Antibodies that bind to CD3ε

By generating and optimizing nucleic acid libraries of antibodies or antibody fragments containing specific CDR regions, the challenge of balancing immune effects and efficacy in therapeutic antibody design is solved, and single-domain antibodies with high affinity and specificity are used to treat cancer and viral infections.

CN115023440BActive Publication Date: 2025-09-12TWIST BIOSCIENCE CORP
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202080081338.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2019-12-09
Filing Date
2020-09-23
Publication Date
2025-09-12
Estimated Expiration
2040-09-23

AI Technical Summary

Technical Problem

Existing therapeutic antibody designs face the challenge of balancing immune effects and efficacy, and there is a demand for the development of single-domain antibodies such as VHH antibodies in therapeutic applications.

Method used

Provide antibodies or antibody fragments containing CDR regions with specific amino acid sequence identity, optimize the binding affinity and specificity of single-domain antibodies such as VHH antibodies through nucleic acid library generation methods, including variant sequences encoding heavy and light chain variable regions, and enrich high-affinity antibodies using phage display and panning technology.

Benefits of technology

Single-domain antibodies that bind to antigens with high affinity have been achieved, improving the therapeutic effects of treating cancer and viral infections and enhancing the functional activity and specificity of antibodies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115023440B_ABST
    Figure CN115023440B_ABST
Patent Text Reader

Abstract

Provided herein are methods and compositions related to libraries of variant nucleic acids encoding antibodies, including single domain antibodies. Libraries generated using the methods described herein have improved characteristics, including improved binding affinity. Libraries described herein include variegated libraries comprising nucleic acids each encoding a predetermined variant of at least one predetermined reference nucleic acid sequence. Protein libraries generated when the nucleic acid libraries are translated are further described herein. Cell libraries expressing the variegated nucleic acid libraries described herein are further described herein.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-references

[0002] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 904,620, filed September 23, 2019, U.S. Provisional Patent Application No. 62 / 935,603, filed November 14, 2019, and U.S. Provisional Patent Application No. 62 / 945,761, filed December 9, 2019, each of which is incorporated by reference in its entirety. Background Art

[0003] Antibodies have the ability to bind to biological targets with high specificity and affinity. However, the design of therapeutic antibodies is challenging due to the need to balance immune effects with efficacy. Single-domain antibodies, such as VHH antibodies, have several beneficial features. Therefore, there is a need to develop compositions and methods for producing antibodies, such as VHH antibodies, for use in therapeutics.

[0004] Incorporation by reference

[0005] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. Summary of the Invention

[0006] Provided herein are antibodies or antibody fragments comprising: a CDRH1 comprising an amino acid sequence at least about 90% identical to the amino acid sequence shown in SEQ ID NO: 152 or SEQ ID NO: 155; a CDRH2 comprising an amino acid sequence at least about 90% identical to the amino acid sequence shown in SEQ ID NO: 153 or SEQ ID NO: 156; and a CDRH3 comprising an amino acid sequence at least about 90% identical to the amino acid sequence shown in SEQ ID NO: 154 or SEQ ID NO: 157. Further provided herein are antibodies or antibody fragments further comprising: CDRL1 comprising an amino acid sequence at least about 90% identical to the amino acid sequence shown in SEQ ID NO: 158 or SEQ ID NO: 161; CDRL2 comprising an amino acid sequence at least about 90% identical to the amino acid sequence shown in SEQ ID NO: 159 or SEQ ID NO: 162; and CDRL3 comprising an amino acid sequence at least about 90% identical to the amino acid sequence shown in SEQ ID NO: 160 or SEQ ID NO: 163.

[0007] Provided herein are methods of treating cancer comprising administering an antibody or antibody fragment described herein.

[0008] Provided herein are methods of treating viral infections comprising administering an antibody or antibody fragment described herein.

[0009] Provided herein are nucleic acid libraries comprising: a plurality of sequences comprising nucleic acids that, when translated, encode antibodies or antibody fragments, wherein each sequence in the plurality of sequences comprises a variant sequence encoding a CDR1, CDR2, or CDR3 on a heavy chain variable region (VH) or a CDR1, CDR2, or CDR3 on a light chain variable region (VL); wherein the library comprises at least 30,000 variant sequences; and wherein the antibodies or antibody fragments are expressed with a K of less than 100 nM. DBinds to its antigen. Further provided herein are nucleic acid libraries, wherein the antibodies are single-domain antibodies. Further provided herein are nucleic acid libraries, wherein the single-domain antibodies are VHH antibodies. Further provided herein are nucleic acid libraries, wherein the antibodies bind to TIGIT. Further provided herein are nucleic acid libraries, wherein the heavy chain variable region, when translated, comprises an amino acid sequence having at least about 90% identity to the amino acid sequence shown in SEQ ID NO: 84-SEQ ID NO: 100. Further provided herein are nucleic acid libraries, wherein the light chain variable region, when translated, comprises an amino acid sequence having at least about 90% identity to the amino acid sequence shown in SEQ ID NO: 101-SEQ ID NO: 117. Further provided herein are nucleic acid libraries, wherein the CDR1, CDR2, or CDR3 on the heavy chain variable region comprises an amino acid sequence having at least about 90% identity to the amino acid sequence shown in any one of SEQ ID NO: 67-SEQ ID NO: 83 or SEQ ID NO: 118-SEQ ID NO: 128. Further provided herein are nucleic acid libraries, wherein the CDR1, CDR2, or CDR3 on the light chain variable region comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence set forth in any one of SEQ ID NO: 129-SEQ ID NO: 137. Further provided herein are nucleic acid libraries, wherein the antibodies bind to CD47. Further provided herein are nucleic acid libraries, wherein the antibodies bind to CD3 epsilon. Further provided herein are nucleic acid libraries, wherein the heavy chain variable region, when translated, comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence set forth in SEQ ID NO: 138-SEQ ID NO: 141. Further provided herein are nucleic acid libraries, wherein the light chain variable region, when translated, comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence set forth in SEQ ID NO: 142-SEQ ID NO: 145. Further provided herein are nucleic acid libraries, wherein the nucleic acid libraries comprise at least 50,000 variant sequences. Further provided herein are nucleic acid libraries, wherein the nucleic acid libraries comprise at least 100,000 variant sequences. Further provided herein is a nucleic acid library, wherein the nucleic acid library comprises at least 10 5 The present invention further provides a nucleic acid library, wherein the nucleic acid library has at least 10 9 Theoretical diversity of sequences.

[0010] Provided herein is a nucleic acid library comprising: a plurality of sequences comprising nucleic acids that, when translated, encode single-domain antibodies, wherein each sequence in the plurality of sequences comprises a variant sequence encoding a CDR1, CDR2, or CDR3 on a heavy chain variable region (VH); wherein the library comprises at least 30,000 variant sequences; and wherein the antibodies or antibody fragments are expressed with a K of less than 100 nM. D Binds to its antigen. Further provided herein is a nucleic acid library, wherein the length of the VH when translated is about 90 to about 100 amino acids. Further provided herein is a nucleic acid library, wherein the length of the VH when translated is about 100 to about 400 amino acids. Further provided herein is a nucleic acid library, wherein the length of the VH is about 270 to about 300 base pairs. Further provided herein is a nucleic acid library, wherein the length of the VH is about 300 to about 1200 base pairs. Further provided herein is a nucleic acid library, wherein the single-domain antibody is a VHH antibody. Further provided herein is a nucleic acid library, wherein the antibody binds to TIGIT. Further provided herein is a nucleic acid library, wherein the CDR1, CDR2 or CDR3 on the heavy chain variable region comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in any one of SEQ ID NO: 67-SEQ ID NO: 83 or SEQ ID NO: 118-SEQ ID NO: 128. Further provided herein are nucleic acid libraries, wherein the heavy chain variable region, when translated, comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence set forth in any one of SEQ ID NO: 84 to SEQ ID NO: 100. Further provided herein are nucleic acid libraries, wherein the CDR3 on the heavy chain variable region comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence set forth in any one of SEQ ID NO: 101 to SEQ ID NO: 117. Further provided herein are nucleic acid libraries, wherein the antibodies bind to CD47. Further provided herein are nucleic acid libraries, wherein the antibodies bind to CD3 epsilon. Further provided herein are nucleic acid libraries, wherein the heavy chain variable region, when translated, comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence set forth in SEQ ID NO: 138 to SEQ ID NO: 141. Further provided herein are nucleic acid libraries, wherein the nucleic acid libraries comprise at least 50,000 variant sequences. Further provided herein are nucleic acid libraries, wherein the nucleic acid libraries comprise at least 100,000 variant sequences. Further provided herein is a nucleic acid library, wherein the nucleic acid library comprises at least 10 5 The present invention further provides a nucleic acid library, wherein the nucleic acid library has at least 10 9 Theoretical diversity of sequences.

[0011] Provided herein is a method for generating a nucleic acid library encoding single domain antibodies, comprising: (a) providing a predetermined sequence encoding: i. a first plurality of polynucleotides, wherein each polynucleotide in the first plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR1 on the heavy chain; ii. a second plurality of polynucleotides, wherein each polynucleotide in the second plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR2 on the heavy chain; iii. a third plurality of polynucleotides, wherein each polynucleotide in the third plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR3 on the heavy chain; and (b) mixing the first plurality of polynucleotides, the second plurality of polynucleotides, and the third plurality of polynucleotides to form the nucleic acid library of variant nucleic acids encoding the single domain antibodies, wherein at least about 70% of the variant nucleic acids encode variants of the single domain antibodies with a K of less than 100 nM. D A single domain antibody that binds to its antigen. Further provided herein is a method for generating a nucleic acid library, wherein the single domain antibody comprises one heavy chain variable domain. Further provided herein is a method for generating a nucleic acid library, wherein the single domain antibody is a VHH antibody. Further provided herein is a method for generating a nucleic acid library, wherein the single domain antibody binds to TIGIT. Further provided herein is a method for generating a nucleic acid library, wherein the single domain antibody comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence shown in any one of SEQ ID NO: 84-SEQ ID NO: 100 or SEQ ID NO: 138-SEQ ID NO: 141. Further provided herein is a method for generating a nucleic acid library, wherein the single domain antibody binds to CD47. Further provided herein is a method for generating a nucleic acid library, wherein the nucleic acid library comprises at least 50,000 variant sequences. Further provided herein is a method for generating a nucleic acid library, wherein the nucleic acid library comprises at least 100,000 variant sequences. Further provided herein is a method for generating a nucleic acid library, wherein the nucleic acid library comprises at least 10 5 The present invention further provides a method for generating a nucleic acid library, wherein the nucleic acid library comprises at least one sequence encoding the single domain antibody, the single domain antibody having a K of less than 75 nM. D Further provided herein is a method for generating a nucleic acid library, wherein the nucleic acid library comprises at least one sequence encoding a single domain antibody that binds to an antigen with a K of less than 50 nM. D Further provided herein is a method for generating a nucleic acid library, wherein the nucleic acid library comprises at least one sequence encoding a single domain antibody that binds to an antigen with a K of less than 25 nM. DFurther provided herein is a method for generating a nucleic acid library, wherein the nucleic acid library comprises at least one sequence encoding the single domain antibody that binds to the antigen with a K of less than 10 nM. D Binds to an antigen. Further provided herein is a method for generating a nucleic acid library, wherein the nucleic acid library has at least 10 9 Theoretical diversity of sequences. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 A diagram illustrating the steps of an exemplary processing workflow for gene synthesis as disclosed herein is presented.

[0013] Figure 2 An example of a computer system is shown.

[0014] Figure 3 is a block diagram illustrating the architecture of a computer system.

[0015] Figure 4 is a diagram illustrating a network configured to incorporate multiple computer systems, multiple cellular phones and personal data assistants, and network attached storage (NAS).

[0016] Figure 5 is a block diagram of a multiprocessor computer system that uses a shared virtual address memory space.

[0017] Figure 6-Figure 7 The TIGIT affinity distribution of the VHH library is depicted, depicting affinity thresholds from 20 to 4000 ( Figure 6 ) or an affinity threshold between 20 and 1000 ( Figure 7 Of the 140 VHH binders, 51 variants were <100 nM and 90 variants were <200 nM.

[0018] Figure 8 Plots of the CDR3 counts per length are depicted for "VHH library", "VHH shuffling" and "VHH h shuffled library".

[0019] Figure 9 Depicted is a graph of a TIGIT:CD155 blocking assay of a TIGIT VHH Fc binder. The concentration of the TIGIT VHH Fc binder in nanomolar (nM) is on the x-axis, and the relative HRP signal is on the y-axis.

[0020] Figure 10Depicted is the CD47 affinity profile of CD47 VHH Fc binders. Affinity thresholds (monovalent KD) for the "VHH Ratio" library (horizontal bar graph), the "VHH Shuffled" library (black bar graph), and the "VHH h Shuffled" library (dotted bar graph) are on the x-axis, and counts are on the y-axis.

[0021] Figure 11 Depicted is a graph of a CD47-SIRPα inhibition assay of a CD47 VHH Fc conjugate. The concentration of the CD47 VHH Fc conjugate in nanomolar (nM) is on the x-axis, and the relative HRP signal is on the y-axis.

[0022] Figures 12A-12B Depicted is a graph of FACS analysis of GLP1R-43-77 ( Figure 12A ) and dose curves and specificity plots ( Figure 12B ).

[0023] Figures 13A-13B Depicted is a FACS analysis of CRTH2-41-51 ( Figure 13A ) and dose curves and cAMP activity diagrams ( Figure 13B ).

[0024] Figures 14A-14B The dose curve of CRTH2-44-59 is depicted ( Figure 14A ) and FACS analysis diagram ( Figure 14B ).

[0025] Figures 15A-15E Depicted are FACS analysis graphs of cell binding measured by mean fluorescence intensity (MFI) of an 8-point titration of CRTH2R IgG using CRTH2-74, CRTH2-24, CRTH2-28, CRTH2-39, CRTH2-19, CRTH2-9, CRTH2-8, CRTH2-27, CRTH2-45, CRTH2-35, CRTH2-50, CRTH2-66, CRTH2-57, CRTH2-32, CRTH2-15, CRTH2-25, CRTH2-42, CRTH2-55, CRTH2-60, and CRTH2-70.

[0026] Figure 16A Depicted are exemplary gated dot plots showing CRTH2-27 binding at 100 nM.

[0027] Figure 16B Depicted are exemplary APC histograms showing CRTH2-27 binding at 100 nM.

[0028] Figure 17ABinding analysis as in the previous figure using the comparator antibody gPCR-51 is depicted.

[0029] Figure 17B Binding analysis as in the previous figure using the comparator antibody gPCR-52 is depicted.

[0030] Figures 18A-18B Binding curves of IgG to CRTH2-9, CRTH2-27, CRTH2-50, CRTH2-32, and CRTH2-42 are depicted, which have functional effects in the cAMP assay.

[0031] Figure 19A Depicted are the CRTH2R cAMP assay results for all antibodies tested at 300 nM, 100 nM, and 33 nM.

[0032] Figure 19B Depicted are the CRTH2R cAMP assay results for all antibodies tested at 33 nM.

[0033] Figure 20 The negative allosteric effect seen in five CRTH2R IgGs (CRTH2-9, CRTH2-27, CRTH2-50, CRTH2-32, and CRTH2-42) is shown.

[0034] Figures 21A-21C A control experiment of an allosteric modulator is depicted, showing that the comparator antibody 52 is a positive allosteric modulator.

[0035] Figures 22A-22D CRTH2R activity in a β-arrestin recruitment assay with CRTH2R IgG is depicted.

[0036] Figure 23 A schematic diagram depicting the libraries generated herein.

[0037] Figure 24 Schematic diagram depicting the design of the phage-displayed hyperimmune library generated herein.

[0038] Figures 25A-25B Depicted are the heavy chain CDR length distributions of the hyperimmune library assessed by next generation sequencing. Figure 25A Plots of CDR3 counts for each length are depicted. Figure 25B Length plots for CDRH1, CDRH2, and CDRH3 are depicted.

[0039] Figure 26 A schematic diagram of the workflow for selecting soluble protein targets is depicted.

[0040] Figures 27A-27DDepicted are graphs of data from hTIGIT ELISA after rounds 3 and 4 of panning.

[0041] Figure 27E-Figure 27F CDRH3 length, yield, and affinity (K) of hTIGIT immunoglobulins are depicted. D ) schematic diagram.

[0042] Figures 28A-28D Depicted are graphs of data from human CD3 epsilon (hCD3) and cynomolgus CD3 epsilon (cCD3) ELISAs after the 4th and 5th rounds of panning.

[0043] Figure 28E-Figure 28L A diagram depicts cross-reactive human CD3 epsilon (hCD3) and macaque CD3 epsilon (cCD3) immunoglobulins.

[0044] Figures 29A-29G Depicted are the titration graphs of human CD3 on CD8+, CD3+, and CD3- T cells.

[0045] Figures 30A-30F Depicts the CRTH2R immunoglobulin CRTH2-48-03 ( Figure 30A )、CRTH2-48-21( Figure 30B ) and CRTH2-48-27 ( Figure 30C ) and the binding affinity diagram of CRTH2-48-03 ( Figure 30D )、CRTH2-48-21( Figure 30E ) and CRTH2-48-27 ( Figure 30F ) cAMP assay diagram.

[0046] Figure 31A-Figure 31B The dose curve of A2AR-90-007 is depicted ( Figure 31A ) and FACS analysis diagram ( Figure 31B ). DETAILED DESCRIPTION

[0047] Unless otherwise indicated, the present disclosure employs conventional molecular biology techniques within the skill of the art.Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0048] definition

[0049] Throughout this disclosure, multiple embodiments are given in range format. It should be understood that the description of the range format is only for convenience and simplicity, and should not be interpreted as a hard limit to the scope of any embodiment. Therefore, unless the context clearly stipulates otherwise, the description of the range should be considered to clearly disclose all possible sub-ranges and each numerical value accurate to one-tenth of the lower limit unit in the range. For example, the description of the range such as from 1 to 6 should be considered to have clearly disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, and each value in the range, for example, 1.1, 2, 2.3, 5 and 5.9. Regardless of the width of the scope, this is applicable. The upper and lower limits of these intermediate ranges can be independently included in a smaller range, and are also encompassed in this disclosure, subject to any specific exclusion limit in the range. Unless the context clearly stipulates otherwise, in the case where the range includes one or both of the limits, the scope of excluding any one or both of these included limits is also included in this disclosure.

[0050] The terms used herein are only used for the purpose of describing specific embodiments and are not intended to limit any embodiments. Unless the context clearly dictates otherwise, the singular forms "a", "an", and "the" as used herein are also intended to include the plural forms. It should be further understood that the terms "include" and / or "comprise" when used in this specification refer to the presence of the features, integers, steps, operations, elements and / or components, but do not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components and / or groups thereof. As used herein, the term "and / or" includes any and all combinations of one or more of the relevant listed items.

[0051] Unless specifically stated or obvious from the context, as used herein, the term "about" with respect to a number or numerical range should be understood to mean the stated number and + / - 10% thereof, or, for values ​​listed in a range, 10% below the listed lower limit to 10% above the listed upper limit.

[0052] Unless otherwise specified, as used herein, the term "nucleic acid" encompasses double-stranded or triple-stranded nucleic acids as well as single-stranded molecules. In double-stranded or triple-stranded nucleic acids, the nucleic acid strands need not be coextensive (i.e., a double-stranded nucleic acid need not be double-stranded along the entire length of both strands). When provided, nucleic acid sequences are listed in a 5' to 3' orientation unless otherwise specified. The methods described herein provide for the production of isolated nucleic acids. The methods described herein further provide for the production of isolated and purified nucleic acids. As referred to herein, a "nucleic acid" may comprise at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000 or more bases in length. Furthermore, provided herein are methods for synthesizing any number of nucleotide sequences encoding polypeptide segments, including sequences encoding nonribosomal peptides (NRPs), sequences encoding nonribosomal peptide synthetase (NRPS) modules and synthetic variants, polypeptide segments of other modular proteins such as antibodies, polypeptide segments from other protein families, including non-coding DNA or RNA, such as regulatory sequences, e.g., promoters, transcription factors, enhancers, siRNAs, shRNAs, RNAi, miRNAs, small nucleolar RNAs derived from microRNAs, or any functional or structural DNA or RNA unit of interest. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, intergenic DNA, locus(s) defined by linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), small nucleolar RNA, ribozymes, complementary DNA (cDNA) (which is a DNA representation of mRNA, usually obtained by reverse transcription of messenger RNA (mRNA) or by amplification); DNA molecules produced synthetically or by amplification, genomic DNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. A cDNA encoding a gene or gene fragment mentioned herein may comprise at least one region encoding an exon sequence without the intervening intron sequences found in the genomic equivalent sequence.

[0053] Antibody library

[0054] Provided herein are methods, compositions, and systems for generating antibodies. In some cases, the antibodies are single-domain antibodies. The methods, compositions, and systems described herein for optimizing antibodies include ratio-variant methods that reflect the natural diversity of antibody sequences. In some cases, the optimized antibody library comprises variant antibody sequences. In some cases, the variant antibody sequences are designed to comprise variant CDR regions. In some cases, variant antibody sequences comprising variant CDR regions are generated by shuffling natural CDR sequences in llama, humanized, or chimeric frameworks. In some cases, such libraries are synthesized, cloned into expression vectors, and the activity of the translation products (antibodies) is assessed. In some cases, sequence fragments are synthesized and subsequently assembled. In some cases, expression vectors are used to display and enrich desired antibodies, such as phage display. In some cases, the phage vector is a Fab phagemid vector. In some cases, the selection pressures used in the enrichment process include binding affinity, toxicity, immune tolerance, stability, or other factors. Such expression vectors allow the selection of antibodies with specific properties ("panning"), and subsequent propagation or amplification of such sequences enriches libraries with these sequences. The panning rounds can be repeated any number of times, such as 1, 2, 3, 4, 5, 6, 7, or more than 7 rounds. In some cases, each round of panning involves multiple washes. In some cases, each round of panning involves at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more than 16 washes.

[0055] This paper describes methods and systems for computer library design. In some cases, the libraries described herein are designed based on a database comprising a variety of antibody sequences. In some cases, the database comprises multiple variant antibody sequences for various targets. In some cases, the database comprises at least 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more than 5000 antibody sequences. An exemplary database is the iCAN database. In some cases, the database comprises naive and memory B cell receptor sequences. In some cases, the naive and memory B cell receptor sequences are sequences of humans, mice, or primates. In some cases, the naive and memory B cell receptor sequences are human sequences. In some cases, the position-specific variation of the database is analyzed. In some cases, the antibodies described herein comprise position-specific variation in the CDR region. In some cases, the CDR region comprises multiple variant sites.

[0056] Described herein are libraries comprising variations in the CDR regions. In some cases, the CDR is a CDR1, CDR2, or CDR3 of a variable heavy chain. In some cases, the CDR is a CDR1, CDR2, or CDR3 of a variable light chain. In some cases, the library comprises a plurality of variants encoding CDR1, CDR2, or CDR3. In some cases, the library as described herein encodes at least 50, 100, 200, 300, 400, 500, 1000, 1200, 1500, 1700, 2000, 2500, 3000, 3500, 4000, 4500, 5000, or more than 5000 CDR1 sequences. In some cases, the libraries as described herein encode at least 50, 100, 200, 300, 400, 500, 1000, 1200, 1500, 1700, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more than 5000 CDR2 sequences. In some cases, the libraries as described herein encode at least 50, 100, 200, 300, 400, 500, 1000, 1200, 1500, 1700, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more than 5000 CDR3 sequences. In some cases, in silico antibody libraries are synthesized, assembled and enriched for the desired sequences.

