Composition, kit, detection method and application for immunoassay

Abstract

The present application belongs to the field of biological immunoassay technology, and specifically discloses a composition for immunoassay, including a first probe and a second probe, wherein the first probe includes a first nucleotide sequence connected to a first protein; the second probe includes a second nucleotide sequence connected to a second protein; the first protein and the second protein can simultaneously recognize and bind to a target molecule, and the first nucleotide sequence and the second nucleotide sequence can be connected by DNA ligase. The present application has at least one of the following beneficial effects: when the composition provided by the present application is used for immunoassay, it has high specificity and high sensitivity, and the first nucleotide sequence and / or the second nucleotide sequence are marked with different sample labels, which can realize high-throughput detection and has a wide range of application value.

Description

Technical Field

[0001] The present application belongs to the technical field of biological immunoassay, and more specifically, it relates to a composition, a kit, a detection method and an application for immunoassay. Background Art

[0002] Immunodiagnosis is a diagnostic method that uses the specific immune reaction between antigens and antibodies to determine the immune status and detect various diseases. Current immunoassay technologies mainly include radioimmunoassay, immunocolloidal gold technology, enzyme-linked immunosorbent assay, chemiluminescent immunoassay, etc. Although radioimmunoassay has high sensitivity, the supplies are expensive and there is radioactive contamination; colloidal gold immunoassay has a fast reaction speed and is easy to operate, but its sensitivity and specificity are poor; although enzyme-linked immunosorbent assay has high sensitivity, the quality of its results depends on the coating matrix, and it is difficult to achieve consistency between batches of solid phase carriers, so the repeatability is poor; chemiluminescent immunoassay has high sensitivity and a high degree of automation, but the luminescence intensity is low, it is difficult to measure, and the instruments and equipment are expensive. Summary of the invention

[0003] For the diagnosis of infectious diseases, the most ideal method is to diagnose pathogens, but some pathogens require high growth conditions, long growth time, and low positive detection rate, which brings certain difficulties to clinical diagnosis. The inventors found that the detection of specific antibodies produced by the body's immunity can make up for the above shortcomings to a certain extent. Therefore, it is urgent to develop antibody detection technology with high specificity, high sensitivity, and high throughput for the diagnosis of infectious diseases.

[0004] Based on this, the present application provides a composition for immune detection. When using the composition for detection, the first protein and the second protein can specifically recognize and bind to the target molecule to form a complex. At this time, the first nucleotide sequence and the second nucleotide sequence are adjacent to each other in space, and an amplifiable DNA sequence is formed through a ligation reaction, which is amplified and detected by real-time PCR, thereby converting the detection of antibodies into DNA detection, thereby realizing quantitative antibody analysis.

[0005] This application is implemented through the following scheme:

[0006] In one aspect, the present application provides a composition for immunoassay, comprising a first probe and a second probe,

[0007] The first probe includes a first nucleotide sequence linked to a first protein;

[0008] The second probe includes a second nucleotide sequence linked to a second protein;

[0009] The first protein and the second protein can simultaneously recognize and bind to the target molecule, and the first nucleotide sequence and the second nucleotide sequence can be connected by DNA ligase.

[0010] The immunodetection composition provided by the present application can be used for immunodetection of target molecules (generally antigens or antibodies). When the first protein and the second protein both recognize the same target molecule at the same time, the first nucleotide sequence probe and the second nucleotide sequence will be adjacent to each other in space, and through DNA ligase, a section of amplifiable DNA sequence (referred to as proximity ligation reaction in the present application) is formed, which is then amplified and detected by real-time PCR. Through the immunodetection composition provided by the present application, the detection of target molecules can be transformed into the detection of DNA, and quantitative analysis can be achieved.

[0011] In the present application, the proximity ligation reaction can only occur when a pair of probes are both bound to the target molecule and are sufficiently close to each other, so this method has very little nonspecific detection. This advantage makes it have higher specificity and detection sensitivity compared with conventional methods.

[0012] In a specific embodiment of the present invention, the first protein and the second protein are antibodies or antigens, or they may be antibody fragments or antigen fragments containing dual recognition sites or multiple recognition sites.

[0013] In a specific embodiment of the present invention, it also includes a template connector, wherein the first partial sequence of the template connector is complementary to the end of the first nucleotide sequence away from the first protein, and the second partial sequence of the template connector is complementary to the end of the second nucleotide sequence away from the second protein.

[0014] In a specific embodiment of the present invention, the first protein is the same as or different from the second protein. For example, the first protein and the second protein are the same: both are antigens that can specifically bind to the antibody to be detected, or both are secondary antibodies of the antibody to be detected; or the first protein and the second protein are different: the first protein is an antigen that can specifically bind to the antibody to be detected, and the second protein is a secondary antibody of the antibody to be detected; or the first protein is a secondary antibody of the antibody to be detected, and the second protein is an antigen that can specifically bind to the antibody to be detected.

[0015] In a specific embodiment of the present invention, the composition further comprises a solid phase carrier. The solid phase carrier can be a plastic product, such as a polystyrene microplate (coated plate); can be a microparticle, such as a magnetic bead; can be a membrane carrier, such as a nitrocellulose membrane (Nc), a glass cellulose membrane, and a nylon membrane.

[0016] In a specific embodiment of the present invention, the solid phase carrier is magnetic beads.

[0017] In a specific embodiment of the present invention, the solid phase carrier is a coated plate.

[0018] In a specific embodiment of the present invention, the magnetic beads are selected from M-270 epoxy magnetic beads or magnetic beads connected with streptavidin.

[0019] In a specific embodiment of the present invention, the target molecule is connected to the solid phase carrier through the first protein or the second protein to form a solid phase carrier-first protein / second protein-target molecule complex, and then the solid phase carrier is used to separate the target molecule more simply and conveniently.

[0020] In a specific embodiment of the present invention, the target molecule is an antibody, the first protein is an antigen that specifically binds to the target molecule, the second protein is a secondary antibody to the target molecule, and the solid phase carrier contains streptavidin; the first protein can specifically recognize and specifically bind to the target molecule; the second protein specifically binds to the target molecule; and the first protein is fixed to the solid phase carrier via biotin-avidin.

[0021] In a specific embodiment of the present invention, the composition further comprises a third protein, and the target molecule is connected to the solid phase carrier through the third protein. The target molecule is connected to the solid phase carrier through the third protein to form a solid phase carrier-third protein-target molecule complex, and then the target molecule is simply and conveniently separated through the solid phase carrier.

[0022] In a specific embodiment of the present invention, when the target molecule is an antibody, the third protein may be an antigen or protein A / G that specifically binds to the target molecule.

[0023] In a specific embodiment of the present invention, the target molecule is an antibody, the first protein is a secondary antibody against the target molecule, the second protein and the third protein are the same and are both antigens, the first protein can specifically recognize and bind to the target molecule; the second protein specifically binds to the target molecule; the third protein is covalently fixed to the solid phase carrier, and the third protein can specifically recognize and bind to the target molecule.

[0024] In a specific embodiment of the present invention, the target molecule is an antibody, the first protein is a secondary antibody against the target molecule, the second protein is an antigen, the third protein is a biotin-labeled antigen, and streptavidin is connected to the solid phase carrier; the first protein can specifically recognize and bind to the target molecule; the second protein specifically binds to the target molecule; the third protein is fixed to the solid phase carrier via biotin-avidin, and the third protein specifically binds to the target molecule.

[0025] In a specific embodiment of the present invention, the target molecule is an antibody, the first protein and the second protein are the same and are both antigens, and the third protein is protein A / G; the first protein and the second protein can specifically recognize and bind to the target molecule; the third protein is fixed on the solid phase carrier and specifically recognizes and binds to the target molecule.

[0026] In a specific embodiment of the present invention, the target molecule is an antibody, the first protein and the second protein are the same, both are secondary antibodies against the target molecule, the third protein is a biotin-labeled antigen, and streptavidin is connected to the solid phase carrier; the first protein and the second protein can specifically recognize and bind to the target molecule; the third protein is fixed to the solid phase carrier through biotin-avidin, and specifically recognizes and binds to the target molecule.

[0027] In the present application, the first nucleotide sequence and / or the second nucleotide sequence may be connected to a sample tag (index primer) sequence for labeling each sample to achieve a high-throughput reaction. The tag sequence may be a sequence in the first nucleotide sequence and / or the second nucleotide sequence, or may be connected to the first nucleotide sequence and / or the second nucleotide sequence by complementary pairing.

