A method for paired-end sequencing of immobilized template polynucleotides

Abstract

The present invention relates to the field of gene sequencing technology, and in particular to a method for paired-end sequencing of immobilized template polynucleotides. In the method of the present invention, the first-end sequencing template chain is immobilized on a chip, and the complementary chain of the first-end sequencing template chain is directly connected to its 3' end to indirectly fix the complementary chain on the chip, thereby releasing the double-stranded structure between the first-end sequencing template chain and the complementary chain, and blocking the first-end sequencing template chain to prevent the complementary chain from re-hybridizing and combining with the first-end sequencing template chain in a renaturing environment, thereby realizing second-end sequencing using the complementary chain as a template. The template chain of the second-end sequencing of the entire sequencing method is directly connected to the position of the first-end sequencing template chain, which overcomes the technical defects of the traditional double-end sequencing method such as the poor stability of the sequencing signal caused by the reduction of cluster orderliness and the enlargement of the cluster range due to the re-clustering of the second-end sequencing.

Description

Technical Field

[0001] The present invention relates to the technical field of gene sequencing, and in particular to a method for paired-end sequencing of immobilized template polynucleotides. Background Art

[0002] Paired-end sequencing allows the determination of two reads of sequences from two locations on a polynucleotide double strand. Since paired-end sequences are not completely random but are known to occur on a single double strand and are connected or paired in the genome, they help to combine the sequences of the entire genome into a consistent sequence, thereby increasing the length of the sequence information obtained in a single sequencing run.

[0003] The paired-end sequencing methods based on array polynucleotide templates disclosed in the prior art include the method disclosed in WO2004 / 070005 and implemented on a solid support, wherein two or more primers are hybridized to the target polynucleotide at the same time, and after the hybridization step, all primers hybridized to the template except one primer are blocked, and the unblocked primers are extended for sequencing, and after the sequencing is completed, one of the blocked primers is unblocked to obtain a free 3' hydroxyl group for another extended sequencing reaction. During the implementation of this method, although the array polynucleotide template is always connected to the solid support to maintain the stability of the polynucleotide template chain, it is necessary to ensure that only one primer can be extended, and the other primers must be completely blocked. In actual operation, it is difficult to ensure that the other primers are completely blocked, resulting in a high sequencing error rate;

[0004] WO2007010252 discloses forming a double-stranded template cluster on a solid support, denaturing the double-stranded template cluster to form a single-stranded cluster, removing one of the strands of a portion of the double-stranded template cluster, and sequencing the remaining strand; after completing one sequencing, removing the single-stranded template with the same sequence as that in the first sequencing in the remaining portion of the double-stranded template cluster, sequencing the remaining strand complementary to the removed template strand, and completing double-end sequencing of the double-stranded template. This method can only sequence one strand of a portion of the clusters at a time, and cannot fully utilize all the clusters, resulting in the sequencing signal strength not meeting expectations;

[0005] WO2008041002 discloses that one of the chains of all double-stranded template clusters is first removed, the remaining chain is sequenced, and then the remaining chain is used as a template amplification to form its complementary chain, and its complementary chain is sequenced, and finally double-end sequencing is achieved. This method needs to first form a template chain cluster sequenced at the first end, and then use the template chain sequenced at the first end as a template amplification to form a cluster of its complementary chain as a template for the second section of sequencing. Since there is a certain disorder in the clustering process, the secondary clustering process of the second end sequencing of this method will increase the disorder of cluster formation, so that the cluster range of the second end sequencing becomes larger, and the complexity of cluster signal correction is increased. Therefore, it is necessary to further innovate and improve the existing paired end sequencing method, while ensuring the stability of the second end sequencing, avoid the cluster range of the second end sequencing from becoming larger, and reduce the complexity of cluster signal correction. Summary of the invention

[0006] In order to overcome the defects of the prior art, one of the objects of the present invention is to provide a method for paired-end sequencing of immobilized polynucleotide templates, improve the stability of second-end sequencing, reduce the complexity of cluster signal correction, and improve sequencing quality.

[0007] At the same time, the present invention also provides a kit for implementing the sequencing method of the present invention.

[0008] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0009] A method for paired-end sequencing of immobilized polynucleotide templates, comprising the following steps:

[0010] S1. providing a single-stranded template polynucleotide cluster in an array fixed on a solid support as a first-end sequencing template chain, adding a first sequencing primer, sequencing at least a portion of the sequence of the single-stranded template polynucleotide, and obtaining an extended chain of the first sequencing primer and corresponding first-end sequence information;

[0011] S2: Using the first-end sequencing template strand as a template, a polynucleotide strand complementary to the first-end sequencing template strand is formed, which is called a complementary strand;

[0012] S3: The 3' end of the first sequencing template chain is connected to the 5' end of the complementary chain, the double-stranded hybrid structure of the first sequencing template chain and the complementary chain is released, and the first sequencing template chain is blocked to prevent the complementary chain from re-hybridizing with the first sequencing template chain in the renaturing environment;

[0013] S4: adding a second sequencing primer that complementarily pairs with the 3' end of the complementary chain, sequencing at least a portion of the sequence of the complementary chain, and obtaining second end sequence information.