[0057] After synthesizing the CDR1 variants, CDR2 variants, and CDR3 variants, in some cases, the CDR1 variants, CDR2 variants, and CDR3 variants are shuffled to generate a diverse library. In some cases, the diversity of the library generated by the methods described herein is at least or about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 or more than 10 18 In some cases, the library has at least or about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16, 10 17 , 10 18 or more than 10 18 The final library diversity of 10 sequences.

[0058] The germline sequence corresponding to the variant sequence can also be modified to generate a sequence in the library. For example, the sequence generated by the methods described herein comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more than 16 mutations from the germline sequence. In some cases, the sequence generated comprises no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or no more than 18 mutations from the germline sequence. In some cases, the sequence generated comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or about 18 mutations relative to the germline sequence.

[0059] Antibody library

[0060] Provided herein are libraries generated by the methods described herein. The antibodies described herein result in improved functional activity, structural stability, expression, specificity, or a combination thereof. In some cases, the antibodies are single domain antibodies. In some cases, a single domain antibody comprises one heavy chain variable domain. In some cases, a single domain antibody is a VHH antibody.

[0061] As used herein, the term antibody will be understood to include proteins having the characteristic two arms and Y shape of a typical antibody molecule, as well as one or more fragments of an antibody that retains the ability to specifically bind to an antigen. Exemplary antibodies include, but are not limited to, monoclonal antibodies, polyclonal antibodies, bispecific antibodies, multispecific antibodies, transplanted antibodies, human antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, camelized antibodies, single-chain Fv (scFv) (including fragments in which VL and VH are linked using recombinant methods by a synthetic or natural linker that enables them to become a single protein chain in which the VL and VH regions pair to form monovalent molecules, including single-chain Fab and scFab), single-chain antibodies, Fab fragments (including monovalent fragments comprising VL, VH, CL and CH1 domains), F(ab')2 fragments (including fragments comprising a hinge region linked by a The present invention also includes a bivalent fragment of two Fab fragments linked by disulfide bonds), an Fd fragment (including a fragment comprising a VH and CH1 fragment), an Fv fragment (including a fragment comprising the VL and VH domains of a single arm of an antibody), a single-domain antibody (dAb or sdAb) (including a fragment comprising a VH domain), an isolated complementarity-determining region (CDR), a diabody (including a fragment comprising a bivalent dimer, such as two VL and VH domains that bind to each other and recognize two different antigens), a fragment consisting of only a single monomeric variable domain, a disulfide-linked Fv (sdFv), an intrabody, an anti-idiotypic (anti-Id) antibody, or an antigen-binding fragment thereof. In some cases, the libraries disclosed herein comprise nucleic acids encoding antibodies, wherein the antibodies are Fv antibodies, including Fv antibodies consisting of minimal antibody fragments that contain complete antigen recognition and antigen binding sites. In some embodiments, the Fv antibody consists of a dimer of one heavy-chain variable domain and one light-chain variable domain in tight, non-covalent association, and the three hypervariable regions of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. In some embodiments, these six hypervariable regions confer antigen-binding specificity to the antibody. In some embodiments, a single variable domain (or half of an Fv comprising only three hypervariable regions specific for an antigen, including single-domain antibodies isolated from camelids that comprise a single heavy-chain variable domain, such as VHH antibodies or Nanobodies) has the ability to recognize and bind to an antigen. In some cases, the libraries disclosed herein comprise nucleic acids encoding antibodies, wherein the antibodies are single-chain Fvs or scFvs, including antibody fragments comprising VH, VL, or both VH and VL domains, wherein both domains are present in a single polypeptide chain. In some embodiments, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains, thereby allowing the scFv to form the desired structure for antigen binding. In some cases, a scFv is linked to an Fc fragment, or a VHH is linked to an Fc fragment (including mini-antibodies).In some cases, the antibodies include immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, e.g., molecules that contain an antigen binding site. The immunoglobulin molecules are of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG 1, IgG 2, IgG 3, IgG 4, IgA 1, and IgA 2), or subclass.

[0062] In some embodiments, the library comprises immunoglobulins suitable for the species of the intended therapeutic target. Typically, these methods include "mammalianization" and include transferring the donor antigen binding information to a mammalian antibody recipient with lower immunogenicity to generate a method for useful therapeutic treatment. In some cases, the mammal is a mouse, rat, horse, sheep, cattle, primate (e.g., chimpanzee, baboon, gorilla, orangutan, monkey), dog, cat, pig, donkey, rabbit, and human. In some cases, provided herein are libraries and methods for feline and canine versions of antibodies.

[0063] "Humanized" forms of non-human antibodies can be chimeric antibodies that contain minimal sequence derived from a non-human antibody. Humanized antibodies are typically human antibodies (recipient antibody) in which residues from one or more CDRs are replaced with residues from one or more CDRs of a non-human antibody (donor antibody). The donor antibody can be any suitable non-human antibody, such as a mouse, rat, rabbit, chicken, or non-human primate antibody with the desired specificity, affinity, or biological effect. In some cases, selected framework region residues of the recipient antibody are replaced with corresponding framework region residues from the donor antibody. Humanized antibodies may also contain residues that are not found in either the recipient or donor antibody. In some cases, these modifications are made to further improve antibody performance.

[0064] "Caninization" can include methods of transferring non-canine antigen-binding information from a donor antibody to a less immunogenic canine antibody acceptor to generate a therapeutic that can be used as a therapeutic agent in dogs. In some cases, the caninized forms of non-canine antibodies provided herein are chimeric antibodies containing minimal sequence derived from a non-canine antibody. In some cases, a caninized antibody is a canine antibody sequence ("acceptor" or "recipient" antibody) in which hypervariable region residues of the acceptor are replaced with hypervariable region residues from a non-canine species ("donor" antibody) such as mouse, rat, rabbit, cat, dog, goat, chicken, cow, horse, llama, camel, dromedary, shark, non-human primate, human, humanized, recombinant, or engineered sequence with desired properties. In some cases, framework region (FR) residues of a canine antibody are replaced with corresponding non-canine FR residues. In some cases, the caninized antibody includes residues not found in the acceptor or donor antibody. In some cases, these modifications are made to further improve antibody performance. The caninized antibody may also comprise at least a portion of an immunoglobulin constant region (Fc) of a canine antibody.

[0065] "Felization" can include methods of transferring non-feline antigen binding information from a donor antibody to a less immunogenic feline antibody acceptor to generate a therapeutic that can be used as a therapeutic agent in cats. In some cases, the felineized forms of non-feline antibodies provided herein are chimeric antibodies containing minimal sequence derived from a non-feline antibody. In some cases, a felineized antibody is a feline antibody sequence ("acceptor" or "recipient" antibody) in which the hypervariable region residues of the acceptor are replaced with hypervariable region residues from a non-feline species ("donor" antibody) such as mouse, rat, rabbit, cat, dog, goat, chicken, cow, horse, llama, camel, dromedary, shark, non-human primate, human, humanized, recombinant, or engineered sequence with desired properties. In some cases, framework region (FR) residues of a feline antibody are replaced with corresponding non-feline FR residues. In some cases, the felineized antibody includes residues that are not found in the acceptor antibody or the donor antibody. In some cases, these modifications are made to further improve antibody performance. The felineized antibody may also comprise at least a portion of an immunoglobulin constant region (Fc) of a feline antibody.

[0066] The methods described herein can be used to generate libraries encoding non-immunoglobulins. In some cases, the libraries comprise antibody mimics. Exemplary antibody mimics include, but are not limited to, anticalins, affilins, affibody molecules, affimers, affitins, alphabodies, avimers, atrimers, DARPins, fynomers, Kunitz domain-based proteins, monobodies, anticalins, knottins, armadillo repeat-based proteins, and bicyclic peptides.

[0067] The libraries comprising antibody-encoding nucleic acids described herein contain variations in at least one region of an antibody. Exemplary regions of an antibody for variation include, but are not limited to, complementarity determining regions (CDRs), variable domains, or constant domains. In some cases, the CDR is a CDR1, CDR2, or CDR3. In some cases, the CDR is a heavy chain domain, including, but not limited to, CDRH1, CDRH2, and CDRH3. In some cases, the CDR is a light chain domain, including, but not limited to, CDRL1, CDRL2, and CDRL3. In some cases, the variable domain is a light chain variable domain (VL) or a heavy chain variable domain (VH). In some cases, the CDR1, CDR2, or CDR3 belongs to the light chain variable domain (VL). The CDR1, CDR2, or CDR3 of the light chain variable domain (VL) may be referred to as CDRL1, CDRL2, or CDRL3, respectively. The CDR1, CDR2, or CDR3 of the heavy chain variable domain (VH) may be referred to as CDRH1, CDRH2, or CDRH3, respectively. In some cases, the VL domain comprises a kappa or lambda chain.In some cases, the constant domain is a light chain constant domain (CL) or a heavy chain constant domain (CH).

[0068] Provided herein are libraries comprising nucleic acids encoding antibodies, wherein the antibodies comprise variations in at least one region of the antibodies, wherein the regions are CDR regions. In some cases, the antibodies are single domain antibodies comprising a heavy chain variable domain, such as VHH antibodies. In some cases, the VHH antibodies comprise variations in one or more CDR regions. In some cases, the VHH libraries described herein comprise at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000 or more than 3000 CDR1, CDR2 or CDR3 sequences. For example, the library comprises at least 2000 CDR1 sequences, at least 1200 CDR2 sequences and at least 1600 CDR3 sequences. In some cases, each sequence is different.

[0069] Libraries as described herein can comprise different lengths of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3 amino acids, or combinations thereof, when translated. In some cases, the length of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3 amino acids, or combinations thereof, when translated, is at least or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 amino acids.

[0070] Libraries comprising nucleic acids encoding antibodies with variant CDR sequences as described herein comprise amino acids of various lengths when translated. In some cases, the length of each amino acid fragment or the average length of the synthesized amino acids can be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150 or more than 150 amino acids. In some cases, the length of amino acids is about 15 to 150, 20 to 145, 25 to 140, 30 to 135, 35 to 130, 40 to 125, 45 to 120, 50 to 115, 55 to 110, 60 to 110, 65 to 105, 70 to 100, or 75 to 95 amino acids. In some cases, the length of amino acids is about 22 amino acids to about 75 amino acids. In some cases, the antibody comprises at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000 or more than 5000 amino acids. In some cases, the library is a VHH library. In some cases, the library is an antibody library.

[0071] The libraries encoding VHH antibodies described herein comprise variant CDR sequences that have been shuffled to generate antibodies with at least or about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 or more than 10 18 In some cases, the library has at least or about 10 7 , 108 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 or more than 10 18 The final library diversity of 10 sequences.

[0072] The libraries encoding antibodies or immunoglobulins described herein comprise variant CDR sequences that have been shuffled to generate antibodies with at least or about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 or more than 10 18 In some cases, the library has at least or about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 or more than 10 18 The final library diversity of 10 sequences.

[0073] The methods described herein provide for the synthesis of a library comprising nucleic acids encoding antibodies or immunoglobulins, wherein each nucleic acid encodes a predetermined variant of at least one predetermined reference nucleic acid sequence. In some cases, the predetermined reference sequence is a nucleic acid sequence encoding a protein, and the variant library comprises sequences encoding variations of at least a single codon, such that multiple different variants of a single residue in a subsequent protein encoded by the synthetic nucleic acid are generated by a standard translation process. In some cases, the antibody library comprises different nucleic acids that collectively encode variations at multiple positions. In some cases, the variant library comprises sequences encoding variations of at least a single codon of a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domain. In some cases, the variant library comprises sequences encoding variations of multiple codons of a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domain. In some cases, the variant library comprises sequences encoding variations of multiple codons of framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). Exemplary numbers of codons for variation include, but are not limited to, at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.

[0074] In some cases, at least one region of the antibody used for variation is from a heavy chain V gene family, a heavy chain D gene family, a heavy chain J gene family, a light chain V gene family, or a light chain J gene family. In some cases, the light chain V gene family comprises an immunoglobulin kappa (IGK) gene or an immunoglobulin lambda (IGL) gene.

[0075] Provided herein are libraries comprising nucleic acids encoding antibodies, wherein the libraries are synthesized using various numbers of fragments. In some cases, the fragments comprise a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domain. In some cases, the fragments comprise framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). In some cases, the antibody library is synthesized using at least or about 2 fragments, 3 fragments, 4 fragments, 5 fragments, or more than 5 fragments. The length of each nucleic acid fragment or the average length of the synthesized nucleic acids can be at least or about 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600 or more base pairs. In some cases, the length is about 50 to 600, 75 to 575, 100 to 550, 125 to 525, 150 to 500, 175 to 475, 200 to 450, 225 to 425, 250 to 400, 275 to 375, or 300 to 350 base pairs.

[0076] Libraries comprising nucleic acids encoding antibodies or immunoglobulins as described herein comprise amino acids of various lengths when translated. In some cases, the length of each amino acid fragment or the average length of the synthesized amino acids can be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150 or more than 150 amino acids. In some cases, the length of the amino acid sequence is about 15 to 150, 20 to 145, 25 to 140, 30 to 135, 35 to 130, 40 to 125, 45 to 120, 50 to 115, 55 to 110, 60 to 110, 65 to 105, 70 to 100, or 75 to 95 amino acids. In some cases, the length of the amino acid sequence is about 22 amino acids to about 75 amino acids. In some cases, the antibody comprises at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more than 5000 amino acids.

[0077] A plurality of variant sequences of at least one region of an antibody to be mutated are synthesized de novo using methods described herein. In some cases, a plurality of variant sequences are synthesized de novo for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or a combination thereof. In some cases, a plurality of variant sequences are synthesized de novo for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). The number of variant sequences can be at least or about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more than 500 sequences. In some cases, the number of variant sequences is at least or about 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, or more than 8000 sequences. In some cases, the number of variant sequences is about 10 to 500, 25 to 475, 50 to 450, 75 to 425, 100 to 400, 125 to 375, 150 to 350, 175 to 325, 200 to 300, 225 to 375, 250 to 350, or 275 to 325 sequences.

[0078] In some cases, the variant sequence for at least one region of the antibody differs in length or sequence. In some cases, the at least one region synthesized de novo is for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or a combination thereof. In some cases, the at least one region synthesized de novo is for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). In some cases, the variant sequence comprises at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, or more than 50 variant nucleotides or amino acids compared to wild-type. In some cases, the variant sequence comprises at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 additional nucleotides or amino acids compared to wild-type. In some cases, the variant sequence comprises at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 fewer nucleotides or amino acids than the wild type. 1 , 10 2 , 103 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 or more than 10 10 variants.

[0079] After antibody library synthesis, the antibody library can be used for screening and analysis. For example, the library displayability and panning of the antibody library are determined. In some cases, displayability is analyzed using a selective tag. Exemplary tags include, but are not limited to, radioactive labels, fluorescent labels, enzymes, chemiluminescent tags, colorimetric tags, affinity tags, or other tags or labels known in the art. In some cases, the tag is histidine, polyhistidine, myc, hemagglutinin (HA), or FLAG. In some cases, the antibody library is assayed by sequencing using various methods, including but not limited to single molecule real-time (SMRT) sequencing, polymerase cloning (Polony) sequencing, ligation sequencing, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electronic sequencing, pyrosequencing, Maxam-Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or synthetic sequencing. In some cases, the antibody library is displayed on the surface of cells or phage. In some cases, phage display is used to enrich the antibody library for sequences with the desired activity.

[0080] In some cases, the functional activity, structural stability (e.g., thermal stability or pH stability), expression, specificity, or a combination thereof, of the antibody library is determined. In some cases, the antibodies in the antibody library are determined for folding. In some cases, the functional activity, structural stability, expression, specificity, folding, or a combination thereof of the antibody region is determined. For example, the functional activity, structural stability, expression, specificity, folding, or a combination thereof of the VH region or the VL region is determined.

[0081] The antibodies or IgG produced by the methods described herein comprise improved binding affinity. In some cases, the antibodies comprise a binding affinity (e.g., K) of less than 1 nM, less than 1.2 nM, less than 2 nM, less than 5 nM, less than 10 nM, less than 11 nM, less than 13.5 nM, less than 15 nM, less than 20 nM, less than 25 nM, or less than 30 nM. D In some cases, the antibody comprises a K of less than 400 nM, less than 350 nM, less than 300 nM, less than 250 nM, less than 200 nM, less than 150 nM, less than 100 nM, less than 50 nM, less than 25 nM, less than 15 nM, or less than 10 nM.D In some cases, the antibody comprises a K of less than 1 nM. D In some cases, the antibody comprises a K of less than 1.2 nM. D In some cases, the antibody comprises a K of less than 2 nM. D In some cases, the antibody comprises a K of less than 5 nM. D In some cases, the antibody comprises a K of less than 10 nM. D In some cases, the antibody comprises a K of less than 13.5 nM. D In some cases, the antibody comprises a K of less than 15 nM. D In some cases, the antibody comprises a K of less than 20 nM. D In some cases, the antibody comprises a K of less than 25 nM. D In some cases, the antibody comprises a K of less than 30 nM. D .

[0082] In some cases, the affinity of the antibodies or IgGs produced by the methods described herein is improved to at least or about 1.5x, 2.0x, 5x, 10x, 20x, 30x, 40x, 50x, 60x, 70x, 80x, 90x, 100x, 200x, or greater than 200x the binding affinity of the comparator antibody. In some cases, the affinity of the antibodies or IgGs produced by the methods described herein is functionally improved to at least or about 1.5x, 2.0x, 5x, 10x, 20x, 30x, 40x, 50x, 60x, 70x, 80x, 90x, 100x, 200x, or greater than 200x the binding affinity of the comparator antibody. In some cases, the comparator antibody is an antibody with a similar structure, sequence, or antigenic target.

[0083] In some cases, the methods described herein result in increased production of antibodies or IgG. In some cases, the production is at least or about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 micrograms (ug) or greater. In some cases, the production is in the range of about 5 to about 80, about 10 to about 75, about 15 to about 60, about 20 to about 50, or about 30 to about 40 micrograms (ug).

[0084] Expression system

[0085] Provided herein are libraries comprising nucleic acids encoding antibodies comprising a binding domain, wherein the libraries have improved specificity, stability, expression, folding, or downstream activity. In some cases, the libraries described herein are used for screening and analysis.

[0086] Provided herein are libraries comprising nucleic acids encoding antibodies comprising binding domains, wherein the nucleic acid libraries are used for screening and analysis. In some cases, screening and analysis include in vitro, in vivo, or ex vivo assays. Cells used for screening include primary cells or cell lines taken from living subjects. Cells can be from prokaryotes (e.g., bacteria and fungi) or eukaryotes (e.g., animals and plants). Exemplary animal cells include, but are not limited to, those from mice, rabbits, primates, and insects. In some cases, cells used for screening include cell lines, including, but not limited to, Chinese hamster ovary (CHO) cell lines, human embryonic kidney (HEK) cell lines, or baby hamster kidney (BHK) cell lines. In some cases, the nucleic acid libraries described herein can also be delivered to multicellular organisms. Exemplary multicellular organisms include, but are not limited to, plants, mice, rabbits, primates, and insects.

[0087] The nucleic acid libraries described herein can be screened for various pharmacological or pharmacokinetic properties. In some cases, the libraries are screened using in vitro assays, in vivo assays, or ex vivo assays. For example, the in vitro pharmacological or pharmacokinetic properties screened include, but are not limited to, binding affinity, binding specificity, and binding avidity. Exemplary in vivo pharmacological or pharmacokinetic properties of the libraries described herein screened include, but are not limited to, therapeutic efficacy, activity, preclinical toxicity properties, clinical efficacy properties, clinical toxicity properties, immunogenicity, efficacy, and clinical safety properties.

[0088] Provided herein are nucleic acid libraries, wherein the nucleic acid libraries can be expressed in vectors. Expression vectors for inserting the nucleic acid libraries disclosed herein may include eukaryotic or prokaryotic expression vectors. Exemplary expression vectors include, but are not limited to, mammalian expression vectors: pSF-CMV-NEO-NH2-PPT-3XFLAG, pSF-CMV-NEO-COOH-3XFLAG, pSF-CMV-PURO-NH2-GST-TEV, pSF-OXB20-COOH-TEV-FLAG(R)-6His, pCEP4 pDEST27, pSF-CMV-Ub-KrYFP, pSF-CMV-FMDV-daGFP, pEF1a-mCherry-N1 vector, pEF1a-tdTomato vector, pSF-CMV-FMDV-Hygro, pSF-CMV-PGK-Puro, pMCP-tag (m) and pSF-CMV-PURO-NH2-CMYC; bacterial expression vectors: pSF-OXB20-BetaGal, pSF-OXB20-Fluc, pSF-OXB20 and pSF-Tac; plant expression vectors: pRI 101-AN DNA and pCambia2301; and yeast expression vectors: pTYB21 and pKLAC2, and insect vectors: pAc5.1 / V5-His A and pDEST8. In some cases, the vector is pcDNA3 or pcDNA3.1.

[0089] Described herein are nucleic acid libraries expressed in vectors to produce constructs comprising antibodies. In some cases, the sizes of the constructs vary. In some cases, the constructs comprise at least or about 500, 600, 700, 800, 900, 1000, 1100, 1300, 1400, 1500, 1600, 1700, 1800, 2000, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 6000, 7000, 8000, 9000, 10000 or more than 10000 bases. In some cases, the construct comprises about 300 to 1,000, 300 to 2,000, 300 to 3,000, 300 to 4,000, 300 to 5,000, 300 to 6,000, 300 to 7,000, 300 to 8,000, 300 to 9,000, 300 to 10,000, 1,000 to 2,000, 1,000 to 3,000, 1,000 to 4,000, 1,000 to 5,000, 1,000 to 6,000. 0 to 6,000, 1,000 to 7,000, 1,000 to 8,000, 1,000 to 9,000, 1,000 to 10,000, 2,000 to 3,000, 2,000 to 4,000, 2,000 to 5,000, 2,000 to 6,000, 2,000 to 7,000, 2,000 to 8,000, 2,000 to 9,000, 2,000 to 10,000, 3,000 to 4,000, 3, 000 to 5,000, 3,000 to 6,000, 3,000 to 7,000, 3,000 to 8,000, 3,000 to 9,000, 3,000 to 10,000, 4,000 to 5,000, 4,000 to 6,000, 4,000 to 7,000, 4,000 to 8,000, 4,000 to 9,000, 4,000 to 10,000, 5,000 to 6,000, 5,000 to 7,000 , 5,000 to 8,000, 5,000 to 9,000, 5,000 to 10,000, 6,000 to 7,000, 6,000 to 8,000, 6,000 to 9,000, 6,000 to 10,000, 7,000 to 8,000, 7,000 to 9,000, 7,000 to 10,000, 8,000 to 9,000, 8,000 to 10,000, or 9,000 to 10,000 bases.

[0090] Provided herein are libraries comprising nucleic acids encoding antibodies, wherein the nucleic acid libraries are expressed in cells. In some cases, the libraries are synthesized to express reporter genes. Exemplary reporter genes include, but are not limited to, acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), β-galactosidase (LacZ), β-glucuronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), azure fluorescent protein, citrine fluorescent protein, orange fluorescent protein, cherry fluorescent protein, turquoise fluorescent protein, blue fluorescent protein, horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), luciferase, and derivatives thereof. Methods for determining the regulation of reporter genes are well known in the art and include, but are not limited to, fluorescence spectrometry (e.g., fluorescence spectroscopy, fluorescence activated cell sorting (FACS), fluorescence microscopy), and antibiotic resistance determination.