[0028] On the other hand, the present application provides a proximity ligation immunoassay method, which comprises the following steps:

[0029] S1: adding the first probe and the second probe to the sample to be tested containing the target molecule, mixing evenly, and incubating;

[0030] S2: In step S1, add template connector, ATP, and DNA ligase for incubation;

[0031] S3: In step S2, PCR primers, DNA polymerase, and dNTPs are added to carry out PCR reaction.

[0032] In a specific embodiment of the present invention, the detection method further comprises a step S0 before step S1: adding a sample to be tested containing the target molecule to the solid phase carrier, and incubating the sample to allow the target molecule to be connected to the solid phase carrier.

[0033] In a specific embodiment of the present invention, the target molecule is an antibody, and the third protein may be an antigen or protein A / G that specifically binds to the target molecule.

[0034] In a specific embodiment of the present invention, both steps S1 and S2 further include magnetic separation.

[0035] In a specific embodiment of the present invention, after step S2, it also includes protease separation protein and magnetic beads.

[0036] In a specific embodiment of the present invention, the protease is selected from one or more of proteinase K, Glu-C protease, Lys-C protease, LysN protease, Asp-N protease and chymosin.

[0037] In a specific embodiment of the present invention, the solid phase carrier is a magnetic bead, and the proximity ligation immunoassay method specifically comprises the following steps:

[0038] S0: Add the sample to be tested containing the target molecule to the magnetic beads connected with the third protein, and incubate to connect the target molecule to the solid phase carrier;

[0039] S1: Add the first probe and the second probe to the sample containing the target molecule and mix them evenly, and incubate them at room temperature for 1 hour on a rotating mixer;

[0040] Magnetic separation: Wash the beads three times with PBST;

[0041] S2: In step S1, add template connector, ATP, and T4 ligase, and incubate at room temperature for 15 min on a rotating mixer;

[0042] Magnetic separation: Wash the beads three times with PBST;

[0043] Protease separation of proteins and magnetic beads: Add 10 μl of protease mixture (final concentration of 0.4 μg / μl Proteinasek, 1× Dream Taq DNA Polymerase Buffer), place in a PCR instrument, and react at 50°C for 15 min and 90°C for 10 min.

[0044] S3: Perform PCR reaction: transfer the product after magnetic separation in step S2 to the qPCR plate, add qPCR mixture (final concentrations are 400 μM dNTP, 0.5 μM PCR-fwd and 0.5 μM PCR-rev, 0.2×SYBR Green, 0.05 U / μl Dream Taq Hot Start DNA Polymerase, 0.02 U / μl Uracil-DNA glycosylasein 1×Dream Taq DNA Polymerase Buffer), and then place the plate into the qPCR instrument. First, the reaction condition is 95°C for 2 min, and then 40 cycles are performed at 95°C for 15 s, 58°C for 30 s, and 72°C for 30 s.

[0045] In a specific embodiment of the present invention, the solid phase carrier is a magnetic bead, the second probe is connected to a sample label (index primer) sequence, and the sample label (index primer) sequence is connected to the second probe by complementary pairing. The proximity ligation immunoassay method specifically comprises the following steps:

[0046] S0: Add the sample to be tested containing the target molecule to the magnetic beads connected with the third protein, and incubate to connect the target molecule to the solid phase carrier;

[0047] S1: Add the first probe and the second probe to the sample containing the target molecule and mix them evenly, and incubate them at room temperature for 1 hour on a rotating mixer;

[0048] Magnetic separation: Wash the beads three times with PBST;

[0049] S2: In step S1, add template connector, ATP, and T4 ligase, and incubate at room temperature for 15 min on a rotating mixer;

[0050] Magnetic separation: Wash the beads three times with PBST;

[0051] S2-A: In step S2, phi29 DNA polymerase and dNTPs were added and incubated at 37°C for 15 min;

[0052] Magnetic separation: Wash the beads three times with PBST;

[0053] Protease separation of proteins and magnetic beads: Add 10 μl of protease mixture (final concentration of 0.4 μg / μl Proteinasek, 1× Dream Taq DNA Polymerase Buffer), place in a PCR instrument, and react at 50°C for 15 min and 90°C for 10 min.

[0054] S3: PCR detection: transfer the product after magnetic separation in step S2 to a qPCR plate, add qPCR mixture (final concentration of 400 μM dNTP, 0.5 μM PCR-fwd2 and 0.5 μM PCR-rev2, 0.2×SYBR Green, 0.05 U / μl Dream Taq Hot Start DNA Polymerase, 0.02 U / μl Uracil-DNA glycosylase in 1×Dream Taq DNA Polymerase Buffer), and then place the plate into a qPCR instrument. First, the reaction conditions were 95°C for 2 min, and then 40 cycles were performed at 95°C for 15 s, 58°C for 30 s, and 72°C for 30 s.

[0055] In a specific embodiment of the present application, the solid phase carrier is a coated plate, and the proximity ligation immunoassay method specifically comprises the following steps:

[0056] S0: Add the sample containing the target molecule to the coated plate to fix the target molecule on the coated plate;

[0057] S1: Add the first probe and the second probe to the sample containing the target molecule and mix them evenly, and incubate them at room temperature for 1 hour on a rotating mixer;

[0058] S2: In step S1, add template connector, ATP, and T4 ligase, and incubate at room temperature for 15 min on a rotating mixer;

[0059] S3: PCR detection: In step S2, add the qPCR mixture (final concentration of 200 μM dNTP, 0.25 μM PCR-fwd and 0.25 μM PCR-rev, 0.1×SYBR Green, 0.025 U / μl Dream Taq Hot Start DNA Polymerase, 0.01 U / μl Uracil-DNA glycosylase in 1×Dream Taq DNA Polymerase Buffer), and then put the plate into the qPCR instrument. First, the reaction condition was 95°C for 2 min, and then 40 cycles were performed at 95°C for 15 s, 58°C for 30 s, and 72°C for 30 s.

[0060] A third aspect of the present application provides a kit, which includes a first probe and a second probe.

[0061] In a specific embodiment of the present application, the kit further comprises magnetic beads, to which a third protein capable of specifically binding to the target molecule is connected.

[0062] The fourth aspect of the present application provides the above-mentioned composition, the above-mentioned detection method, and the use of the above-mentioned kit in antibody detection.

[0063] In a specific embodiment of the present application, the antibody is a novel coronavirus antibody or a human papillomavirus (HPV) antibody.

[0064] The composition provided in the present application has at least one of the following beneficial effects:

[0065] The composition provided in the present application has high specificity and sensitivity when used for immune detection. The first nucleotide sequence and / or the second nucleotide sequence can be labeled with different sample labels to achieve high-throughput detection, and has wide application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 This is a schematic diagram of the first technical route provided in the embodiments of the present application.

[0067] Figure 2 This is a schematic diagram of the second technical route provided in the embodiments of the present application.

[0068] Figure 3 Schematic diagram of the binding mode of antigen, antibody and probe in the M-270 epoxy magnetic beads or streptavidin-based magnetic beads detection analysis provided in the embodiments of the present application; wherein, represents solid phase carrier; ● represents antigen; Table antibody; It represents that the left probe nucleotide sequence and the right probe nucleotide sequence are complementary paired with the connector and connected; Represents an unpaired nucleotide sequence.

[0069] Figure 5 A schematic diagram of the binding mode of antigen, antibody and probe when detecting antibodies with magnetic beads based on streptavidin provided in the embodiments of the present application, wherein a sample tag sequence is introduced; represents a solid phase carrier; represents an antigen; generation It represents that the left probe nucleotide sequence and the right probe nucleotide sequence are complementary paired with the connector and connected; represents an unpaired nucleotide sequence; Figure 7 middle, represents solid phase carrier; ● represents antigen; represents antibody; The representative represents that the left probe nucleotide sequence and the right probe nucleotide sequence are complementary paired with the connector and connected; represents an unpaired nucleotide sequence; Figure 8 middle, represents solid phase carrier; ● represents antigen; represents antibody; The representative represents that the left probe nucleotide sequence and the right probe nucleotide sequence are complementary paired with the connector and connected; Represents an unpaired nucleotide sequence.

[0070] Fig. 9 The target molecule provided in the embodiment of the present application is connected to the magnetic beads through the first protein, and the antibody is detected based on the streptavidin magnetic beads. represents solid phase carrier; ● represents antigen; represents antibody; The representative represents that the left probe nucleotide sequence and the right probe nucleotide sequence are complementary paired with the connector and connected; Represents an unpaired nucleotide sequence

[0071] Fig.10 This is a schematic diagram of the third technical route provided in the embodiments of the present application.