[0014] Optionally, the specific method for forming a complementary chain in step S2 is to continue to extend the extended polynucleotide chain of the first sequencing primer that has completed the first-end sequencing using the first-end sequencing template chain as a template to form a polynucleotide chain that is complementary to the full length of the first-end sequencing template chain.

[0015] Alternatively, the specific method for forming a complementary chain in step S2 is to release the double-stranded structure of the extended chain of the first sequencing primer and the first-end sequencing template chain under denaturing conditions, remove the extended chain of the first sequencing primer, add an amplification primer that is at least partially complementary to the 3' end of the first-end sequencing template chain, and use the first-end sequencing template chain as a template to extend the amplification primer to form a polynucleotide chain complementary to the full length of the first-end sequencing template chain.

[0016] Optionally, the method for releasing the double-stranded hybridization structure of the first-end sequencing template chain and the complementary chain and sealing the first-end sequencing template chain in step S3 is: under denaturing conditions, the first-end sequencing template chain and the complementary chain release the double-stranded hybridization structure to form a long single chain, and then a first extension primer that is complementary to the 3' end of the long single chain is added, and the first extension primer is extended with the first-end sequencing template chain as a template to form a first extension primer chain that is complementary to the first-end sequencing template chain, thereby sealing the first-end sequencing template chain.

[0017] Further preferably, after the long single strand is formed, a single strand binding protein is added, and then a first extension primer that complementarily pairs only with the 3' end of the first end sequencing template strand of the long single strand is added.

[0018] In the primer extension environment, the complementary chain has the possibility of hybridizing with the template chain. In order to avoid the renaturation hybridization of the complementary chain and the template chain, the relationship between the cluster density and the concentration of the first extension primer is controlled or the first extension primer is chemically modified. The extension rate of the first extension primer is controlled to be greater than the renaturation hybridization rate of the complementary chain and the template chain, and the possibility of renaturation hybridization of the complementary chain and the template chain is reduced by using the kinetic exclusion principle, thereby improving the feasibility and accuracy of the second end sequencing using the complementary chain.

[0019] Optionally, in step S3, the method for releasing the double-stranded hybrid structure of the first-end sequencing template chain and the complementary chain and blocking the first-end sequencing template chain is: adding a second extension primer complementary to the 3' end of the first-end sequencing template chain, in the environment of chain displacement reaction, the second extension primer is extended with the first-end sequencing template chain as a template, and simultaneously displaces the complementary chain hybridized with the first-end sequencing template chain, and the second extension primer chain formed by the second extension primer and complementary to the first-end sequencing template chain is formed, and blocks the first-end sequencing template chain. Further, optionally, the second extension primer is complementary to the 3' end of the first-end sequencing template chain by a recombinase, and the second extension primer is extended in a chain displacement environment and simultaneously displaces the complementary chain hybridized with the first-end sequencing template chain; at the same time, it should be understood that, in the case of not using a recombinase, by reserving a single-stranded region at the 3' end of the first-end sequencing template chain, the second extension primer is complementary to the single-stranded region, and the extension of the second extension primer in a chain displacement environment can also displace the complementary chain hybridized with the first-end sequencing template chain.

[0020] Optionally, the method for connecting the 3' end of the first sequencing template chain and the 5' end of the complementary chain in step S3 is: forming a first functional group at the 3' end of the first sequencing template chain, forming a second functional group at the 5' end of the complementary chain, initiating a click chemistry reaction between the first functional group and the second functional group, and covalently connecting the 3' end of the first sequencing template chain and the 5' end of the complementary chain.

[0021] Optionally, the method of forming the first functional group at the 3' end of the first sequencing template strand comprises using a terminal transferase to connect a modified nucleotide having a first functional group modified at 3' to the 3' end of the first sequencing template strand;

[0022] The method for forming the second functional group at the 5' end of the complementary chain includes using a primer with a second functional group modified at the 5' end, and extending the first end sequencing template chain as a template to form a complementary chain.

[0023] It can be understood that any first functional group and second functional group capable of undergoing click chemistry reaction can be applied to the present invention. As an example, in some embodiments of the present invention, the first functional group is selected from azide, alkyne, cycloalkyne, cycloalkene or heterocycloalkene; the corresponding second functional group is selected from cycloalkene, heterocycloalkene, alkyne, cycloalkyne or azide.

[0024] Optionally, in addition to the chemical covalent connection method described above, the connection between the 3' end of the first end sequencing template strand and the 5' end of the complementary strand in step S3 may also be connected by a biological enzyme method. In one embodiment of the present invention, the specific implementation of the biological enzyme method connection includes designing an amplification primer with a stem-loop structure in step S2 for extending to form a complementary strand, the 3' stem portion of the amplification primer having a protruding single-stranded region, at least part of the protruding single-stranded region complementary pairing and hybridization with the 3' end of the first end sequencing template strand; adding a ligase to connect the 5' end of the amplification primer to the 3' end of the first end sequencing template strand.