[0091] Diseases and conditions

[0092] Provided herein are libraries comprising nucleic acids encoding antibodies or immunoglobulins (including VHH antibodies that may have therapeutic effects). In some cases, the antibodies or immunoglobulins, when translated, produce proteins that are used to treat a disease or condition in a subject. Exemplary diseases include, but are not limited to, cancer, inflammatory diseases or conditions, metabolic diseases or disorders, cardiovascular diseases or conditions, respiratory diseases or conditions, pain, digestive diseases or conditions, reproductive diseases or conditions, endocrine diseases or conditions, or nervous system diseases or conditions. In some cases, the cancer is a solid cancer or a hematologic cancer. In some cases, the subject is a mammal. In some cases, the subject is a mouse, rabbit, dog, or human. The subject treated by the methods described herein can be an infant, an adult, or a child. Pharmaceutical compositions comprising the antibodies or antibody fragments described herein can be administered intravenously or subcutaneously.

[0093] In some cases, the disease or condition is associated with TIGIT dysfunction. In some cases, the disease or condition is associated with abnormal signaling through TIGIT. In some cases, the disease or condition is associated with CD3 dysfunction. In some cases, the disease or condition is associated with abnormal signaling through CD3. In some cases, the disease or condition is cancer. In some cases, the disease or condition is a viral infection.

[0094] Protein targets

[0095] Provided herein are libraries comprising nucleic acids encoding antibodies or immunoglobulins, including VHH antibodies designed to target a variety of protein targets. In some cases, the protein is an ion channel, a G protein-coupled receptor, a tyrosine kinase receptor, an immunoreceptor, a membrane protein, or a combination thereof. In some cases, the protein is a receptor. In some cases, the protein is the glucagon-like peptide 1 (GLP1) receptor. In some cases, the protein is the prostaglandin D2 receptor 2 (DP2 or CRTH2) receptor. In some cases, the protein is the adenosine A2A receptor. In some cases, the protein is a T cell immunoreceptor with Ig and ITIM domains (TIGIT). In some cases, the protein is cluster of differentiation 47 (CD47). In some cases, the protein is cluster of differentiation 3ɛ (CD3ɛ).

[0096] Provided herein are antibodies or immunoglobulins, wherein the antibody or immunoglobulin comprises a sequence that has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NO: 1-SEQ ID NO: 151. In some cases, the antibody or immunoglobulin sequence has at least or about 95% sequence identity to any one of SEQ ID NO: 1-SEQ ID NO: 151. In some cases, the antibody or immunoglobulin sequence has at least or about 97% sequence identity to any one of SEQ ID NO: 1-SEQ ID NO: 151. In some cases, the antibody or immunoglobulin sequence has at least or about 99% sequence identity to any one of SEQ ID NO: 1-SEQ ID NO: 151. In some cases, the antibody or immunoglobulin sequence has at least or about 100% sequence identity to any one of SEQ ID NO: 1-SEQ ID NO: 151. In some cases, the antibody or immunoglobulin sequence comprises at least a portion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 or more amino acids of any one of SEQ ID NO: 1-SEQ ID NO: 151.

[0097] In some embodiments, the antibody or immunoglobulin sequence comprises a complementarity determining region (CDR) comprising a sequence as shown in Table 1A, Table 14B, Table 17, and Table 20. In some embodiments, the antibody or immunoglobulin sequence comprises a complementarity determining region (CDR) having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NO: 46-SEQ ID NO: 83, SEQ ID NO: 118-SEQ ID NO: 137, or SEQ ID NO: 152-SEQ ID NO: 163. In some cases, the antibody or immunoglobulin sequence comprises a complementarity determining region (CDR) that is at least or about 95% homologous to any one of SEQ ID NO: 46-SEQ ID NO: 83, SEQ ID NO: 118-SEQ ID NO: 137, or SEQ ID NO: 152-SEQ ID NO: 163. In some cases, the antibody or immunoglobulin sequence comprises a complementarity determining region (CDR) that is at least or about 97% homologous to any one of SEQ ID NO: 46-SEQ ID NO: 83, SEQ ID NO: 118-SEQ ID NO: 137, or SEQ ID NO: 152-SEQ ID NO: 163. In some cases, the antibody or immunoglobulin sequence comprises a complementarity determining region (CDR) that is at least or about 99% homologous to any one of SEQ ID NO: 46-SEQ ID NO: 83, SEQ ID NO: 118-SEQ ID NO: 137, or SEQ ID NO: 152-SEQ ID NO: 163. In some cases, the antibody or immunoglobulin sequence comprises a complementarity determining region (CDR) that is at least or about 100% homologous to any one of SEQ ID NO: 46-SEQ ID NO: 83, SEQ ID NO: 118-SEQ ID NO: 137, or SEQ ID NO: 152-SEQ ID NO: 163.In some cases, the antibody or immunoglobulin sequence comprises a complementarity determining region (CDR) comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of any one of SEQ ID NO: 46-SEQ ID NO: 83, SEQ ID NO: 118-SEQ ID NO: 137, or SEQ ID NO: 152-SEQ ID NO: 163.

[0098] Table 1A.

[0099]

[0100] In some embodiments, the antibody or immunoglobulin sequence comprises a CDR1 that has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 118-SEQ ID NO: 120, SEQ ID NO: 129-SEQ ID NO: 131, SEQ ID NO: 152, SEQ ID NO: 155, SEQ ID NO: 158, or SEQ ID NO: 161. In some cases, the antibody or immunoglobulin sequence comprises a CDR1 that is at least or about 95% homologous to any one of SEQ ID NO: 118-SEQ ID NO: 120, SEQ ID NO: 129-SEQ ID NO: 131, SEQ ID NO: 152, SEQ ID NO: 155, SEQ ID NO: 158, or SEQ ID NO: 161. In some cases, the antibody or immunoglobulin sequence comprises a CDR1 that is at least or about 97% homologous to any one of SEQ ID NO: 118-SEQ ID NO: 120, SEQ ID NO: 129-SEQ ID NO: 131, SEQ ID NO: 152, SEQ ID NO: 155, SEQ ID NO: 158, or SEQ ID NO: 161. In some cases, the antibody or immunoglobulin sequence comprises a CDR1 that is at least or about 99% homologous to any one of SEQ ID NO: 118-SEQ ID NO: 120, SEQ ID NO: 152, SEQ ID NO: 155, SEQ ID NO: 158, or SEQ ID NO: 161. In some cases, the antibody or immunoglobulin sequence comprises a CDR1 that is at least or about 100% homologous to any one of SEQ ID NO: 118-SEQ ID NO: 120, SEQ ID NO: 129-SEQ ID NO: 131, SEQ ID NO: 152, SEQ ID NO: 155, SEQ ID NO: 158, or SEQ ID NO: 161.In some cases, the antibody or immunoglobulin sequence comprises a CDR1 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of any one of SEQ ID NO: 118-SEQ ID NO: 120, SEQ ID NO: 129-SEQ ID NO: 131, SEQ ID NO: 152, SEQ ID NO: 155, SEQ ID NO: 158, or SEQ ID NO: 161.

[0101] In some embodiments, the antibody or immunoglobulin sequence comprises a CDR2 that has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 121-SEQ ID NO: 123, SEQ ID NO: 132-SEQ ID NO: 134, SEQ ID NO: 153, SEQ ID NO: 156, SEQ ID NO: 159, or SEQ ID NO: 162. In some cases, the antibody or immunoglobulin sequence comprises a CDR2 that is at least or about 95% homologous to any one of SEQ ID NO: 121-SEQ ID NO: 123, SEQ ID NO: 132-SEQ ID NO: 134, SEQ ID NO: 153, SEQ ID NO: 156, SEQ ID NO: 159, or SEQ ID NO: 162. In some cases, the antibody or immunoglobulin sequence comprises a CDR2 that is at least or about 97% homologous to any one of SEQ ID NO: 121-SEQ ID NO: 123, SEQ ID NO: 132-SEQ ID NO: 134, SEQ ID NO: 153, SEQ ID NO: 156, SEQ ID NO: 159, or SEQ ID NO: 162. In some cases, the antibody or immunoglobulin sequence comprises a CDR2 that is at least or about 99% homologous to any one of SEQ ID NO: 121-SEQ ID NO: 123, SEQ ID NO: 132-SEQ ID NO: 134, SEQ ID NO: 153, SEQ ID NO: 156, SEQ ID NO: 159, or SEQ ID NO: 162. In some cases, the antibody or immunoglobulin sequence comprises a CDR2 that is at least or about 100% homologous to any one of SEQ ID NO: 121-SEQ ID NO: 123, SEQ ID NO: 132-SEQ ID NO: 134, SEQ ID NO: 153, SEQ ID NO: 156, SEQ ID NO: 159, or SEQ ID NO: 162.In some cases, the antibody or immunoglobulin sequence comprises a CDR2 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of any one of SEQ ID NO: 121-SEQ ID NO: 123, SEQ ID NO: 132-SEQ ID NO: 134, SEQ ID NO: 153, SEQ ID NO: 156, SEQ ID NO: 159, or SEQ ID NO: 162.

[0102] In some embodiments, the antibody or immunoglobulin sequence comprises a CDR3 that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to any one of SEQ ID NO: 46-SEQ ID NO: 83, SEQ ID NO: 124-SEQ ID NO: 128, SEQ ID NO: 154, SEQ ID NO: 157, SEQ ID NO: 160, or SEQ ID NO: 163. In some cases, the antibody or immunoglobulin sequence comprises a CDR3 that is at least or about 95% homologous to any one of SEQ ID NO: 46-SEQ ID NO: 83, SEQ ID NO: 124-SEQ ID NO: 128, SEQ ID NO: 125-SEQ ID NO: 137, SEQ ID NO: 154, SEQ ID NO: 157, SEQ ID NO: 160, or SEQ ID NO: 163. In some cases, the antibody or immunoglobulin sequence comprises a CDR3 that is at least or about 97% homologous to any one of SEQ ID NO: 46-SEQ ID NO: 83, SEQ ID NO: 124-SEQ ID NO: 128, SEQ ID NO: 125-SEQ ID NO: 137, SEQ ID NO: 124-SEQ ID NO: 128, SEQ ID NO: 154, SEQ ID NO: 157, SEQ ID NO: 160, or SEQ ID NO: 163. In some cases, the antibody or immunoglobulin sequence comprises a CDR3 that is at least or about 99% homologous to any one of SEQ ID NO: 46-SEQ ID NO: 83, SEQ ID NO: 124-SEQ ID NO: 128, SEQ ID NO: 125-SEQ ID NO: 137, SEQ ID NO: 124-SEQ ID NO: 128, SEQ ID NO: 154, SEQ ID NO: 157, SEQ ID NO: 160, or SEQ ID NO: 163.In some cases, the antibody or immunoglobulin sequence comprises a CDR3 that is at least or about 100% homologous to any one of SEQ ID NO: 46-SEQ ID NO: 83, SEQ ID NO: 124-SEQ ID NO: 128, SEQ ID NO: 125-SEQ ID NO: 137, SEQ ID NO: 124-SEQ ID NO: 128, SEQ ID NO: 154, SEQ ID NO: 157, SEQ ID NO: 160, or SEQ ID NO: 163. In some cases, the antibody or immunoglobulin sequence comprises a CDR3 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of any one of SEQ ID NO: 46-SEQ ID NO: 83, SEQ ID NO: 124-SEQ ID NO: 128, SEQ ID NO: 125-SEQ ID NO: 137, SEQ ID NO: 124-SEQ ID NO: 128, SEQ ID NO: 154, SEQ ID NO: 157, SEQ ID NO: 160, or SEQ ID NO: 163.

[0103] In some embodiments, the antibody or immunoglobulin sequence comprises a CDRH1 that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NO: 152; a CDRH2 that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NO: 153; and a CDRH3 that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NO: 154. In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 that is at least or about 95%, 97%, 99%, or 100% homologous to any one of SEQ ID NO: 152; a CDRH2 that is at least or about 95%, 97%, 99%, or 100% homologous to any one of SEQ ID NO: 153; and a CDRH3 that is at least or about 95%, 97%, 99%, or 100% homologous to any one of SEQ ID NO: 154. In some cases, the antibody or immunoglobulin sequence comprises: a CDRH1 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 152; a CDRH2 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 153; and a CDRH3 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 154.

[0104] In some embodiments, the antibody or immunoglobulin sequence comprises a CDRH1 that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 155; a CDRH2 that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 156; and a CDRH3 that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 157. In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 155; a CDRH2 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 156; and a CDRH3 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 157. In some cases, the antibody or immunoglobulin sequence comprises: a CDRH1 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 155; a CDRH2 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 156; and a CDRH3 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 157.

[0105] In some embodiments, the antibody or immunoglobulin sequence comprises a CDRL1 that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 158; a CDRL2 that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 159; and a CDRL3 that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 160. In some cases, the antibody or immunoglobulin sequence comprises a CDRL1 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 158; a CDRL2 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 159; and a CDRL3 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 160. In some cases, the antibody or immunoglobulin sequence comprises: CDRL1 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 158; CDRL2 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 159; and CDRL3 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 160.

[0106] In some embodiments, the antibody or immunoglobulin sequence comprises a CDRL1 that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 161; a CDRL2 that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 162; and a CDRL3 that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 163. In some cases, the antibody or immunoglobulin sequence comprises a CDRL1 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 161; a CDRL2 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 162; and a CDRL3 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 163. In some cases, the antibody or immunoglobulin sequence comprises: CDRL1 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 161; CDRL2 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 162; and CDRL3 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 163.

[0107] In some embodiments, the antibody or immunoglobulin sequence comprises: a CDRH1 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 152; a CDRH2 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 153; a CDRH3 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 154; a CDRL1 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: and a CDRL3 that has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 160. In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 152; a CDRH2 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 153; a CDRH3 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 154; a CDRL1 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 158; a CDRL2 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 159; and a CDRL3 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 160.In some cases, the antibody or immunoglobulin sequence comprises: a CDRH1 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 152; a CDRH2 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 153; a CDRH3 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 154; a CDRL1 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 158; a CDRL2 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: NO: 159; and CDRL3 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 160.

[0108] In some embodiments, the antibody or immunoglobulin sequence comprises: a CDRH1 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 152; a CDRH2 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 153; a CDRH3 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 154; a CDRL1 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: and CDRL3 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 163. In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 152; a CDRH2 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 153; a CDRH3 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 154; a CDRL1 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 161; a CDRL2 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 162; and a CDRL3 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 163.In some cases, the antibody or immunoglobulin sequence comprises: a CDRH1 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 152; a CDRH2 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 153; a CDRH3 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 154; a CDRL1 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 161; a CDRL2 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: NO: 162; and CDRL3 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 163.

[0109] In some embodiments, the antibody or immunoglobulin sequence comprises: a CDRH1 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 155; a CDRH2 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 156; a CDRH3 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 157; a CDRL1 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: and a CDRL3 that has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 160. In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 155; a CDRH2 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 156; a CDRH3 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 157; a CDRL1 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 158; a CDRL2 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 159; and a CDRL3 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 160.In some cases, the antibody or immunoglobulin sequence comprises: a CDRH1 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 155; a CDRH2 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 156; a CDRH3 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 157; a CDRL1 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 158; a CDRL2 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: NO: 159; and CDRL3 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 160.

[0110] In some embodiments, the antibody or immunoglobulin sequence comprises: a CDRH1 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 155; a CDRH2 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 156; a CDRH3 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 157; a CDRL1 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: and CDRL3 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 163. In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 155; a CDRH2 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 156; a CDRH3 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 157; a CDRL1 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 161; a CDRL2 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 162; and a CDRL3 that is at least or about 95%, 97%, 99%, or 100% homologous to SEQ ID NO: 163.In some cases, the antibody or immunoglobulin sequence comprises: a CDRH1 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 155; a CDRH2 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 156; a CDRH3 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 157; a CDRL1 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: 161; a CDRL2 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids of SEQ ID NO: NO: 162; and CDRL3 comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 163.

[0111] In some embodiments, antibodies or immunoglobulins that bind to CRTH2R are described herein. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a heavy chain variable domain that has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NO: 1-SEQ ID NO: 23 or SEQ ID NO: 126-SEQ ID NO: 148. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a heavy chain variable domain that has at least or about 95% sequence identity to any one of SEQ ID NO: 1-SEQ ID NO: 23 or SEQ ID NO: 126-SEQ ID NO: 148. In some instances, the CRTH2R antibody or immunoglobulin sequence comprises a heavy chain variable domain that has at least or about 97% sequence identity to any one of SEQ ID NO: 1 - SEQ ID NO: 23 or SEQ ID NO: 126 - SEQ ID NO: 148. In some instances, the CRTH2R antibody or immunoglobulin sequence comprises a heavy chain variable domain that has at least or about 99% sequence identity to any one of SEQ ID NO: 1 - SEQ ID NO: 23 or SEQ ID NO: 126 - SEQ ID NO: 148. In some instances, the CRTH2R antibody or immunoglobulin sequence comprises a heavy chain variable domain that has at least or about 100% sequence identity to any one of SEQ ID NO: 1 - SEQ ID NO: 23 or SEQ ID NO: 126 - SEQ ID NO: 148. In some instances, the CRTH2R antibody or immunoglobulin sequence comprises a heavy chain variable domain comprising a sequence having SEQ ID NO: 1 to SEQ ID NO: 23 or SEQ ID NO: 126 to SEQ ID NO: 30, 340, 350, 360, 370, 380, 390, 400, or more than 400 amino acids of 148.

[0112] In some instances, the CRTH2R antibody or immunoglobulin sequence comprises a light chain variable domain that has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NO: 24 - SEQ ID NO: 45 or SEQ ID NO: 149 - SEQ ID NO: 151. In some instances, the CRTH2R antibody or immunoglobulin sequence comprises a light chain variable domain that has at least or about 95% sequence identity to any one of SEQ ID NO: 24 - SEQ ID NO: 45 or SEQ ID NO: 149 - SEQ ID NO: 151. In some instances, the CRTH2R antibody or immunoglobulin sequence comprises a light chain variable domain that has at least or about 97% sequence identity to any one of SEQ ID NO: 24 - SEQ ID NO: 45 or SEQ ID NO: 149 - SEQ ID NO: 151. In some instances, the CRTH2R antibody or immunoglobulin sequence comprises a light chain variable domain that has at least or about 99% sequence identity to any one of SEQ ID NO: 24 - SEQ ID NO: 45 or SEQ ID NO: 149 - SEQ ID NO: 151. In some instances, the CRTH2R antibody or immunoglobulin sequence comprises a light chain variable domain that has at least or about 100% sequence identity to any one of SEQ ID NO: 24 - SEQ ID NO: 45 or SEQ ID NO: 149 - SEQ ID NO: 151. In some instances, the CRTH2R antibody or immunoglobulin sequence comprises a light chain variable domain comprising a sequence having SEQ ID NO: 24-SEQ ID NO: 45 or SEQ ID NO: 149-SEQ ID NO: 30, 340, 350, 360, 370, 380, 390, 400, or more than 400 amino acids of 151.

[0113] Provided herein are antibodies or immunoglobulins directed against various protein targets. In some cases, the protein is TIGIT. In some embodiments, described herein are antibodies or immunoglobulins that bind to TIGIT. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a heavy chain variable domain that has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 84-SEQ ID NO: 100. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a heavy chain variable domain that has at least or about 95% sequence identity to any one of SEQ ID NO: 84-SEQ ID NO: 100. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a heavy chain variable domain that has at least or about 97% sequence identity to any one of SEQ ID NO: 84 - SEQ ID NO: 100. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a heavy chain variable domain that has at least or about 99% sequence identity to any one of SEQ ID NO: 84 - SEQ ID NO: 100. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a heavy chain variable domain that has at least or about 100% sequence identity to any one of SEQ ID NO: 84 - SEQ ID NO: 100. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a heavy chain variable domain comprising at least a portion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 or more amino acids of any one of SEQ ID NO: 84-SEQ ID NO: 100.

[0114] In some cases, the TIGIT antibody or immunoglobulin sequence comprises a light chain variable domain that has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NO: 101-SEQ ID NO: 117. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a light chain variable domain that has at least or about 95% sequence identity to any one of SEQ ID NO: 101-SEQ ID NO: 117. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a light chain variable domain that has at least or about 97% sequence identity to any one of SEQ ID NO: 101-SEQ ID NO: 117. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a light chain variable domain that has at least or about 99% sequence identity to any one of SEQ ID NO: 101-SEQ ID NO: 117. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a light chain variable domain that has at least or about 100% sequence identity to any one of SEQ ID NO: 101-SEQ ID NO: 117. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a light chain variable domain comprising at least a portion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 or more amino acids of any one of SEQ ID NO: 101-SEQ ID NO: 117.

[0115] In some cases, the protein is CD3 epsilon. In some embodiments, antibodies or immunoglobulins that bind to CD3 are described herein. In some cases, the CD3 antibody or immunoglobulin sequence comprises a heavy chain variable domain that has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 138-SEQ ID NO: 141. In some cases, the CD3 antibody or immunoglobulin sequence comprises a heavy chain variable domain that has at least or about 95% sequence identity to any one of SEQ ID NO: 138-SEQ ID NO: 141. In some cases, the CD3 antibody or immunoglobulin sequence comprises a heavy chain variable domain that has at least or about 97% sequence identity to any one of SEQ ID NO: 138-SEQ ID NO: 141. In some instances, the CD3 antibody or immunoglobulin sequence comprises a heavy chain variable domain that has at least or about 99% sequence identity to any one of SEQ ID NO: 138 - SEQ ID NO: 141. In some instances, the CD3 antibody or immunoglobulin sequence comprises a heavy chain variable domain that has at least or about 100% sequence identity to any one of SEQ ID NO: 138 - SEQ ID NO: 141. In some instances, the CD3 antibody or immunoglobulin sequence comprises a heavy chain variable domain comprising at least a portion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 or more amino acids of any one of SEQ ID NO: 138-SEQ ID NO: 141.

[0116] In some instances, the CD3 antibody or immunoglobulin sequence comprises a light chain variable domain that has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NO: 142-SEQ ID NO: 145. In some instances, the CD3 antibody or immunoglobulin sequence comprises a light chain variable domain that has at least or about 95% sequence identity to any one of SEQ ID NO: 142-SEQ ID NO: 145. In some instances, the CD3 antibody or immunoglobulin sequence comprises a light chain variable domain that has at least or about 97% sequence identity to any one of SEQ ID NO: 142-SEQ ID NO: 145. In some instances, the CD3 antibody or immunoglobulin sequence comprises a light chain variable domain that has at least or about 99% sequence identity to any one of SEQ ID NO: 142-SEQ ID NO: 145. In some instances, the CD3 antibody or immunoglobulin sequence comprises a light chain variable domain that has at least or about 100% sequence identity to any one of SEQ ID NO: 142-SEQ ID NO: 145. In some instances, the CD3 antibody or immunoglobulin sequence comprises a light chain variable domain comprising at least a portion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 or more amino acids of any one of SEQ ID NO: 142-SEQ ID NO: 145.

[0117] Variant Library

[0118] Codon variation

[0119] The variant nucleic acid library described herein may comprise a plurality of nucleic acids, wherein each nucleic acid encodes a variant codon sequence compared to a reference nucleic acid sequence. In some cases, each nucleic acid in the first nucleic acid population contains a variant at a single variant site. In some cases, the first nucleic acid population contains a plurality of variants at a single variant site, so that the first nucleic acid population contains more than one variant at the same variant site. The first nucleic acid population may be included in nucleic acids encoding a plurality of codon variants at the same variant site. The first nucleic acid population may be included in nucleic acids encoding up to 19 or more codons at the same position. The first nucleic acid population may be included in nucleic acids encoding up to 60 variant triplets at the same position, or the first nucleic acid population may be included in nucleic acids encoding up to 61 different codon triplets at the same position. Each variant may encode a codon that produces a different amino acid during translation. Table 1B provides a list of each codon (and representative amino acid) possible for a variant site.