[0072] Fig.11 This is a linear regression equation curve diagram for detecting HPV antibodies in the examples of this application. DETAILED DESCRIPTION

[0073] The technical scheme in the embodiment of the present invention will be clearly and completely described below. Obviously, the described embodiment is only a part of the embodiment of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. If the specific conditions are not specified in the embodiment, it is carried out according to the conditions recommended by the normal conditions or the manufacturers. If the manufacturer is not specified in the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0074] The first nucleotide sequence and the second nucleotide sequence in the present application are mainly used for PCR amplification, so there are no special requirements for the first nucleotide sequence and the second nucleotide sequence, which can be any nucleotide sequence of more than 2 bp. Preferably, the first nucleotide sequence and the second nucleotide sequence are nucleotide sequences of more than 15 bp.

[0075] In the present application, there is no clear definition for the first probe and the second probe, the first nucleotide sequence and the second nucleotide sequence. The nucleotide sequence used to prepare the first probe can also be used to prepare the second probe. The first and second therein do not indicate order, etc., but are only used to distinguish different probes or nucleotide sequences. The meanings of the first, second, etc. at other positions are similar.

[0076] SARS-CoV-2 (2019-nCoV) Spike RBD-mFc Recombinant Protein (Model 40592-V05H, Sino-Biological); SARS-CoV-2 (2019-nCoV) Spike S1-His Recombinant Protein (Model 40591-V08H, Sino-Biological); SARS-CoV / SARS-CoV-2 Spike antibody Chimeric Mab (Model 40150-D001, Sino-Biological); Affinity-purified donkey anti-human IgG (H+L) antibody (AffiniPure Donkey Anti-Human IgG (H+L); Model 709-005-149, Jackson); Affinity-purified donkey anti-rabbit IgG (H+L) antibody (AffiniPure Donkey Anti-Rabbit IgG (H+L); Model 711-005-152, Jackson); AffiniPure Donkey Anti-Mouse IgG (H+L); Model 715-005-150, Jackson; SARS-CoV-2 (2019-nCoV) Spike S1 Rabbit Monoclonal Antibody (Rabbit Mab; Model 40150-R007, Sino-Biological); Human Papilloma Virus type 16 (HPV 16) L1 protein (HPV16; Sino-Biological); Mouse Human Papillomavirus 16 L1 Monoclonal Antibody (HPV16 L1 Antibody, Mouse Mab; Model 68009-MM01, Sino-Biological); Dynabeads Antibody Coupling Kit Kit; Model 14311D, ThermoFisherScientific); Dynabeads MyOne Streptavidin T1; Model 65601, Invitrogen; Protein A / G Magnetic Beads; Model 88802, ThermoFisherScientific; Streptavidin Coated PCR plate (Streptavidin Coated PCR plate; Model SA2120, i.e., coated plate);Biotinylated Sulfo-NHS (EZ-Link Sulfo-NHS-Biotin; Model A39256, ThermoFisherScientific); Dibenzyl Cyclooctyne NHS Ester Model: AF-206-NA, R&D Systems); Sulfosuccinimidyl-6-(biotin)hexanoate (Sulfo-NHS-LC-Biotin; Model: CLK-A124-10; Jena Bioscience); Thermo Fisher Zeba™ Spin Desalting Column (Thermo Fisher Zeba™ Spin Desalting Column; Model 89882, ThermoFisher Scientific); T4 DNA ligase (T4 DNA Ligase; Model EL0014, ThermoFisher Scientific); Proteinase K Solution (Proteinase K Solution; Model AM2546, ThermoFisher Scientific); ATP solution (ATP Solution; Model R0441, ThermoFisher Scientific); Phi29 DNA Polymerase (Phi29DNA Polymerase; Model EP0091, ThermoFisher Scientific). ;

[0077] The nucleic acid sequences involved in the embodiments of the present application are as follows:

[0078] Nucleotide sequence of the first probe (left probe):

[0079] cgcatcgcccttggactacgactgacgaaccgctttgcctgactgatcgctaaatcgtg

[0080] The nucleotide sequence of the second probe (right probe):

[0081] tcgtgtctaaagtccgttaccttgattcccctaaccctcttgaaaaattcggcatcggtga

[0082] PCR-fwd:catcgcccttggactacga

[0083] PCR-rev:gggaatcaaggtaacggactttag

[0084] Connector:tacttagacacgacacgatttagttt

[0085] PCR-fwd2:catcgcccttggactacga

[0086] PCR-rev2:acactctttccctacacgac

[0087] Index Primer 1:acactctttccctacacgacctctctatgagggttaggggaatcaaggtaac

[0088] Index Primer 2:acactctttccctacacgactatcctctgagggttaggggaatcaaggtaac

[0089] Index Primer 3:acactctttccctacacgacgtaaggaggagggttaggggaatcaaggtaac

[0090] Index Primer 4:acactctttccctacacgacactgcatagagggttaggggaatcaaggtaac

[0091] Index Primer 5:acactctttccctacacgacaaggagtagagggttaggggaatcaaggtaac

[0092] Index Primer 6:acactctttccctacacgacctaagcctgagggttaggggaatcaaggtaac

[0093] Index Primer 7:acactctttccctacacgaccgtctaatgagggttaggggaatcaaggtaac

[0094] Index Primer 8:acactctttccctacacgactctctccggagggttaggggaatcaaggtaac

[0095] Index Primer 9:acactctttccctacacgactcgactaggagggttaggggaatcaaggtaac

[0096] Index Primer 10:acactctttccctacacgacttctagctgagggttaggggaatcaaggtaac

[0097] Index Primer 11:acactctttccctacacgaccctagagtgagggttaggggaatcaaggtaac

[0098] Index Primer 12:acactctttccctacacgacgcgtaagagagggttaggggaatcaaggtaac

[0099] In the following embodiments of the present application, magnetic beads and coated plates are used as solid phase carriers for illustration.

[0100] Example 1 Detection of antibodies to the novel coronavirus 2019-nCoV

[0101] Solution 1: Immunoassay for detecting COVID-19 antibodies based on M-270 epoxy magnetic beads

[0102] The technical route in this plan is shown in Figure 1 The binding modes of antigen, antibody and probe are shown in Figure 3 shown.

[0103] The first protein is the secondary antibody against the novel coronavirus 2019-nCoV.

[0104] The second protein is the recombinant protein of antigens 2019-nCoV Spike RBD-mFc (RBD) and 2019-nCoV Spike S1-His (S1), denoted as S1&RBD.

[0105] The third protein is the recombinant protein of antigens 2019-nCoV Spike RBD-mFc (RBD) and 2019-nCoV Spike S1-His (S1), denoted as S1&RBD.

[0106] Magnetic beads: M-270 epoxy magnetic beads.

[0107] 1. Preparation of Proximity Probes

[0108] The nucleotide sequence of the second probe is combined with the antigen S1 & RBD recombinant protein to prepare the right probe, and the nucleotide sequence of the first probe is directly combined with the second anti-human IgG to form the left probe. If necessary, a Tag tag sequence with recognition function can be connected to the first probe or the second probe.

[0109] Covalent coupling of protein / antibody with nucleotide: 10ug S1&RBD and secondary human IgG were reacted with 33.3mol dibenzyl cyclooctyne NHS ester (AF-206-NA, R&D Systems) and 33.3mol Sulfo-NHS-LC-Biotin (DBCO-NHS ester; JenaBioscience) at room temperature for 1 hour. Then the activated recombinant protein S1&RBD and secondary human IgG were passed through 7K MWCOZeba Spin Columns to remove excess biotin and dibenzyl cyclooctyne NHS ester, and purified recombinant protein S1&RBD and secondary human IgG were obtained. A 2.5-fold molar excess of the nucleotide sequence of the second probe modified with azide was added to the purified S1&RBD, and the mixture was incubated overnight at 4°C to prepare the right probe; a 2.5-fold molar excess of the nucleotide sequence of the first probe modified with azide was added to the purified secondary anti-human IgG, and the mixture was incubated overnight at 4°C to prepare the left probe.

[0110] 2. Sample Preparation

[0111] The human-mouse chimeric 2019-nCoV Spike antibody (target molecule) was dissolved in PBS to simulate the samples of COVID-19 patients who had already produced antibodies, and only PBS without antibodies was added to the control group.

[0112] 3. Coupling of Antigen and Magnetic Beads

[0113] Antigen S1 & RBD recombinant protein (third protein) was covalently coupled to M-270 epoxy magnetic beads. The coupling ratio was 5 μg antigen / mg magnetic beads according to the instructions of the M-270 epoxy magnetic beads antibody coupling kit. The magnetic beads were fixed to 10 mg / mL and stored at 4°C.

[0114] 4. Proximity Ligation Reaction

[0115] (1) Four 96-well plates were prepared. Two 96-well plates were added with magnetic beads coated with S1&RBD and spike antibody (referred to as Experiment 1 and Experiment 2). Two 96-well plates were added with magnetic beads coated with S1&RBD and PBS as controls (referred to as Control 1 and Control 2). In Experiment 1 and Experiment 2, 5 μl of sample (3 μl PBS, 1 μl 5% BSA buffer and 1 μl 0.005 μg / μl Spike antibody) was added to each well, and 2.5 μl of 30 ng / μl human IgG left probe and 30 ng / μl S1&RBD right probe were added. In Control 1 and Control 2, 5 μl of sample (3 μl PBS, 1 μl 5% BSA buffer and 1 μl 0.005 μg / μl PBS) was added to each well, and 2.5 μl of 30 ng / μl human IgG left probe and 30 ng / μl S1&RBD right probe were added to each well.

[0116] (2) After mixing, incubate on a rotating mixer at room temperature for 1 h.

[0117] (3) Collect the mixed solution from each 96 wells of each plate into one centrifuge tube, for a total of 4 tubes, and perform magnetic separation. Wash the magnetic beads three times with PBST.

[0118] (4) Add 25 μl of T4 ligation mixture (final concentration: 100 μM ATP, 0.1 μM Connector), 0.05 U / μl T4 ligase, 1× Dream Taq DNA Polymerase Buffer) to each tube and incubate at room temperature for 15 min on a rotating mixer.

[0119] (5) Magnetic separation: wash the magnetic beads three times with PBST.

[0120] 5. Protease Isolation Protein and Magnetic Beads

[0121] Add 10 μl of protease mixture (final concentration: 0.4 μg / μl Proteinase k, 1× DreamTaq DNA Polymerase Buffer) to each tube and place it in a PCR instrument at 50°C for 15 min and 90°C for 10 min.

[0122] 6. PCR reaction

[0123] After magnetic separation, 10 μl of the above product was transferred to a qPCR plate and mixed with 10 μl qPCR mixture (final concentrations of 400 μM dNTP, 0.5 μM PCR-fwd and 0.5 μM PCR-rev), 0.2×SYBR Green, 0.05 U / μl DreamTaq Hot Start DNA Polymerase, 0.02 U / μl Uracil-DNA glycosylase in 1× Dream TaqDNA Polymerase Buffer (all from Thermo Scientific), and then the plate was placed in a qPCR instrument, and the reaction conditions were first 95°C for 2 min, and then 40 cycles were performed at 95°C for 15 s, 58°C for 30 s, and 72°C for 30 s.

[0124] 7. The experimental results are shown in Table 1.

[0125] Table 1 Real-time fluorescence PCR of M-270 epoxy magnetic beads for detecting COVID-19 antibodies

[0126] project Antibody content in sample (μg / well) qPCR CT value Comparison 1 0 20.83 Comparison 2 0 19.35 Test 1 0.005 12.13 Test 2 0.005 11.94

[0127] As can be seen from Table 1, magnetic beads coated with antigens and 0.005 μl of Spike antibodies were added to two 96-well plates respectively (Test 1 and Test 2), and magnetic beads coated with antigens and PBS were added to two 96-well plates respectively as controls (Control 1 and Control 2). After the 96-well samples were mixed into one tube, the CT values ​​measured by adding antibody 2019-nCoV Spike were 12.13 and 11.94, respectively, which were significantly lower than the CT values ​​of 20.83 and 19.35 of the blank control group with PBS added, indicating that the 2019-nCoV Spike antibody can be detected by the antibody detection method of Scheme 1.

[0128] Solution 2: Detection of COVID-19 antibodies using magnetic beads based on streptavidin immunoassay

[0129] The technical route in this plan is shown in Fig.10 The binding modes of antigen, antibody and probe are shown in Figure 3 shown.

[0130] The first protein is the secondary antibody against the novel coronavirus 2019-nCoV.

[0131] The second protein is a recombinant protein of biotinylated antigen S1 & RBD, denoted as biotinylated S1 & RBD.

[0132] The third protein is the recombinant protein of antigens 2019-nCoV Spike RBD-mFc (RBD) and 2019-nCoV Spike S1-His (S1), denoted as S1&RBD.

[0133] Solid phase carrier: streptavidin coated plate (96 transparent wells)

[0134] 1. Preparation of Proximity Probes

[0135] The nucleotide sequence of the second probe is combined with the antigen S1&RBD recombinant protein to prepare the right probe, and the nucleotide of the first probe is directly combined with the secondary anti-human IgG to form a left probe paired with the S1&RBD protein probe. The preparation method is the same as 1 in Scheme 1.

[0136] 2. Biotinylated Antigen

[0137] (1) According to the formula in the EZ-Link Sulfo-NHS-Biotin Kit manual, add 231 μl of ddHO to each tube of Sulfo-NHS-Biotin. 2 O, prepared as 10 mM stock solution.

[0138] (2) According to the instructions of the EZ-Link Sulfo-NHS-Biotin Kit, the antigen S1 & RBD solution was mixed with the Sulfo-NHS-Biotin solution (1 μl of 10 mM Sulfo-NHS-Biotin solution was added for every 10 μg of antigen).

[0139] (3) Incubate at room temperature for 30 minutes.

[0140] (4) The biotinylated antigen was purified by filtration using the Thermo Fisher Zeba™ Spin Desalting Column Kit (the specific purification steps were carried out according to the instruction manual).

[0141] 3. Coupling of biotinylated antigen to streptavidin-coated plate

[0142] (1) Add 10 μl of biotinylated antigen S1 & RBD (protein concentration: 5 ng / μl) to each well of the streptavidin-coated plate and incubate at room temperature for 1 h.

[0143] (2) Add PBST and wash the streptavidin-coated plate three times (automatic plate washer).

[0144] 4. Sample Preparation

[0145] The plasma of healthy people was collected, and different concentration gradients of human-mouse chimeric antibody SARS-CoV Spike were diluted in PBS and plasma respectively to simulate the new coronavirus samples.

[0146] 5. Streptavidin coated plate and sample reaction

[0147] 10 μl of spike antibody samples with different concentration gradients dissolved in plasma and PBS were added to each well of the streptavidin-coated plate, mixed and incubated on a rotating mixer at room temperature for 1 h.

[0148] 6. Proximity Ligation Reaction

[0149] (1) Wash the streptavidin-coated plate three times with PBST.

[0150] (2) Add 10 μl of 10 ng / μl human secondary antibody IgG left probe and 10 μl of 10 ng / μl S1 & RBD protein right probe to each well. Mix well and incubate at room temperature for 1 hour.

[0151] (3) Add PBST and wash the streptavidin-coated plate three times (automatic plate washer).

[0152] (4) Add 20 μl of T4 ligation mixture (same as above) to each reaction and incubate at room temperature for 15 min.

[0153] (5) Add PBST and wash the streptavidin-coated plate three times (automatic plate washer).

[0154] 7. PCR detection

[0155] For qPCR detection, 20 μl of qPCR mixture was added (final concentrations of 200 μM dNTP, 0.25 μM PCR-fwd and 0.25 μM PCR-rev), 0.1×SYBR Green, 0.025 U / μl Dream Taq Hot Start DNA Polymerase, 0.01 U / μl Uracil-DNA glycosylase in 1× Dream Taq DNA Polymerase Buffer (all from Thermo Scientific)), and then the plate was placed in the qPCR instrument, and the reaction conditions were first 95°C for 2 min, and then 40 cycles were performed at 95°C for 15 s, 58°C for 30 s, and 72°C for 30 s.

[0156] 8. The experimental results are shown in Table 2.

[0157] Table 2 Real-time fluorescence PCR results of streptavidin-coated plates for detecting COVID-19 antibodies

[0158]

[0159] As can be seen from Table 2, the antibody 2019-nCoV Spike was added to different tubes in different concentration gradients. It can be seen that as the concentration of the added antibody 2019-nCoV Spike decreased, the CT value gradually increased, indicating that the antibody detection method of scheme 2 is effective in detecting the antibody 2019-nCoV Spike.