[0120] Table 1B. List of codons and amino acids

[0121]

[0122] In some cases, each nucleic acid in the colony is included in the codon variation of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more codons in a single nucleic acid. In some cases, each variant long nucleic acid is included in the codon variation of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more codons in a single long nucleic acid. In some cases, the population of variant nucleic acids comprises codon variation at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more codons in a single nucleic acid. In some cases, the population of variant nucleic acids comprises codon variation at at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more codons in a single long nucleic acid.

[0123] Highly parallel nucleic acid synthesis

[0124] This paper presents a platform approach that leverages miniaturization, parallelization, and vertical integration of the end-to-end process from polynucleotide synthesis to gene assembly within on-silicon nanowells to create a revolutionary synthesis platform. The device described herein utilizes the same footprint as a 96-well plate to provide a silicon synthesis platform capable of increasing throughput by up to 1,000-fold or more compared to traditional synthesis methods, generating up to approximately 1,000,000 or more polynucleotides or 10,000 or more genes in a single, highly parallelized run.

[0125] With the advent of next-generation sequencing, high-resolution genomic data has become essential for in-depth investigation of the biological roles of various genes in normal biology and disease pathogenesis. Central to this research is the central dogma of molecular biology and the concept of "continuous, residue-by-residue transfer of information." Genomic information encoded in DNA is transcribed into information that is subsequently translated into proteins, which are the active products within a given biological pathway.

[0126] Another exciting area of ​​research concerns the discovery, development, and production of therapeutic molecules targeting highly specific cellular targets. Highly diverse DNA sequence libraries are central to the development pipeline for targeted therapeutics. Genetic variants are used to express proteins in a design, build, and test protein engineering cycle, ideally resulting in a gene optimized for high expression of a protein with high affinity for its therapeutic target. As an example, consider the binding pocket of a receptor. The ability to simultaneously test all sequence permutations of all residues within the binding pocket allows for a thorough exploration, increasing the likelihood of success. Saturation mutagenesis (in which researchers attempt to generate all possible mutations at a specific site within a receptor) represents one approach to this development challenge. While costly, time-consuming, and labor-intensive, it enables the introduction of every variant at every position. In contrast, combinatorial mutagenesis (in which a few selected positions or short DNA segments are extensively modified) produces an incomplete repertoire of variants with biased representation.

[0127] To accelerate the drug development process, libraries with the desired variants available at the right positions for testing at the expected frequency (in other words, precise libraries) enable the reduction of costs and turnaround time for screening. This article provides methods for synthesizing synthetic variant libraries of nucleic acids that can precisely introduce each desired variant at the desired frequency. For the end user, this means not only the ability to thoroughly sample sequence space, but also the ability to query these hypotheses in an efficient manner, thereby reducing costs and screening time. Whole genome editing can elucidate important pathways, every variant and sequence permutation can be tested to obtain the best functional library, and entire pathways and genomes can be reconstructed using thousands of genes to re-engineer biological systems for drug discovery.

[0128] In the first example, the drug itself can be optimized using the methods described herein. For example, in order to improve the specified function of an antibody, a variant polynucleotide library encoding a portion of the antibody is designed and synthesized. A variant nucleic acid library of the antibody can then be generated by the process described herein (e.g., PCR mutagenesis followed by insertion into a vector). The antibody is then expressed in a production cell line and screened for enhanced activity. Example screening includes examining binding affinity to the antigen, stability, or regulation of effector functions (e.g., ADCC, complement, or apoptosis). Exemplary regions used to optimize antibodies include, but are not limited to, Fc regions, Fab regions, variable regions of Fab regions, constant regions of Fab regions, variable domains of heavy or light chains (V H or V L ) and V H or V L specific complementarity determining regions (CDRs).

[0129] The nucleic acid libraries synthesized by the methods described herein can be expressed in various cells relevant to a disease state. Cells relevant to a disease state include cell lines, tissue samples, primary cells from a subject, cultured cells expanded from a subject, or cells in a model system. Exemplary model systems include, but are not limited to, plant and animal models of a disease state.

[0130] To identify variant molecules associated with the prevention, alleviation or treatment of a disease state, the variant nucleic acid library described herein is expressed in cells associated with the disease state, or in cells that can induce cell The cells are expressed in cells that are induced to present with a disease state. In some cases, a drug is used to induce a disease state in the cells. Exemplary tools for inducing a disease state include, but are not limited to, the Cre / Lox recombination system, LPS inflammation induction, and streptozotocin for inducing hypoglycemia. Cells associated with the disease state can be cells from a model system or cultured cells, as well as cells from a subject with a specific disease state. Exemplary disease states include bacterial, fungal, viral, autoimmune, or proliferative disorders (e.g., cancer). In some cases, the variant nucleic acid library is expressed in a model system, cell line, or primary cells derived from a subject and screened for changes in at least one cellular activity. Exemplary cellular activities include, but are not limited to, proliferation, cell cycle progression, cell death, adhesion, migration, replication, cell signaling, energy production, oxygen utilization, metabolic activity and aging, response to free radical damage, or any combination thereof.

[0131] base

[0132] The device used as a polynucleotide synthesis surface can be in the form of a substrate, which includes but is not limited to a homogeneous array surface, a patterned array surface, a channel, a bead, a gel, etc. Provided herein is a substrate comprising a plurality of clusters, wherein each cluster comprises a plurality of seats that support polynucleotide attachment and synthesis. In some cases, the substrate comprises a uniform array surface. For example, the uniform array surface is a uniform plate. As used herein, the term "seat" refers to a discrete area on a structure that provides support for the extension of a polynucleotide encoding a single predetermined sequence from the surface. In some cases, the seat is on a two-dimensional surface (e.g., a substantially planar surface). In some cases, the seat is on a three-dimensional surface (e.g., a hole, micropore, channel, or pillar). In some cases, the surface of the seat comprises a material that is activated and functionalized to attach at least one nucleotide for polynucleotide synthesis, or preferably, to attach a population of identical nucleotides for polynucleotide population synthesis. In some cases, a polynucleotide refers to a population of polynucleotides encoding the same nucleic acid sequence. In some cases, the surface of the substrate includes one or more surfaces of the substrate. The average error rate of polynucleotides synthesized within the libraries described herein using the provided systems and methods is typically less than 1 in 1000, less than about 1 in 2000, less than about 1 in 3000, or lower, typically without error correction.

[0133] Provided herein are surfaces that support the parallel synthesis of multiple polynucleotides having different predetermined sequences at addressable locations on a common support. In some cases, the substrate is a substrate for synthesizing more than 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 0, 900,000, 1,000,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, 10,000,000 or more different polynucleotides. In some cases, the surface is synthetic. , 900,000, 1,000,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, 10,000,000 or more polynucleotides encoding different sequences. In some cases, at least a portion of the polynucleotides have the same sequence or are configured to be synthesized with the same sequence. In some cases, the substrate provides a surface environment for growing polynucleotides having at least 80, 90, 100, 120, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more bases.

[0134] Provided herein is a method for synthesizing polynucleotides on the different seats of substrate, wherein each seat supports a synthetic polynucleotide colony. In some cases, each seat supports synthesis of a polynucleotide colony having a different sequence from the polynucleotide colony grown on another seat. In some cases, each polynucleotide sequence is synthesized into 1, 2, 3, 4, 5, 6, 7, 8, 9 or more redundancies on the different seats in the same seat cluster on the surface for polynucleotide synthesis. In some cases, the seat of substrate is located in a plurality of clusters. In some cases, substrate comprises at least 10, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 20000, 30000, 40000, 50000 or more clusters. In some cases, the substrate comprises more than 2,000, 5,000, 10,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 1,100,000, 1,200,000, 1,300,000, 1,400,000, 1,500,000, 1,600,000, 1,700,000, 1,800,000, 1,900,000, 2 In some cases, the substrate comprises about 10,000 different loci. The amount of loci within a single cluster varies in different cases. In some cases, each cluster comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 300, 400, 500 or more seats. In some cases, each cluster comprises about 50-500 seats. In some cases, each cluster comprises about 100-200 seats. In some cases, each cluster comprises about 100-150 seats. In some cases, each cluster comprises about 109, 121, 130, or 137 seats. In some cases, each cluster comprises about 19, 20, 61, 64 or more seats.Alternatively or in combination, polynucleotide synthesis is performed on a uniform array surface.

[0135] In some cases, the number of different polynucleotides synthesized on a substrate depends on the number of different loci available in the substrate. In some cases, the density of loci within a cluster or surface of the substrate is at least or about 1, 10, 25, 50, 65, 75, 100, 130, 150, 175, 200, 300, 400, 500, 1,000, or more loci / mm. 2 In some cases, the substrate comprises 10-500, 25-400, 50-500, 100-500, 150-500, 10-250, 50-250, 10-200, or 50-200 mm 2 In some cases, the distance between the centers of two adjacent loci within a cluster or surface is about 10-500, about 10-200, or about 10-100 μm. In some cases, the distance between the centers of two adjacent loci is greater than about 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 μm. In some cases, the distance between the centers of two adjacent loci is less than about 200, 150, 100, 80, 70, 60, 40, 30, 20, or 10 μm. In some cases, each locus has a width of about 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 μm. In some cases, each locus has a width of about 0.5-100, 0.5-50, 10-75, or 0.5-50 μm.

[0136] In some cases, the density of clusters within the substrate is at least or about 1 cluster / 100 mm 2 , 1 cluster / 10 mm 2 , 1 cluster / 5 mm 2 , 1 cluster / 4 mm 2 , 1 cluster / 3 mm 2 , 1 cluster / 2 mm 2 , 1 cluster / 1 mm 2 , 2 clusters / 1 mm 2 , 3 clusters / 1mm 2 , 4 clusters / 1 mm 2 , 5 clusters / 1 mm 2 , 10 clusters / 1 mm 2 , 50 clusters / 1 mm 2 or higher. In some cases, the substrate contains about 1 cluster / 10 mm 2 Up to about 10 clusters / 1 mm 2In some cases, the distance between the centers of two adjacent clusters is at least or about 50, 100, 200, 500, 1000, 2000, or 5000 μm. In some cases, the distance between the centers of two adjacent clusters is about 50-100, 50-200, 50-300, 50-500, and 100-2000 μm. In some cases, the distance between the centers of two adjacent clusters is about 0.05-50, 0.05-10, 0.05-5, 0.05-4, 0.05-3, 0.05-2, 0.1-10, 0.2-10, 0.3-10, 0.4-10, 0.5-10, 0.5-5, or 0.5-2 mm. In some cases, each cluster has a cross-section of about 0.5 to about 2, about 0.5 to about 1, or about 1 to about 2 mm. In some cases, each cluster has a cross-section of about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm. In some cases, each cluster has an internal cross-section of about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.15, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm.

[0137] In some cases, the substrate is about the size of a standard 96-well plate, for example, about 100 to about 200 mm by about 50 to about 150 mm. In some cases, the substrate has a diameter of less than or equal to about 1000, 500, 450, 400, 300, 250, 200, 150, 100, or 50 mm. In some cases, the substrate has a diameter of about 25-1000, 25-800, 25-600, 25-500, 25-400, 25-300, or 25-200 mm. In some cases, the substrate has at least about 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 12,000, 15,000, 20,000, 30,000, 40,000, 50,000 mm 2 In some cases, the substrate has a thickness of about 50-2000, 50-1000, 100-1000, 200-1000, or 250-1000 mm.

[0138] Surface material

[0139] The substrates, devices, and reactors provided herein can be made of any material suitable for the methods, compositions, and systems described herein. In some cases, the substrate material is manufactured to exhibit low levels of nucleotide binding. In some cases, the substrate material is modified to produce a different surface that exhibits high levels of nucleotide binding. In some cases, the substrate material is transparent to visible light and / or ultraviolet light. In some cases, the substrate material is sufficiently conductive, for example, capable of forming a uniform electric field across the entire substrate or a portion thereof. In some cases, the conductive material is electrically grounded. In some cases, the substrate is thermally conductive or insulating. In some cases, the material is chemically and thermally resistant to support chemical or biochemical reactions, such as polynucleotide synthesis reactions. In some cases, the substrate comprises a flexible material. For flexible materials, materials may include, but are not limited to, modified and unmodified nylon, nitrocellulose, polypropylene, etc. In some cases, the substrate comprises a rigid material. For rigid materials, materials may include, but are not limited to, glass; fused quartz; silicon; plastics (e.g., polytetrafluoroethylene, polypropylene, polystyrene, polycarbonate, and mixtures thereof); and metals (e.g., gold, platinum, etc.). The substrate, solid support, or reactor can be made of a material selected from silicon, polystyrene, agarose, dextran, cellulose polymers, polyacrylamide, polydimethylsiloxane (PDMS), and glass. The substrate / solid support or the microstructures therein, or the reactor can be made using a combination of the materials listed herein or any other suitable materials known in the art.

[0140] Surface architecture

[0141] Provided herein is a substrate for the methods, compositions, and systems described herein, wherein the substrate has a surface architecture suitable for the methods, compositions, and systems described herein. In some cases, the substrate comprises raised and / or recessed features. One benefit of having such features is that the surface area for supporting polynucleotide synthesis increases. In some cases, a substrate with raised and / or recessed features is referred to as a three-dimensional substrate. In some cases, the three-dimensional substrate comprises one or more channels. In some cases, one or more seats comprise a channel. In some cases, the channel can be deposited with a reagent by a deposition device such as a material deposition device. In some cases, reagents and / or fluids are collected in larger holes that are in communication with one or more channel fluids. For example, the substrate comprises a plurality of channels corresponding to a plurality of seats having a cluster, and the plurality of channels are in communication with a hole fluid of the cluster. In some methods, a polynucleotide library is synthesized in a plurality of seats of a cluster.

[0142] Provided herein is the substrate for method described herein, composition and system, wherein the substrate is configured for polynucleotide synthesis.In some cases, the structure is configured to allow controlled flow and mass transfer path for polynucleotide synthesis on the surface.In some cases, the structure of substrate allows controlled and uniform distribution of mass transfer path, chemical exposure number of times and / or washing efficacy in polynucleotide synthesis process.In some cases, the structure of substrate allows to increase scanning efficiency, for example, by providing the volume that is enough for increasing polynucleotide, the volume excluded by the polynucleotide of increase accounts for the initial available volume that can be used for or is suitable for increasing polynucleotide and is no more than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less.In some cases, three-dimensional structure allows the controlled flow of fluid, thereby allows the rapid exchange of chemical exposure.

[0143] Provided herein are substrates for use in the methods, compositions, and systems described herein, wherein the substrates comprise structures suitable for the methods, compositions, and systems described herein. In some cases, isolation is achieved through physical structure. In some cases, isolation is achieved through differential surface functionalization to create active and inactive regions for polynucleotide synthesis. In some cases, differential functionalization is achieved by alternating hydrophobicity across the substrate surface, resulting in a water contact angle effect that can induce reagent beading or wetting, which can lead to deposition. Using larger structures can reduce splashing and cross-contamination of reagents from adjacent spots to different polynucleotide synthesis sites. In some cases, reagents are deposited at different polynucleotide synthesis sites using a device, such as a material deposition device. The substrates having three-dimensional features are configured in a manner that allows for the synthesis of large numbers of polynucleotides (e.g., greater than about 10,000) with low error rates (e.g., less than about 1:500, 1:1000, 1:1500, 1:2,000; 1:3,000; 1:5,000; or 1:10,000). In some cases, the substrate comprises a density of about or greater than about 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, or 500 features / mm 2 characteristics.

[0144] In some cases, the diameter of cluster or the hole that comprises cluster or both are about 0.05-50,0.05-10,0.05-5,0.05-4,0.05-3,0.05-2,0.05-1,0.05-0.5,0.05-0.1,0.1-10,0.2-10,0.3-10,0.4-10,0.5-10,0.5-5 or 0.5-2 mm. In some cases, cluster or hole or both diameters are less than or are about 5,4,3,2,1,0.5,0.1,0.09,0.08,0.07,0.06 or 0.05 mm. In some cases, the diameter of the cluster or the hole or both is about 1.0 mm to 1.3 mm. In some cases, the diameter of the cluster or the hole or both is about 1.150 mm. In some cases, the diameter of the cluster or the hole or both is about 0.08 mm. The diameter of the cluster refers to the cluster within a two-dimensional or three-dimensional substrate.

[0145] In some cases, the height of the pores is about 20-1000, 50-1000, 100-1000, 200-1000, 300-1000, 400-1000, or 500-1000 um. In some cases, the height of the pores is less than about 1000, 900, 800, 700, or 600 um.

[0146] In some cases, the substrate comprises a plurality of channels corresponding to the plurality of loci within the cluster, wherein the channels have a height or depth of 5-500, 5-400, 5-300, 5-200, 5-100, 5-50, or 10-50 μm. In some cases, the height of the channels is less than 100, 80, 60, 40, or 20 μm.

[0147] In some cases, the diameter of the channel, the seat (e.g., in a substantially flat substrate), or both the channel and the seat (e.g., in a three-dimensional substrate in which the seat corresponds to the channel) is about 1-1000, 1-500, 1-200, 1-100, 5-100, or 10-100 μm, such as about 90, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some cases, the diameter of the channel, the seat, or both the channel and the seat is less than about 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some cases, the distance between the centers of two adjacent channels, seats, or channels and seats is about 1-500, 1-200, 1-100, 5-200, 5-100, 5-50, or 5-30, such as about 20 μm.

[0148] Surface modification

[0149] Provided herein are methods for synthesizing polynucleotides on a surface, wherein the surface comprises various surface modifications. In some cases, surface modification is employed to chemically and / or physically alter the surface by additive or subtractive processes to alter one or more chemical and / or physical properties of the substrate surface or selected sites or regions of the substrate surface. For example, surface modification includes, but is not limited to: (1) altering the wetting properties of a surface; (2) functionalizing a surface, i.e., providing, modifying, or replacing surface functional groups; (3) defunctionalizing a surface, i.e., removing surface functional groups; (4) otherwise altering the chemical composition of a surface, such as by etching; (5) increasing or decreasing surface roughness; (6) providing a coating on a surface, e.g., a coating that exhibits wetting properties different from those of the surface; and / or (7) depositing microparticles on a surface.

[0150] In some cases, adding a chemical layer (referred to as an adhesion promoter) on top of the surface facilitates the structured patterning of seats on the substrate surface. Exemplary surfaces for applying the adhesion promoter include, but are not limited to, glass, silicon, silicon dioxide, and silicon nitride. In some cases, the adhesion promoter is a chemical with a high surface energy. In some cases, a second chemical layer is deposited on the surface of the substrate. In some cases, the second chemical layer has a low surface energy. In some cases, the surface energy of the chemical layer applied to the surface supports the positioning of small droplets on the surface. Depending on the patterning arrangement selected, the proximity of the seats and / or the fluid contact area at the seats can be varied.

[0151] In some cases, the substrate surface or resolved loci onto which the nucleic acid or other moiety is deposited (e.g., for polynucleotide synthesis) is smooth or substantially planar (e.g., two-dimensional) or has irregularities such as raised or recessed features (e.g., three-dimensional features). In some cases, the substrate surface is modified with one or more layers of different compounds. Such modified layers of interest include, but are not limited to, inorganic and organic layers, such as metals, metal oxides, polymers, small organic molecules, and the like.

[0152] In some cases, the resolved loci of a substrate are functionalized with one or more moieties that increase and / or decrease surface energy. In some cases, the moieties are chemically inert. In some cases, the moieties are configured to support a desired chemical reaction, such as one or more processes in a polynucleotide synthesis reaction. The surface energy or hydrophobicity of a surface is a factor that determines the affinity with which nucleotides attach to that surface. In some cases, a method for functionalizing a substrate comprises: (a) providing a substrate having a surface comprising silica; and (b) silanizing the surface using a suitable silanizing agent (e.g., an organofunctional alkoxysilane molecule) as described herein or known in the art. Methods and functionalizing agents are described in U.S. Patent No. 5,474,796, which is incorporated herein by reference in its entirety.

[0153] In some cases, the substrate surface is functionalized by contacting the substrate surface with a derivatizing composition containing a mixture of silanes, typically via reactive hydrophilic moieties present on the substrate surface, under reaction conditions effective to couple the silanes to the substrate surface. Silanization is generally performed by self-assembly of organofunctional alkoxysilane molecules to coat the surface. Various siloxane functionalizing agents currently known in the art can also be used, for example, to reduce or increase surface energy. Organofunctional alkoxysilanes are classified according to their organic functionality.

[0154] Polynucleotide synthesis

[0155] The disclosed method for polynucleotide synthesis may include a process involving phosphoramidite chemistry. In some cases, polynucleotide synthesis includes coupling a base with a phosphoramidite. Polynucleotide synthesis may include coupling a base by depositing a phosphoramidite under coupling conditions, wherein the same base is optionally deposited more than once with the phosphoramidite, i.e., double coupling. Polynucleotide synthesis may include capping of unreacted sites. In some cases, capping is optional. Polynucleotide synthesis may also include oxidation or an oxidation step or multiple oxidation steps. Polynucleotide synthesis may include unblocking, detritylation, and sulfurization. In some cases, polynucleotide synthesis includes oxidation or sulfurization. In some cases, between a step or each step during the polynucleotide synthesis reaction, for example, tetrazolium or acetonitrile is used to wash the device. The time range of any step in the phosphoramidite synthesis method may be less than approximately 2 min, 1 min, 50 sec, 40 sec, 30 sec, 20 sec, and 10 sec.

[0156] Polynucleotide synthesis using the phosphoramidite method can include subsequently adding a phosphoramidite building block (e.g., a nucleoside phosphoramidite) to a growing polynucleotide chain to form a phosphite triester bond. Phosphoramidite polynucleotide synthesis proceeds in a 3' to 5' direction. Phosphoramidite polynucleotide synthesis allows for the controlled addition of one nucleotide to a growing nucleic acid chain in each synthesis cycle. In some cases, each synthesis cycle includes a coupling step. Phosphoramidite coupling includes forming a phosphite triester bond between an activated nucleoside phosphoramidite and a nucleoside bound to a substrate (e.g., via a linker). In some cases, the activated nucleoside phosphoramidite is provided to a device. In some cases, the nucleoside phosphoramidite is provided to the device together with an activator. In some cases, the nucleoside phosphoramidite is provided to the device in an excess of 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100 times or more relative to the nucleoside bound to the substrate. In some cases, the addition of the nucleoside phosphoramidite is carried out in an anhydrous environment (e.g., in anhydrous acetonitrile). After the addition of the nucleoside phosphoramidite, the device is optionally washed. In some cases, the coupling step is repeated one or more times, optionally with a washing step between the addition of the nucleoside phosphoramidite to the substrate. In some cases, the polynucleotide synthesis method used herein comprises 1, 2, 3 or more consecutive coupling steps. In many cases, prior to coupling, the nucleoside bound to the device is deprotected by removing a protecting group, wherein the protecting group serves to prevent polymerization. A common protecting group is 4,4'-dimethoxytrityl (DMT).

[0157] After coupling, the phosphoramidite polynucleotide synthesis method optionally includes a capping step. In the capping step, the growing polynucleotide is treated with a capping agent. The capping step can be used to block unreacted substrate-bound 5'-OH groups after coupling to prevent further chain extension, thereby preventing the formation of polynucleotides with internal base deletions. Furthermore, phosphoramidites activated with 1H-tetrazole can react to a small extent with the O6 position of guanosine. Without being bound by theory, this byproduct (possibly via O6-N7 migration) may undergo depurination after oxidation with I2 / water. Apurinic sites may end up being cleaved during the final deprotection process of the polynucleotide, thereby reducing the yield of the full-length product. The O6 modification can be removed by treatment with a capping agent prior to oxidation with I2 / water. In some cases, including a capping step in the polynucleotide synthesis process can reduce the error rate compared to synthesis without capping. As an example, the capping step includes treating the substrate-bound polynucleotide with a mixture of acetic anhydride and 1-methylimidazole. After the capping step, the apparatus is optionally washed.

[0158] In some cases, after adding the nucleoside phosphoramidite, and optionally after capping and one or more wash steps, the growing nucleic acid bound to the device is oxidized. The oxidation step involves oxidation of a phosphite triester to a tetracoordinate phosphotriester, a protected precursor of naturally occurring phosphodiester internucleoside linkages. In some cases, oxidation of the growing polynucleotide is achieved by treatment with iodine and water, optionally in the presence of a weak base (e.g., pyridine, lutidine, collidine). Oxidation can be performed under anhydrous conditions using, for example, tert-butyl hydroperoxide or (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO). In some methods, a capping step is performed after oxidation. This second capping step allows the device to dry, as any residual water from the oxidation may inhibit subsequent coupling. After oxidation, the device and growing polynucleotide are optionally washed. In some cases, the oxidation step is replaced by a sulfurization step to obtain polynucleotide phosphorothioates, wherein any capping step can be performed after sulfurization. Many reagents are capable of efficient sulfur transfer, including but not limited to 3-(dimethylaminomethylene)amino)-3H-1,2,4-dithiazole-3-thione, DDTT, 3H-1,2-benzodithiolan-3-one 1,1-dioxide (also known as Beaucage's reagent), and N,N,N'N'-tetraethylthiuram disulfide (TETD).

[0159] In order to make subsequent nucleoside incorporate circulation and take place by coupling, remove the protected 5 ' end of the polynucleotide of growth that is combined with device, make primary hydroxyl and next nucleoside phosphoramidite reaction.In some cases, blocking group is DMT, and the trichloroacetic acid in dichloromethane is used to deblock.Carry out the detritylation of prolonging time or use the acid solution stronger than the acid solution of recommendation to detritylation and can cause the depurination of the polynucleotide that is combined with solid support to increase, and therefore reduced the productive rate of required full-length product.The method and composition of the present disclosure as herein described provide controlled deblocking condition, thereby limit undesirable depurination reaction.In some cases, the polynucleotide that is combined with device is washed after deblocking.In some cases, the effective washing after deblocking helps to synthesize polynucleotide with low error rate.

[0160] Polynucleotide synthesis methods generally include a series of iterative steps: applying a protected monomer to an activated functionalized surface (e.g., a locus) for attachment to the activated surface, a linker, or a previously deprotected monomer; deprotecting the applied monomer to allow reaction with a subsequently applied protected monomer; and applying another protected monomer for attachment. One or more intermediate steps may include oxidation or sulfurization. In some cases, one or all of the steps are preceded or followed by one or more wash steps.

[0161] The polynucleotide synthesis method based on phosphoramidite comprises a series of chemical steps. In some cases, one or more steps of the synthesis method involve reagent circulation, wherein one or more steps of the method include applying a reagent useful for the step to the device. For example, the reagent is circulated through a series of liquid deposition and vacuum drying steps. For substrates containing three-dimensional features such as holes, micropores, channels, etc., the reagent is optionally passed through one or more regions of the device via the holes and / or channels.

[0162] The methods and systems described herein relate to polynucleotide synthesis apparatus for synthesizing polynucleotides. The synthesis can be parallel. For example, at least or about at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 1000, 10,000, 50,000, 75,000, 100,000 or more polynucleotides can be synthesized in parallel. The total number of polynucleotides that can be synthesized in parallel can be 2-100000, 3-50000, 4-10000, 5-1000, 6-900, 7-850, 8-800, 9-750, 10-700, 11-650, 12-600, 13-550, 14-500, 15-450, 16-400, 17-350, 18-300, 19-250, 20-200, 21-150, 22-100, 23-50, 24-45, 25-40, 30-35. Those skilled in the art will appreciate that the total number of polynucleotides synthesized in parallel can be in any range defined by any of these values, for example 25-100. The total number of polynucleotides synthesized in parallel can be in any range defined by any value serving as a range endpoint. The total molar mass of the polynucleotides synthesized in the device or the molar mass of each polynucleotide can be at least or about 10, 20, 30, 40, 50, 100, 250, 500, 750, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 25000, 50000, 75000, 100000 picomoles or more. The length of each polynucleotide or the average length of the polynucleotides in the device can be at least or about at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500 or more nucleotides. The length of each polynucleotide or the average length of polynucleotides in the device can be at most or about at most 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 or fewer nucleotides. The length of each polynucleotide or the average length of polynucleotides in the device can be between 10-500, 9-400, 11-300, 12-200, 13-150, 14-100, 15-50, 16-45, 17-40, 18-35, 19-25.Those skilled in the art will appreciate that the length of each polynucleotide or the average length of polynucleotides within a device can fall within any range bounded by any of these values, for example, 100 to 300. The length of each polynucleotide or the average length of polynucleotides within a device can fall within any range bounded by any of the values ​​serving as endpoints of the range.

[0163] The method for synthesizing polynucleotides from the outside provided herein allows to synthesize at a faster speed. As an example, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175, 200 or more nucleotides are synthesized per hour. Nucleotide includes adenine, guanine, thymine, cytosine, uridine building blocks, or its analog / modified form. In some cases, polynucleotide libraries are synthesized in parallel on substrate. In some cases, polynucleotide libraries are synthesized on a device with a low error rate as described herein in less than about three months, two months, one month, three weeks, 15 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, 24 hours or less. In some cases, larger nucleic acids assembled from a library of polynucleotides synthesized with low error rates using the substrates and methods described herein are prepared in less than about three months, two months, one month, three weeks, 15 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, 24 hours, or less.

[0164] In some cases, methods described herein provide for generating a nucleic acid library comprising different variant nucleic acids at multiple codon sites. In some cases, the nucleic acid can have 1 site, 2 sites, 3 sites, 4 sites, 5 sites, 6 sites, 7 sites, 8 sites, 9 sites, 10 sites, 11 sites, 12 sites, 13 sites, 14 sites, 15 sites, 16 sites, 17 sites, 18 sites, 19 sites, 20 sites, 30 sites, 40 sites, 50 sites or more variant codon sites.

[0165] In some cases, one or more sites of variant codon sites can be adjacent. In some cases, one or more sites of variant codon sites can be non-adjacent and separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more codons.

[0166] In some cases, a nucleic acid may comprise multiple sites of variant codon sites, wherein all variant codon sites are adjacent to each other, forming a stretch of variant codon sites. In some cases, a nucleic acid may comprise multiple sites of variant codon sites, wherein none of the variant codon sites are adjacent to each other. In some cases, a nucleic acid may comprise multiple sites of variant codon sites, wherein some of the variant codon sites are adjacent to each other, forming a stretch of variant codon sites, and some of the variant codon sites are not adjacent to each other.

[0167] See attached figure, Figure 1 An exemplary processing workflow for synthesizing nucleic acids (e.g., genes) from shorter nucleic acids is shown. The workflow is broadly divided into the following stages: (1) de novo synthesis of a single-stranded nucleic acid library, (2) ligation of nucleic acids to form larger fragments, (3) error correction, (4) quality control, and (5) shipping. Prior to de novo synthesis, the desired nucleic acid sequence or set of nucleic acid sequences is preselected. For example, a set of genes is preselected for generation.

[0168] Once the large nucleic acid for generation is selected, a predetermined nucleic acid library is designed for de novo synthesis. Various suitable methods for generating high-density polynucleotide arrays are known. In this workflow example, a device surface layer is provided. In this example, the chemical properties of the surface are changed to improve the polynucleotide synthesis process. Low surface energy areas are generated to repel liquids, while high surface energy areas are generated to attract liquids. The surface itself can be in the form of a planar surface or contain changes in shape, such as protrusions or micropores that increase the surface area. In this workflow example, as disclosed in International Patent Application Publication WO / 2015 / 021080, which is incorporated herein by reference in its entirety, the selected high surface energy molecules perform the dual function of supporting DNA chemical processes.

[0169] In situ preparation of a polynucleotide array is performed on a solid support, and multiple oligomers are extended in parallel using a single nucleotide extension process. A deposition device, such as a material deposition device, is designed to release reagents in a stepwise manner, allowing multiple polynucleotides to be extended in parallel one residue at a time to generate oligomers 102 having a predetermined nucleic acid sequence. In some cases, the polynucleotides are cleaved from the surface at this stage. Cleavage can include, for example, gas cleavage using ammonia or methylamine.

[0170] The generated polynucleotide library is placed in a reaction chamber. In this exemplary workflow, the reaction chamber (also referred to as a "nanoreactor") is a silicon-coated well that contains PCR reagents and is lowered onto the polynucleotide library 103. Before or after the polynucleotide seal 104, reagents are added to release the polynucleotide from the substrate. In this exemplary workflow, the polynucleotide is released after the nanoreactor seal 105. Once released, fragments of the single-stranded polynucleotide hybridize to span the entire long-range DNA sequence. Partial hybridization 105 is possible because each synthesized polynucleotide is designed to have a small portion that overlaps with at least one other polynucleotide in the pool.

[0171] After hybridization, the PCA reaction begins. During the polymerase cycle, the polynucleotides anneal to the complementary fragments, and the gaps are filled with polymerase. Each cycle randomly increases the length of each fragment, depending on which polynucleotides find each other. The complementarity between the fragments allows the formation of a complete, long-span double-stranded DNA.

[0172] After PCA is complete, the nanoreactor is separated from the device 107 and positioned to interact with the device with PCR primers 108. Once sealed, the nanoreactor undergoes PCR 109 and amplifies the larger nucleic acid. Following PCR 110, the nanochamber is opened 111, an error correction reagent is added 112, the chamber is sealed 113, and an error correction reaction is performed to remove mismatched base pairs and / or strands with poor complementarity from the double-stranded PCR amplification product 114. The nanoreactor is opened and separated 115. The error-corrected product then undergoes additional processing steps, such as PCR and molecular barcoding, before being packaged 122 for shipping 123.

[0173] In some cases, quality control measures are taken. After error correction, quality control steps include, for example, interacting with a wafer containing sequencing primers for amplifying the error-corrected product 116, sealing the wafer into a chamber containing the error-corrected amplified product 117, and performing another round of amplification 118. The nanoreactor is opened 119, and the products are combined 120 and sequenced 121. After obtaining acceptable quality control results, the packaged product 122 is approved for shipping 123.

[0174] In some cases, through Figure 1 Nucleic acids generated using the workflow described herein are mutagenized using overlapping primers disclosed herein. In some cases, a primer library is generated by in situ preparation on a solid support, and multiple oligomers are extended in parallel using a single nucleotide extension process. A deposition device, such as a material deposition device, is designed to release reagents in a stepwise manner, allowing multiple polynucleotides to be extended in parallel one residue at a time to generate oligomers 102 having a predetermined nucleic acid sequence.

[0175] Computer system

[0176] Any of the systems described herein can be operably connected to a computer and can be automated locally or remotely via the computer. In various cases, the methods and systems of the present disclosure may further include a software program on the computer system and its use. Thus, computerized control of the synchronization of the dispense / vacuum / refill functions (e.g., orchestrating and synchronizing the material deposition device motion, dispense action, and vacuum actuation) is within the scope of the present disclosure. The computer system can be programmed to interface between a user-specified base sequence and the position of the material deposition device to deliver the correct reagent to the specified area of ​​the substrate.

[0177] Figure 2 The computer system 200 shown in FIG can be understood as a logical device capable of reading instructions from a medium 211 and / or a network port 205, which can optionally be connected to a server 209 having a fixed medium 212. Figure 2 The system shown may include a CPU 201, a disk drive 203, optional input devices such as a keyboard 215 and / or a mouse 216, and an optional monitor 207. Data communication with a server at a local or remote location may be achieved via the communication medium shown. The communication medium may include any means of transmitting and / or receiving data. For example, the communication medium may be a network connection, a wireless connection, or an Internet connection. Such a connection may provide communication via the World Wide Web. It is contemplated that data related to the present disclosure may be transmitted via such a network or connection so that it can be used by Figure 2 User party 222 is shown receiving and / or reviewing.

[0178] like Figure 3As shown, cache memory 304 may be connected to or incorporated into processor 302 to provide high-speed storage for recently or frequently used instructions or data by processor 302. Processor 302 is connected to northbridge 306 via processor bus 308. Northbridge 306 is connected to random access memory (RAM) 310 via memory bus 312 and manages processor 302's access to RAM 310. Northbridge 306 is also connected to southbridge 314 via chipset bus 316. Southbridge 314, in turn, is connected to peripheral bus 318. The peripheral bus may be, for example, a PCI, PCI-X, PCI Express, or other peripheral bus. The northbridge and southbridge are often referred to as a processor chipset and manage data transfer between the processor, RAM, and peripheral components on peripheral bus 318. In some alternative architectures, the functionality of the northbridge may be incorporated into the processor, rather than using a separate northbridge chip. In some cases, system 300 may include an accelerator card 322 attached to peripheral bus 318. An accelerator may include a field-programmable gate array (FPGA) or other hardware used to accelerate a process. For example, an accelerator may be used for adaptive data reconstruction or to evaluate algebraic expressions used in extended set processing.

[0179] Software and data are stored in external memory 324 and can be loaded into RAM 310 and / or cache memory 304 for use by the processor. System 300 includes an operating system for managing system resources; non-limiting examples of operating systems include: Linux, Windows TM 、MACOS TM 、BlackBerry OS TM 、iOS TM and other functionally equivalent operating systems, and application software running on top of the operating systems for managing data storage and optimization according to the exemplary embodiments of the present disclosure. In this example, system 300 also includes network interface cards (NICs) 320 and 321 connected to the peripheral bus to provide a network interface with external storage such as network attached storage (NAS) and other computer systems that can be used for distributed parallel processing.

[0180] Figure 41 is a diagram illustrating a network 400 having multiple computer systems 402a and 402b, multiple cell phones and personal data assistants 402c, and network attached storage (NAS) 404a and 404b. In the illustrated example, systems 402a, 402b, and 402c can manage data storage and optimize data access to data stored in the NAS 404a and 404b. Mathematical models can be applied to the data and evaluated using distributed parallel processing across the computer systems 402a and 402b and the cell phones and personal data assistant system 402c. The computer systems 402a and 402b and the cell phones and personal data assistant system 402c can also provide parallel processing for adaptive data reconstruction of the data stored in the NAS 404a and 404b. Figure 4 Only one example is shown, and a variety of other computer architectures and systems can be used with various examples of the present disclosure. For example, blade servers can be used to provide parallel processing. Processor blades can be connected via a backplane to provide parallel processing. Storage can also be connected to the backplane via a separate network interface or as network attached storage (NAS). In some example embodiments, a processor can maintain a separate memory space and transfer data via a network interface, backplane, or other connector for parallel processing by other processors. In other cases, some or all processors can use a shared virtual address memory space.

[0181] Figure 5 The block diagram of a multi-processor computer system 500 using a shared virtual address memory space is shown in FIG. The system includes multiple processors 502a-f that can access a shared memory subsystem 504. In the system, multiple programmable hardware memory algorithm processors (MAPs) 506a-f are incorporated into the memory subsystem 504. Each MAP 506a-f can contain memory 508a-f and one or more field-programmable gate arrays (FPGAs) 510a-f. The MAPs provide configurable functional units and can provide specific algorithms or portions of algorithms to the FPGAs 510a-f for processing in close coordination with the respective processors. For example, in the example scenario, the MAPs can be used to evaluate algebraic expressions associated with data models and to perform adaptive data reconstruction. In this example, each MAP is globally accessible to all processors used for these purposes. In one configuration, each MAP can use direct memory access (DMA) to access its associated memory 508a-f, enabling it to perform tasks independently and asynchronously from its respective microprocessor 502a-f. In this configuration, a MAP can feed results directly to another MAP for pipelining and parallel execution of algorithms.

[0182] The above computer architectures and systems are examples only, and a wide variety of other computer, cell phone, and personal data assistant architectures and systems can be used in conjunction with the example embodiments, including systems using any combination of general-purpose processors, coprocessors, FPGAs and other programmable logic devices, systems on a chip (SOCs), application-specific integrated circuits (ASICs), and other processing and logic elements. In some cases, all or part of the computer system can be implemented in software or hardware. Any type of data storage media can be used in conjunction with the example embodiments, including random access memory, hard drives, flash memory, tape drives, disk arrays, network attached storage (NAS), and other local or distributed data storage devices and systems.

[0183] In an exemplary embodiment, the computer system may be implemented using software modules executed on any of the above or other computer architectures and systems. In other examples, the functionality of the system may be implemented partially or completely in firmware, programmable logic devices such as Figure 3 The mentioned field programmable gate array (FPGA), system on chip (SOC), application specific integrated circuit (ASIC) or other processing and logic elements are implemented. For example, the set processor and optimizer can be implemented by using hardware accelerator cards such as Figure 3 The accelerator card 322 is shown as being implemented using hardware acceleration.

[0184] The following examples are set forth to more clearly illustrate the principles and practices of the embodiments disclosed herein to those skilled in the art and should not be construed as limiting the scope of any claimed embodiments. Unless otherwise indicated, all parts and percentages are by weight. Example

[0185] The following examples are given for the purpose of illustrating various embodiments of the present disclosure and are not intended to limit the present invention in any way. These examples and the methods described herein, which presently represent preferred embodiments, are exemplary and are not intended to limit the scope of the present disclosure. Those skilled in the art will appreciate variations thereon and other uses that are within the spirit of the present disclosure as defined by the scope of the claims.

[0186] Example 1: Functionalization of device surfaces

[0187] The device was functionalized to support the attachment and synthesis of polynucleotide libraries. The device surface was first wet-cleaned for 20 minutes using a piranha solution containing 90% H2SO4 and 10% H2O2. The device was rinsed in several beakers containing deionized water, held under a deionized water gooseneck stopcock for 5 minutes, and dried with N2. The device was then immersed in NH4OH (1:100; 3 mL:300 mL) for 5 minutes, rinsed with deionized water using a handgun, immersed in three consecutive beakers containing deionized water for 1 minute each, and then rinsed with deionized water using a handgun again. The device was then plasma cleaned by exposing the device surface to O2. O2 plasma etching was performed using a SAMCO PC-300 instrument in downstream mode at 250 watts for 1 minute.

[0188] The cleaned device surface was activated and functionalized with a solution containing N-(3-triethoxysilylpropyl)-4-hydroxybutanamide using a YES-1224P vapor deposition oven system with the following parameters: 0.5 to 1 torr, 60 min, 70°C, 135°C vaporizer. The device surface was resist coated using a Brewer Science 200X spin coater. SPR™ 3612 photoresist was spin-coated on the device at 2500 rpm for 40 sec. The device was pre-baked at 90°C for 30 min on a Brewer hot plate. The device was photolithographically processed using a Karl Suss MA6 mask aligner. The device was exposed for 2.2 sec and developed in MSF 26A for 1 min. The remaining developer was rinsed with a handheld spray gun, and the device was immersed in water for 5 min. The device was baked in an oven at 100°C for 30 min and then visually inspected for photolithographic defects using a Nikon L200. The residual resist was removed by a pre-clearing (descum) process using a SAMCO PC-300 instrument with O2 plasma etching at 250 W for 1 min.

[0189] The device surface was passivated and functionalized using 100 µL of a solution of perfluorooctyltrichlorosilane mixed with 10 µL of light mineral oil. The device was placed in a chamber and pumped for 10 minutes, after which the valve to the pump was closed and allowed to stand for 10 minutes. The chamber was vented. The device was stripped of resist by two 5-minute soaks in 500 mL of NMP at 70°C while sonicating at maximum power (9 on a Crest system). The device was then soaked in 500 mL of isopropanol at room temperature for 5 minutes while sonicating at maximum power. The device was then immersed in 300 mL of 200-proof ethanol and dried with N2. The functionalized surface was activated to serve as a support for polynucleotide synthesis.

[0190] Example 2: Synthesis of 50-mer sequences on an oligonucleotide synthesis apparatus

[0191] A two-dimensional oligonucleotide synthesis device was assembled into a flow cell, which was connected to a flow cell (Applied Biosystems (ABI394 DNA Synthesizer"). The two-dimensional oligonucleotide synthesis device was uniformly functionalized with N-(3-triethoxysilylpropyl)-4-hydroxybutanamide (Gelest) and used to synthesize an exemplary polynucleotide of 50 bp ("50-mer polynucleotide") using the polynucleotide synthesis method described herein.

[0192] The sequence of the 50-mer is shown in SEQ ID NO.: 104. 5'AGACAATCAACCATTTGGGGTGGACAGCCTTGACCTCTAGACTTCGGCAT##TTTTTTTTTT3' (SEQ ID NO.: 104), where # represents thymidine-succinylhexanamide CED phosphoramidite (CLP-2244 from ChemGenes), which is a cleavable linker that allows release of the polynucleotide from the surface during deprotection.

[0193] Synthesis was accomplished using standard DNA synthesis chemistry (coupling, capping, oxidation, and deblocking) according to the protocol in Table 2 and an ABI synthesizer.

[0194] Table 2: Synthesis scheme

[0195]

[0196] The phosphoramidite / activator combination is delivered in a manner similar to the bulk reagent delivery through the flow cell. No drying step is performed as the environment is kept "wet" with reagent at all times.

[0197] The restrictor was removed from the ABI 394 synthesizer to enable faster flow. Without a restrictor, the flow rates of amidites (0.1 M in ACN), activator (0.25 M benzoylthiotetrazolyl ("BTT"; 30-3070-xx from Glen Research) in ACN), and Ox (0.02 M I2 in 20% pyridine, 10% water, and 70% THF) were approximately ~100 uL / sec, the flow rates of acetonitrile ("ACN") and capping reagent (a 1:1 mixture of Cap A and Cap B, where Cap A is acetic anhydride in THF / pyridine and Cap B is 16% 1-methylimidizole in THF) were approximately ~200 uL / sec, and the flow rate of deblocking reagent (3% dichloroacetic acid in toluene) was approximately ~300 uL / sec (compared to ~50 uL / sec for all reagents with a restrictor). The time for complete oxidant expulsion was observed, and the timing of chemical flow times was adjusted accordingly, with additional ACN washes introduced between different chemicals. Following polynucleotide synthesis, the chip was deprotected overnight in gaseous ammonia at 75 psi. Five drops of water were applied to the surface to recover the polynucleotides. The recovered polynucleotides were then analyzed on a BioAnalyzer small RNA chip.

[0198] Example 3: Synthesis of 100-mer sequences on an oligonucleotide synthesis apparatus

[0199] Using the same process described in Example 2 for the synthesis of 50-mer sequences, 100-mer polynucleotides ("100-mer polynucleotide"; 5' CGGGATCCTTATCGTCATCGTCGTACAGATCCCGACCCATTTGCTGTCCACCAGTCATGCTAGCCATACCATGATGATGATGATGATGAGAACCCCGCAT##TTTTTTTTTT3', where # represents thymidine-succinylhexanamide CED phosphoramidite (CLP-2244 from ChemGenes); SEQ ID NO.: 105) were synthesized on two different silicon chips, the first uniformly functionalized with N-(3-triethoxysilylpropyl)-4-hydroxybutanamide and the second functionalized with a 5 / 95 mixture of 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane, and polynucleotides extracted from the surface were analyzed on a BioAnalyzer instrument.