[0160] Option 3: Protein A / G-based magnetic bead-based immunoassay for COVID-19 antibody detection

[0161] The technical route of this bill is shown in Figure 2 The binding modes of antigen, antibody and probe are shown in Figure 4 shown.

[0162] The first protein and the second protein are both antigen RBD&S1 recombinant proteins.

[0163] The third protein is Protein A / G.

[0164] Magnetic beads: Ordinary magnetic beads that can bind to protein A / G.

[0165] In this scheme, magnetic beads connected with protein A / G are directly purchased from the market.

[0166] 1. Preparation of Proximity Probes

[0167] The first probe is prepared by combining the antigen S1 & RBD recombinant protein with the first nucleotide sequence; the second probe is prepared by combining the antigen S1 & RBD recombinant protein with the second nucleotide sequence, and the preparation method is the same as 1 in Scheme 1.

[0168] 2. Washing of Protein A / G Magnetic Beads

[0169] (1) Place 50 μl (0.50 mg) of Protein A / G magnetic beads into a 1.5 mL centrifuge tube, add 150 μl of wash buffer, and vortex gently to mix.

[0170] (2) Place the centrifuge tube in a magnetic rack so that the beads accumulate on the side of the tube. Remove and discard the supernatant.

[0171] (3) Add 1 mL of wash buffer to the centrifuge tube. Gently vortex the centrifuge tube for 1 min. Collect the beads using a magnetic rack, and then remove and discard the supernatant.

[0172] (4) Add 50 μl of washing buffer to the centrifuge tube to make the magnetic bead concentration 10 mg / mL.

[0173] 3. Sample Preparation

[0174] The plasma of healthy people was collected, and different concentration gradients of antibodies SARS-CoV Spike rabbit anti-virus were diluted in plasma or PBS to simulate the new coronavirus samples.

[0175] 4. Antibodies in the sample are coupled to magnetic beads

[0176] Prepare a 96-well plate, add 5 μl of sample (plasma / PBS + Spike antibody with different concentration gradients) and 5 μl of magnetic bead mixture (1 μl of washed protein A / G magnetic beads 10 mg / mL + 4 μl of 1% BSA buffer) to each well, mix well and incubate at room temperature for 1 h on a rotating mixer.

[0177] 5. Proximity Ligation Reaction

[0178] (1) Place the 96-well plate in a magnetic plate for magnetic separation and wash the magnetic beads three times with PBST.

[0179] (2) Add 20 μl of 10 ng / μl left and right probe mixture (10 μl 10 ng / μl S1&RBD left probe + 10 μl 10 ng / μl S1&RBD right probe) to each well. Mix well and incubate on a rotating mixer at room temperature for 1 hour.

[0180] (3) Place the beads on a magnetic plate for magnetic separation and wash them three times with PBST.

[0181] (4) Add 25 μl of T4 ligation mixture (final concentration: 100 μM ATP, 0.1 μM Connector, 0.05 U / μl T4 ligase, 1× Dream Taq DNA Polymerase Buffer) to each well and incubate at room temperature for 15 min on a rotating mixer.

[0182] 6.Same as 5 of Plan 1.

[0183] 7.Same as 6 in Plan 1.

[0184] 8. The experimental results are shown in Table 3.

[0185] Table 3 Real-time fluorescence PCR CT values ​​of protein A / G magnetic beads for detecting COVID-19 antibodies

[0186]

[0187]

[0188] As can be seen from Table 3, the rabbit anti-Spike antibody was dissolved in PBS and plasma at different concentration gradients and added to different reaction tubes. As the concentration of the added rabbit anti-Spike antibody decreased, the CT value gradually increased, indicating that the antibody detection method of scheme three is effective in detecting rabbit anti-Spike.

[0189] Scheme 4: Detection of COVID-19 antibodies using magnetic beads based on streptavidin (introduction of index primer)

[0190] The technical route of this solution is shown in Figure 1 The binding modes of antigen, antibody and probe are shown in Figure 5 shown.

[0191] The first protein is the antigen RBD&S1 recombinant protein.

[0192] The second protein is the secondary antibody against the novel coronavirus 2019-nCoV: donkey anti-rabbit IgG (H+L) antibody.

[0193] The third protein is the antigen S1&RBD recombinant protein.

[0194] Magnetic beads: Streptavidin magnetic beads.

[0195] 1. Preparation of Proximity Probes

[0196] The antigen S1 & RBD recombinant protein and the nucleotide sequence of the first probe form the left probe, and the secondary antibody rabbit IgG and the nucleotide sequence of the second probe form the right probe. The preparation method is the same as 1 in Scheme 1.

[0197] 2. The right probe is connected to the Index primer

[0198] 80nM index primer (1, 2, 3...12) and 80nM rabbit IgG right probe were mixed in a ratio of 1:1 and incubated at room temperature for 1 hour. The index primer and the right probe were combined in a complementary form to form the right probe with index primer.

[0199] 3. Biotinylated Antigen

[0200] The specific steps are the same as those in 2 of Scheme 2 of this embodiment.

[0201] 4. Biotinylated antigen coupled to magnetic beads coated with streptavidin

[0202] The specific steps are the same as those in 3 of Scheme 2 of this embodiment.

[0203] 5. Sample Preparation

[0204] The plasma of healthy people was collected, and rabbit anti-SARS-CoV Spike with different concentration gradients were diluted in PBS and plasma respectively to simulate the new coronavirus samples.

[0205] 6. Reaction of magnetic beads with samples

[0206] Prepare a 96-well plate, add 5 μl of a mixture of biotinylated S1 & RBD-bound magnetic beads (0.5 μl of 10 mg / mL magnetic beads + 4.5 μl of 1% BSA buffer) to each well, add 5 μl of samples of rabbit Spike antibodies of different concentration gradients dissolved in plasma and PBS, mix well, and incubate on a rotating mixer at room temperature for 1 h.

[0207] 7. Polymerization and proximity ligation reactions

[0208] (1) Place the 96-well plate in a magnetic plate for magnetic separation and wash the magnetic beads three times with PBST.

[0209] (2) Add 20 μl of 10 ng / μl left and right probe mixture (10 μl of 10 ng / μl rabbit IgG right probe linked to Indexprimer and 10 μl of 10 ng / μl S1 & RBD protein left probe) to each well, mix well, and incubate on a rotating mixer at room temperature for 1 h.

[0210] (3) Twelve samples of the same concentration, each of which was linked to 12 index primers (1, 2, 3...12), were pooled into one centrifuge tube.

[0211] (4) Place the beads on a magnetic plate for magnetic separation and wash them three times with PBST.

[0212] (5) Add 25 μl of T4 ligation mixture (final concentration: 100 μM ATP, 0.1 μM Connector, 0.05 U / μl T4 ligase, 1× Dream Taq DNA Polymerase Buffer) to each well and incubate at room temperature for 15 min on a rotating mixer.

[0213] (6) Place the beads on a magnetic plate for magnetic separation and wash them three times with PBST.

[0214] (7) Add 25 μl of phi29 DNA polymerase mixture (final concentration: 0.1 U / μL phi29 DNA Polymerase, 200 μM dNTP, 10× Reaction Buffer) to each well and incubate at 37°C for 15 min.

[0215] 8. Protease Isolation Protein and Magnetic Beads

[0216] Add 10 μl of protease mixture (final concentration of 0.4 μg / μl Proteinase k, 1× DreamTaq DNA Polymerase Buffer) to each well and place in a PCR instrument at 50°C for 15 min and 90°C for 10 min.

[0217] 9. PCR reaction

[0218] After magnetic separation, the above 10 μl ligation product was transferred to a qPCR plate and mixed with 10 μl qPCR mixture (400 μM dNTP, 0.5 μM PCR-fwd2 and 0.5 μM PCR-rev2), 0.2×SYBR Green, 0.05 U / μl DreamTaq Hot Start DNA Polymerase, 0.02 U / μl Uracil-DNA glycosylase in 1× Dream TaqDNA Polymerase Buffer (all from Thermo Scientific), and then the plate was placed in a qPCR instrument, and the reaction conditions were first 95°C for 2 min, and then 40 cycles were performed under the conditions of 95°C for 15 s, 58°C for 30 s, and 72°C for 30 s.

[0219] 10. The experimental results are shown in Table 4.