[0200] All ten samples from both chips were further PCR amplified using a forward primer (5'ATGCGGGGTTCTCATCATC3'; SEQ ID NO.: 106) and a reverse primer (5'CGGGATCCTTATCGTCATCG3'; SEQ ID NO.: 107) in a 50 uL PCR mixture (25 uL NEB Q5 master mix, 2.5 uL 10 uM forward primer, 2.5 uL 10 uM reverse primer, 1 uL polynucleotide extracted from the surface, and water to 50 uL) using the following thermal cycling program:

[0201] 98°C, 30 seconds

[0202] 98°C, 10 sec; 63°C, 10 sec; 72°C, 10 sec; repeat 12 cycles

[0203] 72°C, 2 minutes

[0204] The PCR products were also run on a BioAnalyzer, showing a sharp peak at the 100-mer position. The PCR-amplified samples were then cloned and subjected to Sanger sequencing. Table 3 summarizes the Sanger sequencing results for samples collected from spots 1-5 on chip 1 and spots 6-10 on chip 2.

[0205] Table 3: Sequencing results

[0206]

[0207] Thus, the high quality and uniformity of the synthesized polynucleotides were reproducible on two chips with different surface chemistries. Overall, 89% of the sequenced 100-mers were perfect sequences with no errors, corresponding to 233 out of 262.

[0208] Table 4 summarizes the error signatures of sequences obtained from polynucleotide samples from spots 1-10.

[0209] Table 4: Error characteristics

[0210]

[0211] Example 4: VHH library

[0212] A synthetic VHH library was developed. For the "VHH Ratio" library with customized CDR diversity, 2,391 VHH sequences (iCAN database) were aligned using ClustalOmega to determine the consensus sequence for each position, and the frameworks were derived from the consensus sequence at each position. The CDRs of all 2,391 sequences were analyzed for position-specific variation, and this diversity was incorporated into the library design. For the "VHH Shuffle" library with shuffled CDR diversity, the iCAN database was scanned for unique CDRs in Nanobody sequences. 1,239 unique CDR1s, 1,600 unique CDR2s, and 1,608 unique CDR3s were identified, and the frameworks were derived from the consensus sequence for each framework position in the 2,391 sequences in the iCAN database. Each unique CDR was individually synthesized and shuffled within the consensus framework to generate a library with a theoretical diversity of 3.2 x 10^9. The library was then cloned into a phagemid vector using restriction enzyme digestion. For the "VHH h shuffled" library (a synthetic "human" VHH library with shuffled CDR diversity), the iCAN database was scanned for unique CDRs in the Nanobody sequences. 1239 unique CDR1s, 1600 unique CDR2s, and 1608 unique CDR3s were identified, and frameworks 1, 3, and 4 were derived from the human germline DP-47 framework. Framework 2 was derived from the consensus sequence for each framework position in 2391 sequences in the iCAN database. Each unique CDR was individually synthesized and shuffled in a partially humanized framework using the NUGE tool to generate a library with a theoretical diversity of 3.2 x 10^9. The library was then cloned into a phagemid vector using the NUGE tool.

[0213] The binding affinity and affinity distribution of VHH-Fc variants were evaluated using the Carterra SPR system. VHH-Fc displayed a range of affinities for TIGIT, with a lower bound of 12 nM K. D , with an upper limit of 1685 nM K D (Data not shown) Table 5A provides the specific values ​​of VHH-Fc clones, Protein A (mg / ml) and KD (nM) used for ELISA. Figure 6 and Figure 7 At an affinity threshold of 20-4000 ( Figure 6 ; monovalent KD) and 20-1000 affinity threshold ( Figure 7 The TIGIT affinity distribution of the VHH library is depicted on Figure 4 (Figure 4B; monovalent KD). Among the 140 tested VHH binders, 51 variants had affinities <100 nM and 90 variants had affinities <200 nM. Figure 8CDR3 count data for each length are shown for the "VHH Ratio" library, the "VHH Shuffled Library," and the "VHH h Shuffled Library." Table 5B shows the number of TIGIT unique clones and TIGIT binders for the "VHH Ratio" library, the "VHH Shuffled Library," and the "VHH h Shuffled Library."

[0214] Table 5A.

[0215]

[0216] Table 5B. TIGIT-unique clones and TIGIT binders

[0217]

[0218] Thermostability and competition analysis of VHH-Fc TIGIT clones are presented in Figure 9 and Table 6. For competition assays, 4ug / mL TIGIT was immobilized and incubated with 0.05–100 nM VHH-Fc, followed by incubation with 2ug / mL biotin-CD155 and 1:5000 streptavidin-HRP.

[0219] Table 6. Thermal stability of VHH-FcTIGIT clones

[0220]

[0221] CD47 VHH variants were also generated and analyzed. Figure 10 The CD47 affinity distribution is shown. Table 7 shows the number of unique CD47 clones and TIGIT binders for the "VHH Ratio" library, the "VHH Shuffled Library," and the "VHH h Shuffled Library." Table 8 shows the binding affinities of the CD47 VHH variants. As seen in Table 8, eight CD47 VHH binders had affinities of less than 100 nM for hCD47, and six CD47 VHH binders had affinities of less than 100 nM for cCD47.

[0222] Table 7. VHH-FcCD47 clones

[0223]

[0224] Table 8. VHH-FcCD47 binding affinity

[0225]

[0226] Inhibition and thermostability analysis of VHH-Fc CD47 clones is described in Figure 11and Table 9. For inhibition assays, 3 ug / mL CD47 was immobilized and incubated with 0.3-132 nM VHH-Fc, followed by incubation with 0.25 ug / mL biotin-SIRPα and 1:5000 streptavidin-HRP.

[0227] Table 9. Thermal stability of VHH-FcCD47 clones

[0228]

[0229] Example 5: VHH library for GLP1R

[0230] A VHH library for GLP1R was developed by a method similar to that described in Example 14. Briefly, a stable cell line expressing GLP1R was generated and target expression was confirmed by FACS. Cells expressing >80% of the target were then used for cell-based selection. Five rounds of cell-based selection were performed for cells stably overexpressing the target of interest. Ten 8 Before selecting cells expressing the target, first 8 Phage from each round was depleted on CHO background cells. The stringency of selection was increased by increasing the number of washes in subsequent rounds of selection. The cells were then eluted from the phage using trypsin, and the phage was amplified for the next round of panning. A total of 1000 clones from rounds 4 and 5 were sequenced by NGS to identify unique clones for reformatting into VHH-Fc.

[0231] Of the 156 unique GLP1R VHH Fc binders, 53 had target cell mean fluorescence intensity (MFI) values ​​that were 2-fold higher than those of the parental cells. Data for variant GLP1R-43-77 are available at Figures 12A-12B and Tables 10-11. Table 11 shows flow cytometry data detected using the RL1-A channel.

[0232] Table 10. Panning Overview

[0233]

[0234] Table 11. GLP1R-43-77 data

[0235]

[0236] Example 6. VHH Library of CRTH2R

[0237] A VHH library for CRTH2R was developed by a method similar to that described in Example 4. Briefly, a stable cell line expressing CRTH2R was generated and target expression was confirmed by FACS. Cells expressing >80% of the target were then used for cell-based selection. Five rounds of cell-based selection were performed for cells stably overexpressing the target of interest. Ten 8 Before selecting cells expressing the target, first 8 Phage from each round was depleted on CHO background cells. The stringency of selection was increased by increasing the number of washes in subsequent rounds of selection. The cells were then eluted from the phage using trypsin, and the phage was amplified for the next round of panning. A total of 1000 clones from rounds 4 and 5 were sequenced by NGS to identify unique clones for reformatting into VHH-Fc.

[0238] Target cell mean fluorescence intensity (MFI) values ​​for 26 of the 175 unique CRTH2R VHH Fc binders were 2-fold higher than those for parental cells. Data for variant CRTH2-41-51 are available at Figures 13A-13B and Tables 12-13. Table 13 shows flow cytometry data using the RL1-A channel. Data for variant CRTH2-44-59 are shown in Figures 14A-14B middle.

[0239] Table 12. Panning Overview

[0240]

[0241] Table 13. CRTH2-41-51 data

[0242]

[0243] Example 7. Identification of IgG for CRTH2R

[0244] Cellular binding of anti-CRTH2R antibodies was determined by testing CHO CRTH2R-positive cells (GFP+) and parental CHO cells (GFP-) and comparing parental-negative and target-positive cells to exclude false positives. The antibodies listed in Table 14A were titrated starting at 100 nM (15 ug / mL) using 3-fold titrations for a total of 8 points. The heavy and light chain sequences of the CRTH2R IgG antibodies are shown in Table 14B. Binding by concentration, as measured by mean fluorescence intensity (MFI), is shown in Table 14B. Figures 15A-15E An exemplary gated dot plot and APC histogram with CRTH2-27 at 100 nM are shown in Figures 16A-16B Two antibodies (gPCR-51 and gPCR-52) were used as positive controls. The binding profiles of the two positive controls are shown in Figures 17A-17B middle.

[0245] Table 14A. CRTH2R Antibody Variable Heavy and Light Chain Sequences

[0246]

[0247] Table 14B. Variable Heavy Chain CDR3 Sequences

[0248]

[0249] In the following examples, five antibodies were shown to have functional effects in the cAMP assay: CRTH2-9, CRTH2-27, CRTH2-50, CRTH2-32, and CRTH2-42. Figures 18A-18B The binding curves of these antibodies were compared in .

[0250] Example 8. Antagonist Activity Using cAMP Assay

[0251] A library of CRTH2R IgG antibodies was assayed to determine their antagonist function in PGD2-induced cAMP signaling. Briefly, cells were preincubated with IgG (titer 1:3) for 1 hour at room temperature. Subsequently, since CRTH2R is a G⍺ i Coupled, cells were therefore stimulated with PGD2 (0.59 nM) in the presence of forskolin at 37°C for 30 min.

[0252] The effect of the antibodies on the detection signal in relative light units (rlu) was determined (data not shown). At the highest concentration tested (300 nM), some CRTH2R IgG caused an upward shift in the signal, indicating inhibition of the cAMP signal induced by PGD2 stimulation. For comparison, the bar graph shows the ratio of IgG-treated to control-treated cells for the three highest IgG concentrations tested, as shown in Figure 2. Figure 19A shown. Figure 19BThe antibodies depicted in Figure 3 show CRTH2R IgG antibodies that resulted in greater than 20% antagonist activity at 33 nM, specifically CRTH2-74, CRTH2-24, CRTH2-28, CRTH2-19, CRTH2-45, CRTH2-9, CRTH2-8, CRTH2-15, CRTH2-42, CRTH2-60, and CRTH2-70.

[0253] Example 9. Allosteric Regulation of PGD2-Induced cAMP Signaling

[0254] Determination of the allosteric activity of CRTH2R IgG antibodies. Allosteric regulation was determined by measuring CRTH2R IgG antibodies on PGD2-induced cAMP signaling. Briefly, cells were re-incubated in the absence of IgG antibodies or in the presence of 100 nM CRTH2R IgG antibodies. Subsequently, cells were stimulated with varying concentrations of PGD2 in the presence of forskolin, and cAMP activity was measured.

[0255] The results of cAMP assay are shown in Figure 20 The rightward shift of the PGD2 dose-response curve (and the increase in IC50 value) indicates a negative allosteric effect. Figure 20 As shown, five CRTH2R IgGs (CRTH2-9, CRTH2-27, CRTH2-50, CRTH2-32, and CRTH2-42) elicited IC50-fold differences of >2.0 compared to PGD2 alone, indicating that they are negative allosteric modulators.

[0256] Example 10. Agonist activity of PGD2-induced cAMP signaling

[0257] Determination of agonist function of CRTH2R IgG antibodies Agonist activity was determined by assaying the CRTH2R IgG antibodies described in Example 7 in PGD2-induced cAMP signaling.

[0258] Briefly, cells were treated with PGD2 or CRTH2R IgG antibodies in the presence of forskolin. CRTH2R IgG antibodies include CRTH2-74, CRTH2-24, CRTH2-28, CRTH2-39, CRTH2-19, CRTH2-9, CRTH2-8, CRTH2-27, CRTH2-45, CRTH2-35, CRTH2-50, CRTH2-66, CRTH2-57, CRTH2-32, CRTH2-15, CRTH2-25, CRTH2-42, CRTH2-55, CRTH2-60, and CRTH2-70. Treatments were performed at 37°C for 30 minutes. cAMP was then measured (data not shown).

[0259] Example 11. Control Experiments Demonstrating Allosteric Modulators

[0260] Allosteric modulation of a known CRTH2R antagonist (small molecule OC000459) and two control antibodies was determined. Experiments similar to those described in Example 9 were performed. Briefly, cells were treated with OC000459, the comparator CRTH2R AB51 antibody, or the comparator CRTH2R AB52 antibody. Cells were then stimulated with PGD2 in the presence of forskolin.

[0261] The results are shown in Figure 21A – Figure 21C OC000459 caused a strong rightward shift in the curve, and the IC50 value increased by 459-fold ( Figure 21A Incubation with CRTH2R AB51 did not change the IC50 value ( Figure 21B Incubation with comparator antibody #52 caused the IC50 value to drop to 1 / 3.5 of the previous value, indicating that it is a positive allosteric modulator, that is, it has an agonist effect ( Figure 21C ).

[0262] Example 12. CRTH2Rβ-arrestin recruitment assay for antagonist modulation

[0263] The antagonist regulatory effects of nine CRTH2R IgG antibodies were determined. The nine CRTH2R IgG antibodies include CRTH2-9, CRTH2-27, CRTH2-50, CRTH2-32, CRTH2-42, CRTH2-74, CRTH2-55, CRTH2-28, and CRTH2-39. The antagonist function of these nine antibodies compared to OC000459 was determined using PGD2-induced β-arrestin recruitment. The results, including a positive control using the small molecule OC000459, are shown in Figures 22A-22D middle.

[0264] Example 13. CRTH2Rβ-arrestin recruitment assay for allosteric modulation

[0265] The allosteric regulation of nine CRTH2R IgGs was determined. The nine CRTH2R IgGs included CRTH2-9, CRTH2-27, CRTH2-50, CRTH2-32, CRTH2-42, CRTH2-74, CRTH2-55, CRTH2-28, and CRTH2-39. Allosteric regulation of these nine antibodies compared to OC000459 was determined using PGD2-induced β-arrestin recruitment.

[0266] Briefly, cells were preincubated with IgG (100 nM) for 1 hour at room temperature and then stimulated with PGD2 for 90 minutes at 37°C. Data were normalized to the first data point (lowest PGD2 and zero Ab) in each graph.

[0267] Example 14. Hyperimmune Immunoglobulin Library

[0268] A hyperimmune immunoglobulin (IgG) library was created using methods similar to those described in Example 4. Briefly, the hyperimmune IgG library was generated by analysis of a database of human naive and memory B cell receptor sequences consisting of more than 37 million unique IgH sequences from each of three healthy donors. More than 2 million CDRH3 sequences were collected from this analysis and individually constructed using methods similar to those in Examples 1-3. Any duplicated CDRH3s and potentially responsible motifs that often present problems during development were removed during the library synthesis step. This CDRH3 sequence diversity was then combinatorially assembled and integrated into the DP47 human framework to construct a library with 1 x 10 10 A highly functional antibody Fab library of size. A schematic diagram of the design can be found in Figure 24 middle.

[0269] The heavy chain CDR length distribution of the hyperimmune antibody library was evaluated by next generation sequencing (NGS). The CDR length distribution data are shown in Figures 25A-25B Typically, selection for soluble protein targets proceeded through five rounds of selection, including three PBST washes in round 1, five PBST washes in round 2, seven PBST washes in round 3, nine PBST washes in round 4, and twelve PBST washes in round 5. Skim milk blocks were used. See also Figure 26 .

[0270] For human TIGIT (hTIGIT), 1 uM biotinylated antigen was mixed with 300 ul Dynabeads M-280 at 10 mg / mL to give a concentration of 100 pmol per 100 ul. Details of each selection round are shown in Table 15.

[0271] Table 15. Protein panning selection

[0272]

[0273] After multiple rounds of selection, hTIGIT IgG was analyzed. Data are available at Figures 27A-27F and Table 16. Figures 27A-27D ELISA data from rounds 3 and 4 are shown. Figure 27E-Figure 27FShown are the CDRH3 length, yield (ug) and K of the hTIGIT IgG analyzed. D (nM) data.

[0274] Table 16. Protein panning data

[0275]

[0276] Seventeen distinct hTIGIT immunoglobulins were identified, with monovalent affinities ranging from 16 nM to over 300 nM. Most of these immunoglobulins expressed well and produced over 20 ug of purified protein in 1 ml expression volume. The hTIGIT immunoglobulin sequences are shown in Table 17.

[0277] Table 17. TIGIT sequences

[0278]

[0279] The characterization of human CD3 epsilon (hCD3) and macaque CD3 epsilon (cCD3) immunoglobulins was performed. Details of the individual selection rounds are given in Table 18.

[0280] Table 18. Protein panning selections

[0281]

[0282] After multiple rounds of selection, CD3 epsilon (CD3ɛ) IgG was analyzed. Data are available at Figures 28A-28L and Tables 19A-19B. Figures 28A-28F ELISA data from rounds 4 and 5 are shown. Figure 28G-28L Data showing cross-reactivity of human CD3 epsilon and macaque CD3 epsilon immunoglobulins.

[0283] Table 19A. Protein panning data

[0284]

[0285] Table 19B

[0286]

[0287] Nineteen distinct hCD3 epsilon and macaque CD3 epsilon immunoglobulins were identified, including five human / macaque CD3 epsilon cross-reactive immunoglobulins. One of the human / macaque CD3 epsilon cross-reactive antibodies, CD3-56-05, bound to human and macaque CD3 epsilon with affinities of 67 and 107 nM, respectively. The sequences of the hCD3 epsilon and cCD3 epsilon immunoglobulins are shown in Table 20.

[0288] Table 20. CD3ε sequences

[0289]

[0290] A CRTH2R hyperimmune immunoglobulin library was generated. Briefly, five rounds of cell-based selection were performed on cells stably overexpressing the target of interest. Each round of selection used 10 8 Before selecting cells expressing the target, first 8 Phage from each round was depleted on CHO background cells. The stringency of selection was increased by increasing the number of washes in subsequent rounds of selection. The cells were then eluted from the phage using trypsin, and the phage was amplified for the next round of panning.

[0291] The binding affinity of the CRTH2R immunoglobulins and their function as allosteric modulators of PGD2-induced cAMP were assessed. Figures 30A-30F As shown in Table 21, three specific CRTH2R immunoglobulins were identified that had subnanomolar to single-digit nanomolar cell binding affinities for hCRTH2R and had inhibitory activity in the allosteric cAMP assay. The sequences of these three CRTH2R immunoglobulins, CRTH2-48-3, CRTH2-48-21, and CRTH2-48-27, are shown in Table 21.

[0292] Table 21. CRTH2R sequences

[0293]

[0294] Example 15. Hyperimmune Immunoglobulin Library of A2A Receptor

[0295] A hyperimmune immunoglobulin (IgG) library was created using methods similar to those described in Examples 4 and 14. Briefly, the hyperimmune IgG library was generated by analysis of a database of human naive and memory B cell receptor sequences consisting of more than 37 million unique IgH sequences from each of three healthy donors. More than 2 million CDRH3 sequences were collected from this analysis and independently constructed using methods similar to those of Examples 1-3. The CDRH3 sequences were incorporated into the VHH h shuffled library described in Example 4. The final library diversity was determined to be 1.3 x 10 10 .

[0296] 73 of the 88 unique clones had target cell MFI values ​​that were 2-fold higher than the parental cells. 15 of the 88 unique clones had target cell MFI values ​​that were 20-fold higher than the parental cells. Data for the adenosine A2A receptor variant A2AR-90-007 are available at Figure 31A-Figure 31B middle.

[0297] This example shows that the binding of D Generation of a VHH library targeting the A2AR.