[0220] Table 4 Real-time fluorescence PCR CT values ​​of protein A / G magnetic beads for detecting COVID-19 antibodies

[0221] Rabbit anti-Spike antibody content (μg / well) Antibodies dissolved in PBS Antibodies dissolved in plasma <![CDATA[5×10 -2 ]]> 15.70 13.38 <![CDATA[5×10 -3 ]]> 23.87 16.21 <![CDATA[5×10 -4 ]]> 28.08 22.74 0 28.77 27.20

[0222] From Table 4, we can see that the rabbit anti-Spike antibody was dissolved in PBS and plasma at different concentration gradients. The same concentration gradient reaction well had 12 replicates and was mixed into one tube. As the concentration of the rabbit anti-Spike antibody was reduced, the CT value gradually increased, indicating that the antibody detection method of Scheme 4 was effective in detecting rabbit anti-Spike. The introduction of index primer had no effect on the detection of antibodies. The PCR products with different index primers were sent for detection, which could achieve high-throughput detection of different samples.

[0223] Scheme 5: Detection of COVID-19 antibodies using magnetic beads based on streptavidin with different probes

[0224] The technical route of this solution is shown in Figure 1 The binding modes of antigen, antibody and probe are shown in Figure 6-8 shown.

[0225] 1. Preparation of Proximity Probes

[0226] a. Figure 6 As shown, the first protein and the second protein are rabbit IgG, and the third protein is the antigen S1 & RBD recombinant protein; the first probe (left probe) is rabbit IgG connected to the first nucleotide sequence to form the left probe; the second probe (right probe) is rabbit IgG connected to the second nucleotide sequence to form the right probe.

[0227] b. Figure 7 As shown, the first protein is antigen S1 & RBD recombinant protein; the second protein is rabbit IgG, and the third protein is antigen S1 & RBD recombinant protein; the first probe is the antigen S1 & RBD recombinant protein and the first nucleotide sequence to form a left probe, and the second probe is rabbit IgG and the second nucleotide sequence to form a right probe.

[0228] c. Figure 8 As shown, the first protein is rabbit IgG; the second protein is antigen S1&RBD recombinant protein, and the third protein is antigen S1&RBD recombinant protein; the first probe is rabbit IgG and the first nucleotide sequence to form a left probe, and the second probe is the antigen S1&RBD recombinant protein and the second nucleotide sequence to form a right probe.

[0229] 2. Biotinylated Antigen

[0230] The specific steps are the same as those in step 2 of scheme 2 of this embodiment.

[0231] 3. Biotinylated antigen coupled to magnetic beads coated with streptavidin

[0232] The specific steps are the same as those in 3 of Scheme 2 of this embodiment.

[0233] 4. Sample Preparation

[0234] The plasma of healthy people was collected, and rabbit anti-SARS-CoV Spike with different concentration gradients were diluted in PBS and plasma respectively to simulate the new coronavirus samples.

[0235] 5. Reaction of magnetic beads with samples

[0236] Prepare a 96-well plate, add 5 μl of a mixture of biotinylated S1 & RBD-bound magnetic beads (0.5 μl of 10 mg / mL magnetic beads + 4.5 μl of 1% BSA buffer) to each well, add 5 μl of samples of Spike antibodies dissolved in plasma and PBS at different concentration gradients, mix well, and incubate on a rotating mixer at room temperature for 1 h.

[0237] 6. Proximity Ligation Reaction

[0238] (1) Place the 96-well plate in a magnetic plate for magnetic separation and wash the magnetic beads three times with PBST.

[0239] (2) Add 20 μl of 10 ng / μl left and right probe mixture to each well (a, b, c are added to different wells respectively). Mix well and incubate at room temperature for 1 hour on a rotating mixer.

[0240] (3) Place the beads on a magnetic plate for magnetic separation and wash them three times with PBST.

[0241] (4) Add 25 μl of T4 ligation mixture (same as above) to each well and incubate at room temperature for 15 min on a rotating mixer.

[0242] 7. Same as 5 in Scheme 1 of this embodiment.

[0243] 8. Same as 6 in Scheme 1 of this embodiment.

[0244] 9. The experimental results are shown in Table 5.

[0245] Table 5 Real-time fluorescence PCR CT values ​​of different combinations for detecting COVID-19 antibodies

[0246]

[0247] As can be seen from Table 5, the rabbit anti-Spike antibody was dissolved in PBS and plasma at different concentration gradients, and detected with probes a, b, and c respectively. It can be seen that as the concentration of the added rabbit anti-Spike antibody decreased, the CT value gradually increased, indicating that the different probes in scheme five are effective in detecting rabbit anti-Spike.

[0248] Solution 6: Detection of COVID-19 antibodies using magnetic beads based on streptavidin immunoassay

[0249] The technical route in this plan is shown in Figure 1 The binding modes of antigen, antibody and probe are shown in Fig. 9 shown.

[0250] The first protein is the recombinant protein of antigens 2019-nCoV Spike RBD-mFc (RBD) and 2019-nCoV Spike S1-His (S1), denoted as S1&RBD.

[0251] The second protein is the secondary antibody of the new coronavirus 2019-nCoV antibody.

[0252] Magnetic beads: Streptavidin magnetic beads.

[0253] 1. Preparation of the Second Probe

[0254] The nucleotide sequence of the second probe directly binds to the secondary anti-human IgG to form the right probe, and the preparation method is the same as 1 in Scheme 1.

[0255] 2. Biotinylated Antigen

[0256] The specific steps are the same as those in step 2 of scheme 2 of this embodiment.

[0257] 3. Preparation of the First Probe

[0258] According to the above-mentioned method and steps for connecting DNA to protein, the biotinylated antigen is connected to the nucleotide sequence of the first probe to prepare the second probe. The preparation method is the same as step 1 in scheme 1.

[0259] 4. Biotinylated antigen coupled to magnetic beads coated with streptavidin

[0260] The specific steps are the same as 3 in Scheme 2 of this embodiment.

[0261] A 2.5-fold molar excess of the nucleotide sequence of the first probe modified with azide was added to step 3 and the reaction was allowed to proceed overnight.

[0262] 5. Sample Preparation

[0263] Different concentration gradients of human-mouse chimeric antibody SARS-CoV Spike were diluted in PBS to simulate the new coronavirus sample.

[0264] 6. Reaction of magnetic beads with samples

[0265] Prepare a 96-well plate, add 5 μl of a mixture of biotinylated S1 & RBD-bound magnetic beads (0.5 μl of 10 mg / mL magnetic beads + 4.5 μl of 1% BSA buffer) to each well, add 5 μl of samples of Spike antibodies dissolved in plasma and PBS at different concentration gradients, mix well, and incubate on a rotating mixer at room temperature for 1 h.

[0266] 7. Proximity Ligation Reaction

[0267] (1) Place the 96-well plate in a magnetic plate for magnetic separation and wash the magnetic beads three times with PBST.

[0268] (2) Add 20 μl of human secondary antibody IgG right probe solution to each well, with the probe reaction concentration being 10 ng / μl. Mix well and incubate on a rotating mixer at room temperature for 1 h.

[0269] (3) Place the beads on a magnetic plate for magnetic separation and wash them three times with PBST.

[0270] (4) Add 25 μl of T4 ligation mixture (same as above) to each well and incubate at room temperature for 15 min on a rotating mixer.

[0271] 8. Protease Isolation Protein and Magnetic Beads

[0272] Add 10 μl of protease mixture (final concentration of 0.4 μg / μl Proteinase K, 1× DreamTaq DNA Polymerase Buffer) to each well and place in a PCR instrument at 50°C for 15 min and 90°C for 10 min.

[0273] 9. PCR testing

[0274] For qPCR detection, 10 μl of the ligation product was transferred to a qPCR plate and mixed with 10 μl of qPCR mixture (final concentrations of 400 μM dNTP, 0.5 μM PCR-fwd and 0.5 μM PCR-rev), 0.2×SYBR Green, 0.05 U / μl DreamTaq Hot Start DNA Polymerase, 0.02 U / μl Uracil-DNA glycosylase in 1× Dream TaqDNA Polymerase Buffer (all from Thermo Scientific), and then the plate was placed in a qPCR instrument, and the reaction conditions were first 95°C for 2 min, and then 40 cycles were performed at 95°C for 15 s, 58°C for 30 s, and 72°C for 30 s.

[0275] 10. The experimental results are shown in Table 8.