[0298] Although preferred embodiments of the present disclosure have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided by way of example only. Many variations, changes, and substitutions will occur to those skilled in the art without departing from the present disclosure. It should be understood that various alternatives to the embodiments of the present disclosure described herein may be employed in practicing the present disclosure. It is intended that the scope of the present disclosure be defined by the appended claims, and that methods and structures within the scope of these claims and their equivalents be encompassed thereby. Sequence Listing <110> TWEST Biosciences <120> Antibodies that bind to CD3ε <130> 44854-795.601 <140> PCT / US2020 / 052306 <141> 2020-09-23 <150> 62 / 945,761 <151> 2019-12-09 <150> 62 / 935,603 <151> 2019-11-14 <150> 62 / 904,620 <151> 2019-09-23 <160> 170 <170> PatentIn Version 3.5 <210> 1 <211> 167 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 1 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Ser Glu Tyr 20 25 30 Gly Ile His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Ser Tyr Glu Gly Ser Asn Glu Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ala Asn Gln His Phe Gly Pro Val Ala Gly Gly Ala Thr Pro 100 105 110 Ser Glu Glu Pro Gly Ser Gln Leu Thr Arg Ala Glu Leu Gly Trp Asp 115 120 125 Ala Pro Pro Gly Gln Glu Ser Leu Ala Asp Glu Leu Leu Gln Leu Gly 130 135 140 Thr Glu His Gly Tyr His Tyr Tyr Gly Met Asp Val Trp Gly Gln Gly 145 150 155 160 Thr Leu Val Thr Val Ser Ser 165 <210> 2 <211> 137 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 2 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Ser Phe Ser Asn Tyr 20 25 30 Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Gly Ile Ile Pro Leu Ile Gly Thr Ala Asn Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Met Tyr Tyr Asp Phe Thr Leu Gly Pro Gln Ser Ile Gly 100 105 110 Pro Leu Gly Glu Val Val Pro Ala Asp Asp Ala Phe Asp Ile Trp Gly 115 120 125 Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 <210> 3 <211> 149 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 3 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Asn Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Asp Tyr 20 25 30 Ala Phe Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Ala Ile Ile Pro Phe Phe Gly Thr Val Asn Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Met Tyr Tyr Asp Phe Ala Thr Gly Thr Gly Gly Pro Glu 100 105 110 Asp Asp Leu Tyr Pro Gln Gly Glu Leu Asn Asp Gly Tyr Arg Ile Glu 115 120 125 Val Val Pro Ala Asp Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr Leu 130 135 140 Val Thr Val Ser Ser 145 <210> 4 <211> 143 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 4 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Val Asp Thr Phe Ser Arg Tyr 20 25 30 Ser Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Gly Ile Ile Pro Val Phe Asp Thr Thr Asn Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Met Tyr Tyr Asp Phe Gly Val Ile Leu Gly Gly Thr Ala 100 105 110 Val Gly Thr Asn Asn Gly Ser Ala Asn Glu Val Val Pro Ala Asp Asp 115 120 125 Ala Phe Asp Ile Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 140 <210> 5 <211> 140 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 5 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser His 20 25 30 Ala Ile Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Arg Ile Ile Pro Ile Val Gly Thr Thr Thr Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Met Tyr Tyr Asp Phe Asp Tyr Phe Gly Leu Thr Leu Thr 100 105 110 Gly Asp Arg Asn Asp Asp Glu Val Val Pro Ala Asp Asp Ala Phe Asp 115 120 125 Ile Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 140 <210> 6 <211> 139 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 6 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 20 25 30 Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Met Tyr Tyr Asp Phe Trp Leu Gly Asp Gln Ser Thr Gly 100 105 110 Ser Leu Ile Gly Ala Glu Val Val Pro Ala Asp Asp Ala Phe Asp Ile 115 120 125 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 <210> 7 <211> 147 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 7 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Thr Asp Tyr 20 25 30 Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Gly Ile Ile Pro Phe Phe Gly Ser Pro Asn Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Met Tyr Tyr Asp Phe Ala Ala Gly Leu Glu Gly Thr Ile 100 105 110 Thr Glu Val Phe Asp Glu Glu Gly His Gln Gly Gly Thr Glu Val Val 115 120 125 Pro Ala Asp Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr Leu Val Thr 130 135 140 Val Ser Ser 145 <210> 8 <211> 139 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 8 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asn Tyr 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Ser Tyr Glu Gly Ser Asn Lys Lys Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Met Tyr Tyr Asp Phe Gly Ser Ile Tyr Gly Glu Asp Val 100 105 110 Val Gly Glu Leu Pro Glu Val Val Pro Ala Asp Asp Ala Phe Asp Ile 115 120 125 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 <210> 9 <211> 153 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 9 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser His Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Asp Ile Ser His Glu Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Gly Arg Gly Ser Leu Pro Arg Pro Lys Gly Gly Pro Thr 100 105 110 Ser Gly Gly Gly Phe Ser Thr Asn Ile Gly Tyr Gly Phe Val Val Gln 115 120 125 Ser Tyr Asp Ser Ser Glu Asp Ser Gly Gly Ala Phe Asp Ile Trp Gly 130 135 140 Gln Gly Thr Leu Val Thr Val Ser Ser 145 150 <210> 10 <211> 137 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Synthetic Polypeptide <400> 10 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Arg Ser Tyr 20 25 30 Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Gly Ile Ile Pro Ile Ser Gly Thr Thr Asn Tyr Ala Gln Lys Phe 5 \0 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ala Asn Gln His Phe Thr Arg Ile Phe Gly Asn Tyr Gln Ile 100 105 110 Tyr Phe Gly His Phe Gly Tyr His Tyr Tyr Gly Met Asp Val Trp Gly 115 120 125 Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 <210> 11 <211> 142 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 11 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 20 25 30 Ala Leu Ser Trp Val Arg Lys Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Gly Thr Ile Pro Ile Phe Gly Thr Val Asn Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ala Asn Gln His Phe Thr Arg Val Ile Gly Gln Pro Ser Pro 100 105 110 Ala Val Pro Ser Arg Gly Tyr Ile Tyr His Gly Tyr His Tyr Tyr Gly 115 120 125 Met Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 140 <210> 12 <211> 155 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 12 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Asp Phe Ser Gly Tyr 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Ser Tyr Glu Gly Ser Asn Lys Phe Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Leu Arg Glu Leu Glu Cys Glu Glu Trp Thr Ile Glu Val 100 105 110 His Gly Gln Glu Phe Ala Val His Gln Asp Arg Gly Gly Val Phe Ser 115 120 125 Arg Gly Pro Cys Val Asp Pro Arg Gly Val Ala Gly Ser Phe Asp Val 130 135 140 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 145 150 155 <210> 13 <211> 141 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 13 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Gly Ile Ile Pro Leu Phe Gly Thr Thr Asp Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ala Asn Gln His Phe Val Lys Ile Gln Gly Ala Pro Val Ser 100 105 110 Thr Pro Val Pro Gly Phe Gly Thr Thr Gly Tyr His Tyr Tyr Gly Met 115 120 125 Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 140 <210> 14 <211> 143 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 14 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Lys His 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Phe Ile Ser Tyr Glu Gly Ser Glu Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Met Tyr Tyr Asp Phe His Tyr Ser Thr Val Gly Ala Thr 100 105 110 Tyr Tyr Tyr Tyr Leu Gly Ser Glu Thr Glu Val Val Pro Ala Asp Asp 115 120 125 Ala Phe Asp Ile Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 140 <210> 15 <211> 141 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 15 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Thr Tyr 20 25 30 Ala Ile Asp Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Gly Ile Ile Pro Leu Phe Gly Ser Pro Asn Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ala Asn Gln His Phe Phe Leu Tyr Glu Gly Thr Ser Ser Ser 100 105 110 Trp Leu His Val Gly His Ala Arg Tyr Gly Tyr His Tyr Tyr Gly Met 115 120 125 Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 140 <210> 16 <211> 142 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Polypeptide <400> 16 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Ser Phe Arg Ser Tyr 20 25 30 Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Arg Ile Ile Pro Leu Phe Gly Thr Pro Asp Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Met Tyr Tyr Asp Phe Glu Asp Val Asp Glu Gly Ser Leu 100 105 110 Tyr Leu Asp Met Gly Arg Thr Phe Glu Val Val Pro Ala Asp Asp Ala 115 120 125 Phe Asp Ile Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 140 <210> 17 <211> 156 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 17 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ala Phe Ser Ser Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Ser Tyr Glu Gly Ser Asn Glu Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Leu Arg Glu Leu Glu Cys Glu Glu Trp Thr Val Leu Gln 100 105 110<​​​​​​​​​​​​​​​​​​​​​​​ Polypeptide <400> 18 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Ser Tyr 20 25 30 Asp Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Ser Tyr Glu Gly Ser Glu Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys His Met Ser Met Gln Ala Ser Thr Glu Gly Asp Phe Gly Leu 100 105 110 Glu Glu Val Thr Gly Glu Gly Val Asp Asp Arg Ala Asp Leu Val Gly 115 120 125 Asp Ala Phe Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 140 <210> 19 <211> 138 <212> PRT <213> Artificial Sequence <220> <223> Description of artificial sequence: synthetic Polypeptide <400> 19 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Lys Asn Tyr 20 25 30 Ala Ile Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Ala Ile Ile Pro Lys Phe Gly Ala Ala Asn Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ala Asn Gln His Phe Ser Ala Val Arg Gly Leu Ala Phe Gly 100 105 110 Tyr Gly Tyr Arg Ile Gly Gly Tyr His Tyr Tyr Gly Met Asp Val Trp 115 120 125 Gly Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 <210> 20 <211> 139 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 20 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Asn His 20 25 30 Ala Ile Ile Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Gly Ile Ile Pro Ile Phe Gly Thr Pro Ser Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Met Tyr Tyr Asp Phe Asp Val Ile Ser Ala Gly Val Val 100 105 110 Gly Ala Gly Asn Pro Glu Val Val Pro Ala Asp Asp Ala Phe Asp Ile 115 120 125 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 <210> twenty one <211> 126 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> twenty one Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Ser Thr His 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Thr Ile Gly Gly Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ala His Gly Asp Ser Ser Ser Trp Tyr Phe Ser Tyr Tyr Tyr 100 105 110 Met Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 125 <210> twenty two <211> 117 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> twenty two Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Ile Phe Arg Phe Asn 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ala Gly Ile Ser Gly Ser Gly Gly Asp Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Ala Asp Asn Ser Lys Asn Thr Ala Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Phe Arg Gly Ile Met Arg Pro Asp Trp Gly Gln Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> twenty three <211> 123 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> twenty three Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Pro Thr Phe Asp Thr Tyr 20 25 30 Val Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Ser Met Ser Gly Asp Asp Thr Ala Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Ala Asp Asn Ser Lys Asn Thr Ala Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Thr Asp Leu Arg Gly Arg Gly Asp Val Ser Glu Tyr Glu Tyr Asp 100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> twenty four <211> 110 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> twenty four Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Ser Thr Ser Asn Ile Gly Lys Asn 20 25 30 Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Asp Asp Asp Glu Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Met Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Gln 65 70 75 80 Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Glu Ala Trp Asp Ala Asp Leu 85 90 95 Ser Gly Ala Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 25 <211> 217 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 25 Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Asn Asn 20 25 30 Phe Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Asp Asn Ile Gln Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Gln 65 70 75 80 Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Gly Thr Trp Asp Thr Ser Leu 85 90 95 Ser Ala Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Arg Thr 100 105 110 Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu 115 120 125 Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro 130 135 140 Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly 145 150 155 160 Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr 165 170 175 Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His 180 185 190 Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val 195 200 205 Thr Lys Ser Phe Asn Arg Gly Glu Cys 210 215 <210> 26 <211> 110 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 26 Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Ser Ile Ser Asn Ile Gly Lys Asn 20 25 30 Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Asp Asp His Lys Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Gln 65 70 75 80 Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Ala Thr Trp Asp Arg Gly Leu 85 90 95 Ser Ala Ala Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 27 <211> 111 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 27 Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Ser Asn Ile Gly Asp Asn 20 25 30 Asp Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Asp Asp Asp Lys Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Gln 65 70 75 80 Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Ala Ser Trp Asp Thr Ser Leu 85 90 95 Ser Gly Gly Tyr Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 28 <211> 110 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 28 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln 1 5 10 15 Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Gly Tyr 20 25 30 Asp Tyr Val Thr Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu 35 40 45 Met Ile Tyr Asp Val Asp Thr Arg Pro Ser Gly Val Ser Asn Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu 65 70 75 80 Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Thr Thr Ser 85 90 95 Thr Ser Tyr Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 29 <211> 110 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 29 Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Ser Thr Ser Asn Ile Gly Asn Asn 20 25 30 Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Glu Asn Asp Glu Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Gln 65 70 75 80 Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Ala Thr Trp Asp Thr Arg Leu 85 90 95 Ser Ala Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 30 <211> 110 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 30 Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Ser Asn Ile Gly Lys Asn 20 25 30 Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Asp Asn Asn Gln Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Gln 65 70 75 80 Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Gly Thr Trp Asp Thr Ser Leu 85 90 95 Thr Ser Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 31 <211> 110 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 31 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln 1 5 10 15 Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Asn Asp Val Gly Ala Tyr 20 25 30 Asn Phe Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu 35 40 45 Met Ile Tyr Asp Ile Ser Asn Arg Pro Ser Gly Val Ser Asn Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu 65 70 75 80 Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Thr Arg Ser 85 90 95 Asn Thr Arg Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 32 <211> 111 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 32 Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Thr Ser Ser Asn Ile Glu Asn Asn 20 25 30 Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Asp Asn Val Lys Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Gln 65 70 75 80 Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Gly Thr Trp Asp Asn Thr Val 85 90 95 Ser Ala Pro Trp Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 33 <211> 111 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 33 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln 1 5 10 15 Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Ile Gly Gly Tyr 20 25 30 Glu Phe Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu 35 40 45 Met Ile Tyr Gly Val Ser Arg Arg Pro Ser Gly Val Ser Asn Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu 65 70 75 80 Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Gly Ser Tyr Thr Ser Ser 85 90 95 Ser Thr Pro Tyr Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 34 <211> 111 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 34 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln 1 5 10 15 Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Ile Gly Gly Tyr 20 25 30 Asn Phe Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu 35 40 45 Met Ile Tyr Asp Val Ser Asn Arg Pro Gln Gly Val Ser Asn Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu 65 70 75 80 Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Thr Ser Ser 85 90 95 Asn Thr Tyr Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 35 <211> 108 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 35 Glu Ile Val Met Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Gly Val Gly Ser Asn 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45 Tyr Arg Thr Ser Ile Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Ser 65 70 75 80 Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Trp Pro Pro 85 90 95 Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 36 <211> 110 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 36 Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Ser Asn Ile Glu Asp Asn 20 25 30 Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Asp Asn Phe Lys Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Gln 65 70 75 80 Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Gly Thr Trp Asp Thr Ser Leu 85 90 95 Ser Ala Ala Leu Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 37 <211> 111 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 37 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln 1 5 10 15 Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Gly Val Gly Gly Tyr 20 25 30 Asp Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu 35 40 45 Met Ile Tyr Asp Asp Asn Asn Arg Pro Ser Gly Val Ser Asn Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu 65 70 75 80 Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Thr Gly Ser 85 90 95 Ser Thr Leu Tyr Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 38 <211> 110 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 38 Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Ser Gly Ser Asn Ile Gly Ser Asn 20 25 30 Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Asp Asn Ile Arg Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Gln 65 70 75 80 Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Thr Arg Leu 85 90 95 Ser Ala Gly Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 39 <211> 107 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 39 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Thr Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Thr Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Thr Pro Trp 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 40 <211> 111 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 40 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln 1 5 10 15 Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Gly Tyr 20 25 30 Arg Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu 35 40 45 Met Ile Tyr Asn Val Asn Tyr Arg Pro Ser Gly Val Ser Asn Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu 65 70 75 80 Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Arg Ser Ser 85 90 95 Ser Thr Leu Gly Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 41 <211> 110 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 41 Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Ser Asn Ile Gly Asp Asn 20 25 30 Phe Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Asp Asp Asp Glu Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Gln 65 70 75 80 Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Gly Ala Trp Asp Arg Ser Leu 85 90 95 Ser Ala Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 42 <211> 110 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 42 Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Ser Thr Ser Asn Ile Gly Ile Asn 20 25 30 Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Glu Asn Arg Lys Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Gln 65 70 75 80 Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Ala Thr Trp Asp Ala Ser Leu 85 90 95 Lys Asn Leu Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 43 <211> 112 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 43 Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Ser Thr Ser Asn Ile Gly Asn Asn 20 25 30 Phe Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Asp Asn Glu Lys Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Gln 65 70 75 80 Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Gly Thr Trp Asp Glu Arg Gln 85 90 95 Thr Asp Glu Ser Tyr Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 44 <211> 108 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 44 Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Ser Thr Ser Asn Ile Gly Asn Asn 20 25 30 Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Glu Asn Asp Glu Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Gln 65 70 75 80 Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Ala Thr Trp Asp Thr Arg Leu 85 90 95 Ser Ala Val Val Phe Gly Gly Glu Thr Lys Leu Thr 100 105 <210> 45 <211> 107 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 45 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Asp Tyr 20 25 30 Val Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Gly Ala Ser Ile Leu Gln Thr Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Phe Thr Thr Pro Trp 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 46 <211> 63 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 46 Cys Ala Arg Ala Asn Gln His Phe Gly Pro Val Ala Gly Gly Ala Thr 1 5 10 15 Pro Ser Glu Glu Pro Gly Ser Gln Leu Thr Arg Ala Glu Leu Gly Trp 20 25 30 Asp Ala Pro Pro Gly Gln Glu Ser Leu Ala Asp Glu Leu Leu Gln Leu 35 40 45 Gly Thr Glu His Gly Tyr His His Tyr Tyr Gly Met Asp Val Trp 50 55 60 <210> 47 <211> 32 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 47 Cys Ala Arg Asp Met Tyr Tyr Asp Phe Thr Leu Gly Pro Gln Ser Ile 1 5 10 15 Gly Pro Leu Gly Glu Val Val Pro Ala Asp Asp Ala Phe Asp Ile Trp 20 25 30 <210> 48 <211> 44 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 48 Cys Ala Arg Asp Met Tyr Tyr Asp Phe Ala Thr Gly Thr Gly Gly Pro 1 5 10 15 Glu Asp Asp Leu Tyr Pro Gln Gly Glu Leu Asn Asp Gly Tyr Arg Ile 20 25 30 Glu Val Val Pro Ala Asp Asp Ala Phe Asp Ile Trp 35 40 <210> 49 <211> 38 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 49 Cys Ala Arg Asp Met Tyr Tyr Asp Phe Gly Val Ile Leu Gly Gly Thr 1 5 10 15 Ala Val Gly Thr Asn Asn Gly Ser Ala Asn Glu Val Val Pro Ala Asp 20 25 30 Asp Ala Phe Asp Ile Trp 35 <210> 50 <211> 35 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 50 Cys Ala Arg Asp Met Tyr Tyr Asp Phe Asp Tyr Phe Gly Leu Thr Leu 1 5 10 15 Thr Gly Asp Arg Asn Asp Asp Glu Val Val Pro Ala Asp Asp Ala Phe 20 25 30 Asp Ile Trp 35 <210> 51 <211> 34 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 51 Cys Ala Arg Asp Met Tyr Tyr Asp Phe Trp Leu Gly Asp Gln Ser Thr 1 5 10 15 Gly Ser Leu Ile Gly Ala Glu Val Val Pro Ala Asp Asp Ala Phe Asp 20 25 30 Ile Trp <210> 52 <211> 42 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 52 Cys Ala Arg Asp Met Tyr Tyr Asp Phe Ala Ala Gly Leu Glu Gly Thr 1 5 10 15 Ile Thr Glu Val Phe Asp Glu Glu Gly His Gln Gly Gly Thr Glu Val 20 25 30 Val Pro Ala Asp Asp Ala Phe Asp Ile Trp 35 40 <210> 53 <211> 34 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 53 Cys Ala Arg Asp Met Tyr Tyr Asp Phe Gly Ser Ile Tyr Gly Glu Asp 1 5 10 15 Val Val Gly Glu Leu Pro Glu Val Val Pro Ala Asp Asp Ala Phe Asp 20 25 30 Ile Trp <210> 54 <211> 48 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 54 Cys Ala Arg Asp Gly Arg Gly Ser Leu Pro Arg Pro Lys Gly Gly Pro 1 5 10 15 Thr Ser Gly Gly Gly Phe Ser Thr Asn Ile Gly Tyr Gly Phe Val Val 20 25 30 Gln Ser Tyr Asp Ser Ser Glu Asp Ser Gly Gly Ala Phe Asp Ile Trp 35 40 45 <210> 55 <211> 32 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 55 Cys Ala Arg Ala Asn Gln His Phe Thr Arg Ile Phe Gly Asn Tyr Gln 1 5 10 15 Ile Tyr Phe Gly His Phe Gly Tyr His Tyr Tyr Gly Met Asp Val Trp 20 25 30 <210> 56 <211> 37 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 56 Cys Ala Arg Ala Asn Gln His Phe Thr Arg Val Ile Gly Gln Pro Ser 1 5 10 15 Pro Ala Val Pro Ser Arg Gly Tyr Ile Tyr His Gly Tyr His Tyr Tyr 20 25 30 Gly Met Asp Val Trp 35 <210> 57 <211> 51 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 57 Cys Ala Arg Asp Leu Arg Glu Leu Glu Cys Glu Glu Trp Thr Ile Glu 1 5 10 15 Val His Gly Gln Glu Phe Ala Val His Gln Asp Arg Gly Gly Val Phe 20 25 30 Ser Arg Gly Pro Cys Val Asp Pro Arg Gly Val Ala Gly Gly Ser Phe 35 40 45 Asp Val Trp 50 <210> 58 <211> 36 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 58 Cys Ala Arg Ala Asn Gln His Phe Val Lys Ile Gln Gly Ala Pro Val 1 5 10 15 Ser Thr Pro Val Pro Gly Phe Gly Thr Thr Gly Tyr His Tyr Tyr Gly 20 25 30 Met Asp Val Trp 35 <210> 59 <211> 38 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 59 Cys Ala Arg Asp Met Tyr Tyr Asp Phe His Tyr Ser Thr Val Gly Ala 1 5 10 15 Thr Tyr Tyr Tyr Tyr Leu Gly Ser Glu Thr Glu Val Val Pro Ala Asp 20 25 30 Asp Ala Phe Asp Ile Trp 35 <210> 60 <211> 37 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 60 Cys Ala Arg Ala Asn Gln His Phe Phe Leu Tyr Glu Gly Thr Ser Ser 1 5 10 15 Ser Trp Leu His Val Gly His Ala Arg Tyr Gly Tyr His Tyr Tyr Tyr 20 25 30 Gly Met Asp Val Trp 35 <210> 61 <211> 37 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 61 Cys Ala Arg Asp Met Tyr Tyr Asp Phe Glu Asp Val Asp Glu Gly Ser 1 5 10 15 Leu Tyr Leu Asp Met Gly Arg Thr Phe Glu Val Val Pro Ala Asp Asp 20 25 30 Ala Phe Asp Ile Trp 35 <210> 62 <211> 51 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 62 Cys Ala Arg Asp Leu Arg Glu Leu Glu Cys Glu Glu Trp Thr Val Leu 1 5 10 15 Gln Tyr Gly Lys Phe His Met Arg Trp Ala Glu Ser Gly Glu Gly Ser 20 25 30 Leu Ser Arg Gly Pro Cys Val Asp Pro Arg Gly Val Ala Gly Ser Phe 35 40 45 Asp Val Trp 50 <210> 63 <211> 39 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 63 Cys Ala Lys His Met Ser Met Gln Ala Ser Thr Glu Gly Asp Phe Gly 1 5 10 15 Leu Glu Glu Val Thr Gly Glu Gly Val Asp Asp Arg Ala Asp Leu Val 20 25 30 Gly Asp Ala Phe Asp Val Met 35 <210> 64 <211> 33 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 64 Cys Ala Arg Ala Asn Gln His Phe Ser Ala Val Arg Gly Leu Ala Phe 1 5 10 15 Gly Tyr Gly Tyr Arg Ile Gly Gly Tyr His Tyr Tyr Gly Met Asp Val 20 25 30 Trp <210> 65 <211> 34 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 65 Cys Ala Arg Asp Met Tyr Tyr Asp Phe Asp Val Ile Ser Ala Gly Val 1 5 10 15 Val Gly Ala Gly Asn Pro Glu Val Val Pro Ala Asp Asp Ala Phe Asp 20 25 30 Ile Trp <210> 66 <211> 34 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 66 Cys Ala Arg Asp Met Tyr Tyr Asp Phe Asp Val Ile Ser Ala Gly Val 1 5 10 15 Val Gly Ala Gly Asn Pro Glu Val Val Pro Ala Asp Asp Ala Phe Asp 20 25 30 Ile Trp <210> 67 <211> 15 <212> PRT <213> Homo sapiens <400> 67 Cys Ala Arg Val Ala Gly Ser Ser Gly Trp Ala Phe Asp Tyr Trp 1 5 10 15 <210> 68 <211> 16 <212> PRT <213> Homo sapiens <400> 68 Cys Ala Thr Leu Arg Leu Tyr Ser Ser Gly Gly Gly Ile Asp Tyr Trp 1 5 10 15 <210> 69 <211> 20 <212> PRT <213> Homo sapiens <400> 69 Cys Ala Arg Ile Val Gly Ala Thr Thr Arg Thr Tyr Tyr Tyr Tyr Gly 1 5 10 15 Met Asp Val Trp 20 <210> 70 <211> 12 <212> PRT <213> Homo sapiens <400> 70 Cys Ala Arg Val Arg Asn Arg Ala Ser Asp Ile Trp<D 1 5 10 <210> 71 <211> 15 <212> PRT <213> Homo sapiens<00D2363><400> 71 Cys Ala Arg Ala Pro Tyr Ser Ser Ser Ser Trp Phe Asp Tyr Trp 1 5 10 15 <210> 72 <211> 17 <212> PRT <213> Homo sapiens <400> 72 Cys Ala Arg Asn Ser Tyr Gly Pro Pro Arg Ser Phe Gly Met Asp Val 1 5 10 15 Trp <210> 73 <211> 14 <212> PRT <213> Homo sapiens <400> 73 Cys Ala Arg Thr Pro Tyr Arg Ser Gly Trp Ala Asp Tyr Trp 1 5 10 <210> 74 <211> 14 <212> PRT <213> Homo sapiens <400> 74 Cys Thr Arg Ser Trp Tyr Tyr Tyr Tyr Gly Met Asp Val Trp 1 5 10 <210> 75 <211> 11 <212> PRT <213> Homo sapiens <400> 75 Cys Ala Arg Gly Tyr Gly Gly Tyr Gly Tyr Trp 1 5 10 <210> 76 <211> 14 <212> PRT <213> Homo sapiens <400> 76 Cys Ala Lys Ala Gly Asp Tyr Asp Tyr Tyr Phe Asp Tyr Trp 1 5 10​​​​​​​​​​​​​​​​​​​​​​​​ Cys Ala Arg Val Arg Val Gly Ala Tyr Asp Ala Phe Asp Ile Trp 1 5 10 15 <210> 79 <211> 14 <212> PRT <213> Homo sapiens <400> 79 Cys Ala Arg Asn Ser Gly Trp Phe Met Pro Phe Asp Tyr Trp 1 5 10 <210> 80 <211> 13 <212> PRT <213> Homo sapiens <400> 80 Cys Ala Arg Arg Gly Ser Gly Trp Tyr Ile Asp Ser Trp 1 5 10 <210> 81 <211> 17 <212> PRT <213> Homo sapiens <400> 81 Cys Ala Arg Arg Glu Gly Asp Tyr Met Gly Pro Asn Trp Phe Asp Pro 1 5 10 15 Trp <210> 82 <211> 12 <212> PRT <213> Homo sapiens <400> 82 Cys Ala Ser Ile Arg Glu Arg Arg Phe Asp Phe Trp 1 5 10 <210> 83 <211> 23 <212> PRT <213> Homo sapiens <400> 83<00Cys Ala Arg His Ser Leu Thr Pro Tyr Asn Phe Trp Ser Gly Tyr Tyr 1 5 10 15 Ser Arg Ser Phe Asp Ile Trp 20 <210> 84 <211> 120 <212> PRT <213> Homo sapiens <400> 84 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Ser Tyr 20 25 30 Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ser Ile Ser Gly Ser Gly Ser Thr Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Val Ala Gly Ser Ser Gly Trp Ala Phe Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 85 <211> 121 <212> PRT <213> Homo sapiens <400> 85 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Leu Thr Phe Ser Asn Tyr 20 25 30 Ala Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Arg Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Thr Leu Arg Leu Tyr Ser Ser Gly Gly Gly Ile Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 86 <211> 125 <212> PRT <213> Homo sapiens <400> 86 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe His Asn Tyr 20 25 30 Ala Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Thr Gly Ser Gly Thr Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ile Val Gly Ala Thr Thr Arg Thr Tyr Tyr Tyr Tyr Gly Met 100 105 110 Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 125 <210> 87 <211> 117 <212> PRT <213> Homo sapiens <400> 87 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Arg Phe Gly Asn Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Thr Gly Ser Gly Gly Asn Thr Phe Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Ile Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Val Arg Asn Arg Ala Ser Asp Ile Trp Gly Gln Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> 88 <211> 120 <212> PRT <213> Homo sapiens <400> 88 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Val Phe Ser Ser Tyr[[ID=*]] 20 25 30 Ala Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Thr Val Ser Gly Ser Gly Gly Thr Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ala Pro Tyr Ser Ser Ser Ser Trp Phe Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 89 <211> 122 <212> PRT <213> Homo sapiens <400> 89 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Arg Tyr 20 25 30 Thr Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Gly Ser Gly Gly Gly Ala Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asn Ser Tyr Gly Pro Pro Arg Ser Phe Gly Met Asp Val Trp 100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 90 <211> 119 <212> PRT [[ID=2二十二]]<213> Homo sapiens <400> 90 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 2五 30 [[ID=三十三]] Gly Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val [[ID=三十五]] 35 40 45 Ser Ala Ile Ser Gly Arg Gly Ser Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 It should be noted that there seems to be an error in the original text where "<213> 智人 " was translated as "[[ID=2二十二]]<213> Homo sapiens " in the above translation. It should be "<213> Homo sapiens " directly. The correct translation should be: Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asn Ser Tyr Gly Pro Pro Arg Ser Phe Gly Met Asp Val Trp 100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 90 <211> 119 <212> PRT <213> Homo sapiens <400> 90 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Thr Pro Tyr Arg Ser Gly Trp Ala Asp Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser 115 <210> 91 <211> 119 <212> PRT <213> Homo sapiens <400> 91 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Met Phe Ser Asp Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Gly Ser Gly Gly Tyr Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Thr Arg Ser Trp Tyr Tyr Tyr Tyr Gly Met Asp Val Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser 115 <210> 92 <211> 116 <212> PRT <213> Homo sapiens <400> 92 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ala Phe Arg Ser Tyr[[ID=2)]] 20 25 30 Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Thr Ile Ser Gly Gly Gly Gly Asn Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gly Tyr Gly Gly Tyr Gly Tyr Trp Gly Gln Gly Thr Leu Val 100 105 110 Thr Val Ser Ser 115 <210> 93 <211> 119 <212> PRT <213> Homo sapiens <400> 93 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Lys Ser 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Leu Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Ala Gly Asp Tyr Asp Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser 115 [[ID=~40]] <210> 94 <211> 119 <212> PRT <213> Homo sapiens <400> 94 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Asn Tyr 20 25 30 Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ser Ile Ser Gly Ser Gly Ser Thr Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Val Lys Arg Trp Gly Tyr Tyr Phe Asn Trp Trp Gly Gln Gly 100 105 110[[ID=​​​​​​​​​​​​​​​​​​Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Ser Ser Tyr 20 25 30 Ala Met Ala Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Thr Leu Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Val Arg Val Gly Ala Tyr Asp Ala Phe Asp Ile Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 96 <211> 119 <212> PRT <213> Homo sapiens <400> 96 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Thr Tyr 20 25 30 Gly Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Thr Ile Ser Gly Ser Gly Gly Ser Thr Tyr Phe Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asn Ser Gly Trp Phe Met Pro Phe Asp Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser 115 <210> 97 <211> 118 <212> PRT <213> Homo sapiens <400> 97 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Met Phe Ser Arg Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val [[ID=四十二]]35 40 45 Ser Ser Ile Ser Gly Ser Gly Gly Thr Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Arg Gly Ser Gly Trp Tyr Ile Asp Ser Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 98 <211> 122 <212> PRT <213> Homo sapiens <400> 98 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Thr Ile Ser Gly Ser Gly Ser Arg Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Arg Glu Gly Asp Tyr Met Gly Pro Asn Trp Phe Asp Pro Trp 100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 99 <211> 117 <212> PRT <213> Homo sapiens <400> 99 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ala Phe Ser Ser Tyr 20 25 30 Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Thr Ser Ser Gly Gly Gly Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Ile Arg Glu Arg Arg Phe Asp Phe Trp Gly Gln Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> 100 <211> 128 <212> PRT <213> Homo sapiens <400> 100 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn His 20 25 30 Ala Met Ala Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Gly Ser Gly Gly Tyr Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg His Ser Leu Thr Pro Tyr Asn Phe Trp Ser Gly Tyr Tyr Ser 100 105 110 Arg Ser Phe Asp Ile Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 125 <210> 101 <211> 107 <212> PRT <213> Homo sapiens <400> 101 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ala Ile Ser Asn Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile<其 35 40 45 Tyr Ala Ala Ser Arg Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Glu Ser Tyr Ser Thr Pro Phe 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 102 It should be noted that there seems to be an incorrect tag "<其 " in the original text which is retained as is during translation. You may want to check the accuracy of this tag in the original source.<211> 107 <212> PRT <213> Homo sapiens <400> 102 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Tyr Ile Ser Thr Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Leu Gln Gly Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Asn Tyr Ile Thr Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 103 ​​​​​​​​​​​​Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Tyr Ile Ser Ser Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Gly Ala Phe Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ile Thr Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 104 <211> 107 <212> PRT <213> Homo sapiens <400> 百零四 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Thr Ile Ile Thr Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 It should be noted that the translation of "<400> 104" as "百零四" is a bit of a literal and perhaps not the most common or accurate way in this context. It might be better to clarify the meaning in the original text to get a more appropriate translation.Tyr Ala Ala Ser Asn Leu Arg Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Leu Pro Trp 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 105 <211> 107 <212> PRT <213> Homo sapiens <400> 105 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Val Arg Ser Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Thr Ala Thr Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Gly Leu Pro Arg 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 106 <211> 107 <212> PRT <213> Homo sapiens <400> 106 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Gly Ala Ser Ser Leu Arg Gly Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Arg Pro Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 107 <211> 107 [[ID= <213> Homo sapiens <400> 107 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asn Ile Lys Thr Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Leu His Thr Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Thr Tyr Ser Ile Pro Gln 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 108 <211> 108 <212> PRT <213> Homo sapiens <400> 108 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Gly Gln Ser Ile Arg Ser Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ser Ser Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Thr Pro Leu 85 90 95 Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 109 <211> 107 <212> PRT <213> Homo sapiens <400> 109 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Arg Arg Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Thr Leu Gln Ile Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Thr Tyr Ser Ser Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 110 <211> 107 <212> PRT <213> Homo sapiens <400> 110 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Ile Arg Arg Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Arg Ala Ser Arg Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Asn Thr Leu Arg 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 111 <211> 106 <212> PRT <213> Homo sapiens <400> 111 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asn Ile Asn Tyr Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Gly Ala Ser Ser Leu Gln Asn Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ile Thr Pro Tyr 85 90 95 Thr Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 112 <211> 107 <212> PRT <213> Homo sapiens <400> 112 Asp Ile Gln Met Thr Gln Ser Pro Tyr Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Arg Arg Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Arg Ala Ser Thr Leu Gln Thr Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Thr Tyr Ser Ser Pro Phe 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 113 <211> 10� <212> PRT <213> Homo sapiens <400> 113 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Ile Ser Thr Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Thr Ser Arg Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Thr Thr Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 114 <211> 107 <212> PRT <213> Homo sapiens <400> 114 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Val Ser Arg Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Gly Ser Ser Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Glu Ser Tyr Ser Thr Pro Phe 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 115 <211> 107 <212> PRT <213> Homo sapiens <400> 115 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ala Ile Ser Arg Asn 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Gly Ala Ser Asn Leu Gln Thr Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser His Ser Thr Pro Val 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 116 <211> 107 <212> PRT <213> Homo sapiens <400> 116 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly [[ID=​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr 20 25 30 Val Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Gly Ala Ser Arg Leu Gln Asp Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ile Thr Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 118 <211> 9 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 118 Gly Tyr Thr Phe Thr Ser Asn Met His 1 5 <210> 119 <211> 9 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 119 Phe Thr Phe Ser Ser Tyr Ala Met Asn 1 5 <210> 120 <211> 9 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 120 Phe Thr Phe Ser Ser Tyr Ala Ile Asn 1 5 <210> 121 <211> 14 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 121 Val Ala Ser Ile Ser Ser Tyr Tyr Gly Tyr Thr Tyr Tyr Ala 1 5 10 <210> 122 <211> 14 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 122 Val Ser Ala Val Ser Gly Ser Gly Gly Arg Thr Tyr Tyr Ala 1 5 10 <210> 123 <211> 14 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 123 Val Ser Ala Leu Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala 1 5 10 <210> 124 <211> 16 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 124 Gly Gly Asn Tyr Tyr Asn Leu Trp Thr Gly Tyr Tyr Pro Leu Ala Tyr 1 5 10 15 <210> 125 <211> 10 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 125 Ala Arg Glu Arg Ala Thr Thr Leu Asp Tyr 1 5 10 <210> 126 <211> 10 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 126 Ala Arg Arg Ser Ala Gln Leu Gly Asp Tyr 1 5 10 <210> 127 <211> 12 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 127 Cys Ala Arg Glu Arg Ala Thr Thr Leu Asp Tyr Trp 1 5 10 <210> 128 <211> 18 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 128 Cys Ala Arg Asp Ser Leu Thr Thr Arg Gly Tyr Tyr Tyr Tyr Met Asp 1 5 10 15 Val Trp <210> 129 <211> 11 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 129 Arg Ala Ser Gln Asp Ile Ser Thr Tyr Leu Asn 1 5 10 <210> 130 <211> 11 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 130 Arg Ala Ser Gln Thr Ile Tyr Ser His Leu Asn 1 5 10 <210> 131 <211> 11 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 131 Arg Ala Ser Gln Ser Ile Ser Ser Phe Leu Asn 1 5 10 <210> 132 <211> 7 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 132 Tyr Thr Asp Arg Leu Gln Thr 1 5 <210> 133 <211> 7 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 133 Val Ala Ser Arg Leu Gln Ser 1 5 <210> 134 <211> 7 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 134 Ala Ala Pro Ser Leu Gln Ser 1 5 <210> 135 <211> 9 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 135 Gln Gln Gly Gly Ala Leu Pro Phe Thr 1 5 <210> 136 <211> 9 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 136 Gln Gln Ser Phe Ser Thr Ser Trp Thr 1 5 <210> 137 <211> 9 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 137 Gln Gln Ser Phe Arg Thr Pro Phe Thr 1 5 <210> 138 <211> 117 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 138 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Val Ser Gly Ser Gly Gly Arg Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Arg Ala Thr Thr Leu Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> 139 <211> 123 <212> PRT <213> Unknown <220> <223> Unknown description: Human or cynomolgus monkey sequence<00L3366><400> 139 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15<00033L69>Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Arg Phe Ser Thr Tyr [[ID=Li]]20 25 30 Ala Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val<LOOL3372>35 40 斗5 Ser Gly Ile Ser Gly Ser Gly Gly Ser Lys Tyr His Ala Asp Ser Val<OOOL3374> It should be noted that there seems to be a small error in the original text where "<00L3366>" and "<LOOL3372>" and "<OOOL3374>" are likely incorrect tags. I've translated them as best as possible while keeping the original format. If these are meant to be something specific, the translation might need to be adjusted accordingly.50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Ser Leu Thr Thr Arg Gly Tyr Tyr Tyr Tyr Met Asp Val 100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 140 <211> 123 <212> PRT <213> Unknown <220> <223> Description: Unknown Human or cynomolgus monkey sequence <400> 140 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Tyr Thr Phe Thr Ser 20 25 30 Asn Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Ser Ile Ser Ser Tyr Tyr Gly Tyr Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Gly Gly Asn Tyr Tyr Asn Leu Trp Thr Gly Tyr Tyr Pro Leu Ala Tyr 100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 141 <211> 117 <212> PRT <213> Unknown <220> <223> Unknown description: Human or cynomolgus monkey sequence <400> 141 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Tyr 20 25 30 Ala Leu Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Val Thr Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60[[ID=۴۷]] Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Val Arg Ala Thr Thr Leu Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> 142 <211> 107 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 142 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Thr Ile Tyr Ser His 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Val Ala Ser Arg Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Phe Ser Thr Ser Trp 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 143 <211> 106 <212> PRT <213> Unknown <220> <223> Unknown description: Human or cynomolgus monkey sequence <400> 143 Asp Ile Gln Met Thr Gln Ser Gln Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Arg Thr Ser 20 25 30 Leu Asn Trp Tyr Gln Gln Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr 35 40 45 [[ID=�6]]Ala Ala Ser Arg Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser 50 55 60 Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu 65 70 75 80 Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Thr Leu Tyr Ser 85 90 95 Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 144 <211> 107 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 144 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Thr Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Tyr Thr Asp Arg Leu Gln Thr Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Gly Ala Leu Pro Phe 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 <210> 145 <211> 107 <212> PRT <213> unknown <220> <223> Unknown Description: Human or cynomolgus monkey sequence <400> 145 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Ile Ser Thr Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Thr Ala Ser Arg Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Thr Pro Trp 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 146 <211> 120 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 146 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe Arg Ile Asn 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Ala Ala Ile Asn Asn Phe Gly Thr Thr Lys Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Ala Asp Asn Ala Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Ala Val Arg Trp Gly Pro Arg Asn Asp Asp Arg Tyr Asp Trp Gly Gln 100 105 110 Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 147 <211> 123 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 147 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Phe Phe Ser Ile Asn 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Gly Ile Thr Arg Ser Gly Val Ser Thr Ser Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Ala Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala His Arg Ile Val Val Gly Gly Thr Ser Val Gly Asp Trp Arg 100 105 110 Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 148 <211> 120 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 148 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe His Ile Asn 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Ala Ala Ile Asn Asn Phe Gly Thr Thr Lys Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Ala Asn Asn Ala Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Ala Val Arg Trp Gly Pro Arg Asn Asp Asp Arg Tyr Asp Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 149 <211> 108 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 149 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Asp 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Phe Ala Ser Gly Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Ser Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg 100 105 <210> 150 <211> 108 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 150 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Ile Ser Asn Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Thr Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Thr Leu Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg 100 105 <210> 151 <211> 108 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 151 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Arg Tyr 20 25 30 Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Gly Ala Ser Arg Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Arg Gln Ser Tyr Ser Thr Pro Trp 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg 100 105 <210> 152 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 152 Gly Gly Thr Phe Ser Ser Tyr Ala 1 5 <210> 153 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 153 Ile Ile Pro Ile Phe Gly Thr Ala 1 5 <210> 154 <211> 16 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 154 Cys Ala Arg Asn Asn Asn Asn Asn Asn Asn Asn Asn Phe Asp Tyr Trp 1 5 10 15 <210> 155 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 155 Gly Phe Thr Phe Ser Ser Tyr Ala 1 5 <210> 156 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 156 Ile Ser Gly Ser Gly Gly Ser Thr 1 5 <210> 157 <211> 16 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 157 Cys Ala Lys Asn Asn Asn Asn Asn Asn Asn Asn Asn Phe Asp Tyr Trp 1 5 10 15 <210> 158 <211> 6 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 158 Gln Ser Ile Ser Ser Tyr 1 5 <210> 159 <211> 3 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 159 Ala Ala Ser 1 <210> 160 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 160 Cys Gln Gln Ser Tyr Ser Thr Pro Asn Thr Phe 1 5 10 <210> 161 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 161 Gln Ser Val Ser Ser Ser Tyr 1 5 <210> 162 <211> 3 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 162 Gly Ala Ser 1 <210> 163 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <400> 163 Cys Gln Gln Tyr Gly Ser Ser Pro Asn Thr Phe 1 5 10 <210> 164 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic Oligonucleotides <220> <221> Modified base <222> (51)..(52) <223> Thymidine-succinyl hexanoamide CED phosphoramidite <400> 164 agacaatcaa ccatttgggg tggacagcct tgacctctag acttcggcat tttttttttt 60 tt 62 <210> 165 <211> 112 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic polynucleotides <220> <221> Modified base <222> (101)..(102) <223> Thymidine-succinyl hexanoamide CED phosphoramidite <400> 165 cgggatcctt atcgtcatcg tcgtacagat cccgacccat ttgctgtcca ccagtcatgc 60 tagccatacc atgatgatga tgatgatgag aaccccgcat tttttttttt tt 112 <210> 166 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic Primers <400> 166 atgcggggtt ctcatcatc 19 <210> 167 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic Primers <400> 167 cgggatcctt atcgtcatcg 20 <210> 168 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <220> <221> MOD_RES <222> (2)..(2) <223> Arg, Phe, Ser or Gly <220> <221> MOD_RES <222> (3)..(3) <223> Thr or Ile <220> <221> MOD_RES <222> (4)..(4) <223> Phe or Leu <220> <221> MOD_RES <222> (5)..(5) <223> Ser, Arg or Asp <220> <221> MOD_RES <222> (6) <223> Ser, Thr, Asp, Ile or Asn <220> <221> MOD_RES <222> (7)..(7) <223> Tyr or Asn <220> <221> MOD_RES <222> (8) <223> Ala, Gly, Thr, or Val <400> 168 Gly Xaa Xaa Xaa Xaa Xaa Xaa Xaa Met 1 5 <210> 169 <211> 15 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <220> <221> MOD_RES <222> (2)..(2) <223> Phe, Leu, Trp, or Gly <220> <221> MOD_RES <222> (4)..(4) <223> Ala or Ser <220> <221> MOD_RES <222> (5)..(5) <223> Ala, Gly, Ser or Thr <220> <221> MOD_RES <222> (7)..(7) <223> Ser, Thr, or Asn <220> <221> MOD_RES <222> (8) <223> Trp, Ser, Arg, Thr, or Gly <220> <221> MOD_RES <222> (9)..(9) <223> Ser, Gly, Asn or Asp <220> <221> MOD_RES <222> (10)..(10) <223> Gly, Ser or Asp <220> <221> MOD_RES <222> (11)..(11) <223> Gly, Ser, Thr, Asp, Ala or Asn <220> <221> MOD_RES <222> (12)..(12) <223> Gly, Ser, Thr, Asp or Ala <220> <221> MOD_RES <222> (14)..(14) <223> Tyr, Asn, Ser or Asp <400> 169 Glu Xaa Val Xaa Xaa Ile Xaa Xaa Xaa Xaa Xaa Xaa Thr Xaa Tyr 1 5 10 15 <210> 170 <211> twenty three <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic peptides <220> <221> MOD_RES <222> (2)..(2) <223> Ala, Thr, or Val <220> <221> MOD_RES <222> (3)..(3) <223> Asp, Gly, Arg, Ala, Ser, Val, Asn or Glu <220> <221> MOD_RES <222> (4)..(4) <223> Arg, Pro, Ser, Gly, Ala, Thr, Leu, or Asn <220> <221> MOD_RES <222> (5)..(17) <223> Any amino acid except Cys or Met <220> <221> MISC_FEATURE <222> (5)..(17) <223> This region may contain 0-13 residues <220> <221> MOD_RES <222> (18) <223> Ser, Arg, Gly, Tyr, Ala, Thr, Asp, or Asn <220> <221> MOD_RES <222> (19)..(19) <223> Glu, Asp, Gly, Ser, Arg, Ala, Asn, or Thr <220> <221> MOD_RES <222> (20)..(20) <223> Tyr, Phe or Arg <220> <221> MOD_RES <222> (21)..(21) <223> Asp, Asn, Glu or Gly <220> <221> MOD_RES <222> (22)..(22) <223> Tyr or Ser <400> 170 Ala Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1 5 10 15 Xaa Xaa Xaa Xaa Xaa Xaa Trp 20