[0276] Table 8 Real-time fluorescence PCR results of streptavidin magnetic beads for detecting COVID-19 antibodies

[0277] Spike antibody content (μg / well) Antibodies dissolved in plasma Antibodies dissolved in PBS <![CDATA[2.5×10 -1 ]]> 19.07 21.27 <![CDATA[2.5×10 -2 ]]> 20.05 22.16 <![CDATA[2.5×10 -3 ]]> 22.27 22.61 0 23.50 25.20

[0278] As can be seen from Table 8, the rabbit anti-Spike antibody was dissolved in PBS and plasma at different concentration gradients and added to different reaction tubes. As the concentration of the rabbit anti-Spike antibody added decreased, the CT value gradually increased, indicating that the antibody detection method of Scheme 6 is effective in detecting Spike.

[0279] Example 2 Human papillomavirus HPV antibody detection

[0280] Solution 1: Immunoassay for detecting HPV16 antibodies based on different probes

[0281] The technical route of this solution is shown in Figure 1 The binding modes of antigen, antibody and probe are shown in Figure 6-7 shown.

[0282] 1. Preparation of Proximity Probes

[0283] a. Figure 6 As shown, the first protein and the second protein are human IgG; the third protein is HPV 16L1 antigen; the first probe is a left probe formed by connecting human IgG to a first nucleotide sequence; and the second probe is a right probe formed by connecting human IgG to a second nucleotide sequence.

[0284] b. Figure 7As shown, the first protein is HPV 16L1 antigen, the second protein is human IgG; the third protein is HPV 16L1 antigen; the first probe is the left probe formed by HPV 16L1 antigen and the first nucleotide sequence; the second probe is the right probe formed by Anti-human IgG and the second nucleotide sequence.

[0285] c. Figure 8 As shown, the first protein is human IgG, the second protein is HPV 16L1 antigen; the third protein is HPV 16L1 antigen; the first probe is the left probe formed by human IgG and the first nucleotide sequence; the second probe is the right probe formed by HPV 16L1 antigen and the second nucleotide sequence.

[0286] 2. Biotinylated Antigen

[0287] The specific steps are the same as those in step 2 of scheme 2 of this embodiment.

[0288] 3. Biotinylated antigen coupled to magnetic beads coated with streptavidin

[0289] The specific steps are the same as those in 3 of Scheme 2 of this embodiment.

[0290] 4. Sample Preparation

[0291] Whole blood was collected from two volunteers who had received HPV quadrivalent vaccine (containing HPV6, 11, 16 and 18 proteins) and two volunteers who had not received HPV quadrivalent vaccine. The blood was centrifuged at 2000g for 2 minutes and the supernatant serum was obtained. The basic information of the four volunteers is as follows:

[0292] serial number gender age Vaccination Vaccination date Are there other symptoms? A male 36 years old no none none B female 25 years old no none none C male 25 years old yes 2018-01 none D female 30 years old yes 2020-04 none

[0293] 5. Reaction of magnetic beads with samples

[0294] Prepare a 96-well plate, add 5 μl of a mixture of biotinylated HPV16 L1-bound magnetic beads (0.5 μl of 10 mg / mL magnetic beads and 4.5 μl of 1% BSA buffer) to each well, add 5 μl of serum sample respectively, mix well, and incubate on a rotating mixer at room temperature for 1 h.

[0295] 6. Proximity Ligation Reaction

[0296] (1) Place the 96-well plate in a magnetic plate for magnetic separation and wash the magnetic beads three times with PBST.

[0297] (2) Add 20 μl of 10 ng / μl left and right probe mixture to each well (probes a, b and c are added to different wells respectively). Mix well and incubate on a rotating mixer at room temperature for 1 hour.

[0298] (3) Place the beads on a magnetic plate for magnetic separation and wash them three times with PBST.

[0299] (4) Add 25 μl of T4 ligation mixture (100 μM ATP, 0.1 μM Connector, 0.05 U / μl T4 ligase, 1× Dream Taq DNA Polymerase Buffer) to each reaction and incubate at room temperature for 15 min on a rotating mixer.

[0300] 7.Same as 5 of Plan 1.

[0301] 8.Same as 6 in Plan 1.

[0302] 9. The experimental results are shown in Table 6.

[0303] Table 6 Real-time fluorescence PCR CT values ​​of different combinations for detecting HPV 16 antibodies

[0304]

[0305] As can be seen from Table 6, when 4 human plasma samples were tested using probe combinations a, b, and c, the CT values ​​of people who had received the HPV quadrivalent vaccine were significantly lower than those of people who had not received the HPV quadrivalent vaccine, indicating that the HPV16 antibodies in the human body increased after vaccination, which is in line with the law. This shows that the detection method of the antibody probe combination a, b, and c of Scheme 1 of this embodiment is effective in detecting HPV16 antibodies in human blood.

[0306] Solution 2: Protein A / G-based magnetic bead-based HPV16 antibody immunoassay

[0307] The technical route of this solution is shown in Figure 2 The binding modes of antigen, antibody and probe are shown in Figure 4 shown.

[0308] 1. Preparation of Proximity Probes

[0309] The first probe is prepared by combining the antigen HPV16 L1 recombinant protein with the first nucleotide sequence; the second probe is prepared by combining the antigen HPV16 L1 recombinant protein with the second nucleotide sequence.

[0310] 2. Washing of Protein A / G Magnetic Beads

[0311] The specific steps are the same as those in 2 of Scheme 3 in Example 1.

[0312] 3. Sample Preparation

[0313] Whole blood was collected from two volunteers who had received the HPV quadrivalent vaccine and two volunteers who had not received the HPV quadrivalent vaccine, and the blood was centrifuged at 2000 g for 2 min to obtain the supernatant serum (the same for the four volunteers).

[0314] 4. Antibodies in the sample are coupled to magnetic beads

[0315] To each reaction, 5 μl of sample and 5 μl of magnetic bead mixture (1 μl of washed protein A / G magnetic beads 10 mg / mL and 4 μl of 1% BSA buffer) were added, mixed well, and incubated on a rotating mixer at room temperature for 1 h.

[0316] 5. Proximity Ligation Reaction

[0317] (1) Place the 96-well plate in a magnetic plate for magnetic separation and wash the magnetic beads three times with PBST.

[0318] (2) Add 20 μl of 10 ng / μl left and right probe mixture (10 μl 10 ng / μl HPV16 L1 left probe + 10 μl 10 ng / μl HPV16 L1 right probe) to each reaction. Mix well and incubate on a rotating mixer at room temperature for 1 hour.

[0319] (3) Place the beads on a magnetic plate for magnetic separation and wash them three times with PBST.

[0320] To each reaction, 25 μl of T4 ligation mixture (final concentration of 100 μM ATP, 0.1 μM Connector, 0.05 U / μl T4 ligase, 1× Dream Taq DNA Polymerase Buffer) was added and incubated at room temperature for 15 min on a rotating mixer.

[0321] 6. Same as 5 of Scheme 1 in Example 1.

[0322] 7. Same as 6 of Scheme 1 in Example 1.

[0323] 8. The experimental results are shown in Table 7.

[0324] Table 7 Real-time fluorescence PCR CT values ​​of protein A / G magnetic beads for detecting HPV 16 antibodies

[0325] Sample No. Whether to receive HPV quadrivalent vaccine qPCR CT value A yes 16.55 B yes 17.34 C no 20.36 D no 19.44

[0326] As can be seen from Table 7, the protein A / G magnetic bead test detected 4 human plasma samples respectively, and the CT values ​​of people who received the HPV quadrivalent vaccine were significantly lower than those who did not receive the HPV quadrivalent vaccine, indicating that the HPV16 antibodies in the human body increased after vaccination, which is in line with the law. This shows that the antibody detection method of scheme 2 of this embodiment is effective in detecting HPV16 antibodies in human blood.

[0327] Application Examples

[0328] In this application example, the mouse human papillomavirus type 16 L1 monoclonal antibody HPV16 is used as a standard sample to prepare a standard curve as an example to illustrate the use of the composition in the present application to quantitatively detect the concentration of the antibody.

[0329] In this application example, the first probe is an affinity-purified donkey anti-mouse IgG (H+L) antibody that binds to a first nucleotide sequence, and the second probe is an antigen HPV16 L1 recombinant protein that binds to a second nucleotide sequence. Figure 4 The combination of antigen, antibody and probe was tested by the method in Scheme 2 of Example 2.

[0330] Among them, the preparation of the sample in step 3 of scheme 2 is as follows, and the other experimental steps are the same as scheme 2 in embodiment 2.