Claims

1. An antibody or antigen-binding fragment thereof that binds to CD3ε, wherein the antibody or antigen-binding fragment thereof comprises CDRH1, CDRH2, and CDRH3 on the heavy chain variable region (VH) and CDRL1, CDRL2, and CDRL3 on the light chain variable region (VL); wherein the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 are each composed of the amino acid sequences shown below: a. SEQ ID NO: 118, 121, 124, 129, 132, and 135; b. SEQ ID NO: 119, 122, 125, 130, 133 and 136; or c. SEQ ID NO: 120, 123, 126, 131, 134 and 137.

2. The antibody or antigen-binding fragment thereof according to claim 1, wherein: a. the VH comprises an amino acid sequence that is at least 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence shown in SEQ ID NO: 138, and the VL comprises an amino acid sequence that is at least 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence shown in SEQ ID NO: 142; or b. the VH comprises an amino acid sequence that is at least 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence shown in SEQ ID NO: 140, and the VL comprises an amino acid sequence that is at least 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence shown in SEQ ID NO:

144.

3. The antibody or antigen-binding fragment thereof according to claim 1 or 2, wherein the VH comprises the amino acid sequence shown in SEQ ID NO: 138, and the VL comprises the amino acid sequence shown in SEQ ID NO:

142.

4. The antibody or antigen-binding fragment thereof according to claim 1 or 2, wherein the VH comprises the amino acid sequence shown in SEQ ID NO: 140, and the VL comprises the amino acid sequence shown in SEQ ID NO:

144.

5. An antibody or antigen-binding fragment thereof that binds to CD3ε, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH comprises the amino acid sequence shown in SEQ ID NO: 139, and the VL comprises the amino acid sequence shown in SEQ ID NO:

143.

6. An isolated nucleic acid comprising a sequence encoding the antibody or antigen-binding fragment thereof according to any one of claims 1 to 5. An expression vector comprising the nucleic acid according to claim 6 .

8. An isolated cell comprising the nucleic acid of claim 6.

9. An isolated cell comprising the expression vector according to claim 7.

Citation Information

Patent Citations

  • Method and apparatus for conducting an array of chemical reactions on a support surface

    US5474796A

  • De novo synthesized gene libraries

    WO2015021080A2

  • Antibodies for the detection of integrin complexes in FFPE material

    US20120171699A1