[0331] 3. Sample preparation: plasma from healthy people was collected, and mouse HPV16 antibodies of different concentration gradients were diluted in the plasma to simulate HPV samples. The concentrations of HPV16 antibodies in 5 μl samples were 0, 0.0002, 0.002, 0.02, and 0.2 μg / μl, respectively. The experimental results are shown in Table 9.

[0332] Table 9 Real-time fluorescence PCR CT values ​​of protein A / G magnetic beads for detecting plasma HPV 16 antibodies

[0333] Antibody content in sample (μg / μl) qPCR CT value 0.2 11.46 0.02 14.02 0.002 16.31 0.0002 19.11 0 21.20

[0334] A standard curve was established based on the concentration of the standard samples. Fig.11 As shown, R 2 It is 0.9986, which meets the requirements. According to the standard curve, the antibody concentration of the sample to be tested can be determined.

[0335] The examples in this application are all about the detection of antibodies. For the detection of antigens, those skilled in the art can reasonably design according to the ideas in this application.

[0336] In summary, the composition provided by the present application is applied to antigen and antibody detection. Based on the spatial proximity of the first nucleotide sequence and the second nucleotide sequence in the composition, an amplifiable DNA sequence can be formed through a ligation reaction, and then amplified and detected by real-time PCR, thereby converting the detection of antigens and antibodies into the detection of DNA, and realizing quantitative antigen and antibody analysis with higher specificity and sensitivity, and without the need for expensive instruments and equipment, which can greatly reduce costs. The sample label sequence is connected to the probe, and then sequencing can achieve high-throughput detection, which can be used for large-scale screening, etc.

[0337] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application. Sequence Listing <110> Shenzhen Mima Technology Co., Ltd. <120> Composition, kit, detection method and application for immunoassay <160> 19 <170> SIPOSequenceListing 1.0 <210> 1 <211> 59 <212> DNA <213> Artificial Sequence <400> 1 cgcatcgccc ttggactacg actgacgaac cgctttgcct gactgatcgc taaatcgtg 59 <210> 2 <211> 61 <212> DNA <213> Artificial Sequence <400> 2 tcgtgtctaa agtccgttac cttgattccc ctaaccctct tgaaaaattc ggcatcggtg 60 a 61 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <400> 3 catcgccctt ggactacga 19 <210> 4 <211> twenty four <212> DNA <213> Artificial Sequence <400> 4 gggaatcaag gtaacggact ttag 24 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <400> 5 tacttagaca cgacacgatt tagttt 26 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <400> 6 catcgccctt ggactacga 19 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 acactctttc cctacacgac 20 <210> 8 <211> 52 <212> DNA <213> Artificial Sequence <400> 8 acactctttc cctacacgac ctctctatga gggttagggg aatcaaggta ac 52 <210> 9 <211> 52 <212> DNA <213> Artificial Sequence <400> 9 acactctttc cctacacgac tatcctctga gggttagggg aatcaaggta ac 52 <210> 10 <211> 52 <212> DNA <213> Artificial Sequence <400> 10 acactctttc cctacacgac gtaaggagga gggttagggg aatcaaggta ac 52 <210> 11 <211> 52 <212> DNA <213> Artificial Sequence <400> 11 acactctttc cctacacgac actgcataga gggttagggg aatcaaggta ac 52 <210> 12 <211> 52 <212> DNA <213> Artificial Sequence <400> 12 acactctttc cctacacgac aaggagtaga gggttagggg aatcaaggta ac 52 <210> 13 <211> 52 <212> DNA <213> Artificial Sequence <400> 13 acactctttc cctacacgac ctaagcctga gggttagggg aatcaaggta ac 52 <210> 14 <211> 52 <212> DNA <213> Artificial Sequence <400> 14 acactctttc cctacacgac cgtctaatga gggttagggg aatcaaggta ac 52 <210> 15 <211> 52 <212> DNA <213> Artificial Sequence <400> 15 acactctttc cctacacgac tctctccgga gggttagggg aatcaaggta ac 52 <210> 16 <211> 52 <212> DNA <213> Artificial Sequence <400> 16 acactctttc cctacacgac tcgactagga gggttagggg aatcaaggta ac 52 <210> 17 <211> 52 <212> DNA <213> Artificial Sequence <400> 17 acactctttc cctacacgac ttctagctga gggttagggg aatcaaggta ac 52 <210> 18 <211> 52 <212> DNA <213> Artificial Sequence <400> 18 acactctttc cctacacgac cctagagtga gggttagggg aatcaaggta ac 52 <210> 19 <211> 52 <212> DNA <213> Artificial Sequence <400> 19 acactctttc cctacacgac gcgtaagaga gggttagggg aatcaaggta ac 52

Claims

1. A composition for immunoassay, It is characterized in that comprising a first probe and a second probe, The first probe includes a first nucleotide sequence linked to a first protein; The second probe includes a second nucleotide sequence linked to a second protein; The first protein and the second protein can simultaneously recognize and bind to the target molecule, the first nucleotide sequence and the second nucleotide sequence can be connected by DNA ligase, the first nucleotide sequence and the second nucleotide sequence will be adjacent to each other in space, and an amplifiable DNA sequence is formed by the DNA ligase.

2. The composition according to claim 1, It is characterized in that It also includes a template connector, wherein a first partial sequence of the template connector is complementary to an end of the first nucleotide sequence away from the first protein, and a second partial sequence of the template connector is complementary to an end of the second nucleotide sequence away from the second protein.

3. The composition according to claim 1, It is characterized in that The first protein is the same as or different from the second protein.

4. The composition according to claim 1, It is characterized in that The composition further comprises a solid carrier.

5. The composition according to claim 4, It is characterized in that The solid phase carrier is a magnetic bead or a coated plate.

6. The composition according to claim 5, It is characterized in that The target molecule is captured on the solid phase carrier through the first protein or the second protein.

7. The composition according to claim 6, It is characterized in that The target molecule is an antibody, the first protein is an antigen that specifically binds to the target molecule, the second protein is a secondary antibody to the target molecule, and the solid phase carrier contains streptavidin; the first protein can specifically recognize and specifically bind to the target molecule; the second protein specifically binds to the target molecule; and the first protein is fixed to the solid phase carrier via biotin-avidin.

8. The composition according to claim 5, It is characterized in that The composition further comprises a third protein, and the target molecule is connected to the solid phase carrier through the third protein.

9. The composition according to claim 8, It is characterized in that The target molecule is an antibody, the first protein is a secondary antibody against the target molecule, the second protein is the same as the third protein, and both are antigens; the first protein can specifically recognize and bind to the target molecule; The second protein specifically binds to the target molecule; the third protein is covalently fixed on the solid phase carrier, and the third protein can specifically recognize and bind to the target molecule.

10. The composition according to claim 8, It is characterized in that The target molecule is an antibody, the first protein is a secondary antibody against the target molecule, the second protein is an antigen, the third protein is a biotin-labeled antigen, and streptavidin is connected to the solid phase carrier; the first protein can specifically recognize and bind to the target molecule; The second protein specifically binds to the target molecule; the third protein is fixed on the solid phase carrier through biotin-avidin, and the third protein specifically binds to the target molecule.

11. The composition according to claim 8, It is characterized in that The target molecule is an antibody, the first protein and the second protein are the same, both are antigens, and the third protein is protein A / G; the first protein and the second protein can specifically recognize and bind to the target molecule; The third protein is fixed on the solid phase carrier, and specifically recognizes and binds to the target molecule.

12. The composition according to claim 8, It is characterized in that The target molecule is an antibody, the first protein and the second protein are the same, both are secondary antibodies against the target molecule, the third protein is a biotin-labeled antigen, and the surface of the solid phase carrier has streptavidin; the first protein and the second protein can specifically recognize and bind to the target molecule; The third protein is fixed on the solid phase carrier through biotin-avidin, and specifically recognizes and binds to the target molecule.

13. A composition according to any one of claims 1 to 12, It is characterized in that The first nucleotide sequence and / or the second nucleotide sequence is connected to a sample label sequence for labeling each sample, and the sample label sequence is connected to the first nucleotide sequence and / or the second nucleotide sequence in a complementary manner.

14. A kit, It is characterized in that The kit comprises the composition of any one of claims 1-13.

15. Use of the composition described in any one of claims 1 to 13 in the preparation of a kit for detecting antibodies against the new coronavirus or antibodies against human papillomavirus (HPV).

Images