[0025] Amplification primers with other stem-loop structures can also be used to form complementary chains and achieve connection between the 3' end of the first sequencing template chain and the 5' end of the complementary chain. Specifically, in another embodiment of the present invention, there is a single-stranded region at the 5' end of the amplification primer that is not complementary to the sequencing template chain at the first end, and an auxiliary primer with a stem-loop structure that can complementarily pair and hybridize with the single-stranded region of the amplification primer is added, and a ligase is added to correspondingly connect the 5' end of the auxiliary primer to the 3' end of the first sequencing template chain, and the 3' end of the auxiliary primer to the 5' end of the first sequencing template chain.

[0026] In the sequencing method of the present invention, the first-end sequencing template chain is immobilized on the chip, and the complementary chain of the first-end sequencing template chain is directly connected to its 3' end to indirectly fix the complementary chain on the chip, thereby releasing the double-stranded structure between the first-end sequencing template chain and the complementary chain, and blocking the first-end sequencing template chain to prevent the complementary chain from re-hybridizing and combining with the first-end sequencing template chain in a renaturing environment, thereby realizing the second-end sequencing with the complementary chain as a template. The second-end sequencing template chain of the entire sequencing method is directly connected to the position of the first-end sequencing template chain, which overcomes the technical defects of the traditional double-end sequencing method such as the poor stability of the sequencing signal caused by the reduction of cluster orderliness and the enlargement of the cluster range due to the re-clustering of the second-end sequencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 A schematic diagram of the principle of the sequencing method provided for a specific embodiment of the present invention.

[0028] Figure 2 Schematic diagram of the denaturing PAGE gel analysis results of D-M02, D-M02-T, D-M02-L, L-M02-P, and D-M02-C in Example 1;

[0029] Figure 3 This is a green fluorescence signal image of the sequencing method according to Example 2 of the present invention;

[0030] Figure 4 This is a red fluorescent signal image of the sequencing method according to Example 2 of the present invention. DETAILED DESCRIPTION

[0031] Below, in conjunction with specific embodiments, the present invention is further described, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0032] 1. Single-stranded template polynucleotide

[0033] The single-stranded template polynucleotide of the present invention refers to any polynucleotide chain in a single-stranded form, which serves as a template for first-end sequencing, preferably in a single-stranded form with a linear structure;

[0034] The linear structure of the single-stranded template polynucleotide includes a first adapter, a second adapter and a target DNA sequence inserted into the first adapter and the second adapter, the first adapter provides a first sequencing primer binding site, an amplification primer binding site, a first extension primer binding site and / or a second extension primer binding site, and at least a partial sequence of the second adapter is the same as the second sequencing primer sequence; in some embodiments, the first adapter and the second adapter use a universal sequence to achieve large-scale parallel sequencing of different target DNA sequences, and the target DNA and sequencing direction of different samples can be marked by inserting a label sequence into the first adapter and the second adapter.

[0035] 2. Construction of single-stranded template polynucleotide library

[0036] 2.1 Overview of library construction methods

[0037] In many large-scale parallel sequencing technologies, there are many methods for generating sequencing template libraries. In certain embodiments, according to the library construction method commonly used in "Solexa" type sequencing, a linear structure single-stranded template polynucleotide library is constructed, the genomic DNA is first fragmented, and then both ends of the DNA fragments are connected to platform-specific oligonucleotide adapters, one end of the adapter is used to fix a single fragment on a solid support, and the single fragment is amplified on the solid support to generate a single-stranded template polynucleotide cluster for sequencing;

[0038] It should be understood that the present invention can adopt any library construction method known in the art to construct an array structure including many different target DNA sequences but sharing the same adapter sequence to achieve large-scale parallel sequencing.

[0039] 2.2 Adaptors

[0040] The adaptors used in the construction of the above-mentioned single-stranded template polynucleotide library may include elements for fixing the template DNA polynucleotide on a solid support (e.g., the 5' end of the second adaptor carries a modification group that can react with a functional group on the solid support), and may also include a restriction endonuclease recognition site, an extension primer hybridization site, a barcode sequence, a unique molecular identifier sequence, and a polymerase recognition sequence (e.g., the extension primer binding site, sequencing primer binding site, and tag sequence provided on the first adaptor and the second adaptor in the above-mentioned template polynucleotide structure);

[0041] The adapter sequence can have a length, structure, and other characteristics suitable for a particular sequencing platform and intended use. For example, the adapter can be single-stranded, double-stranded, or partially double-stranded, and the length can range from 10 to 200 nucleotides, 20 to 100 nucleotides, 40 to 100 nucleotides, or 50 to 80 nucleotides. In some embodiments, different members of the library will generally contain a common adapter sequence, although different species or subclasses in the library may have unique characteristics, such as tag sequences or subgenus-specific barcodes;

[0042] A single adapter may include multiple subsequences with different functions. For example, in the embodiment of the present invention, the first adapter of the single-stranded template polynucleotide of the linear structure includes a first sequencing primer binding site, a first extension primer binding site, a second extension primer binding site, and an amplification primer binding site. Different functional sequences may overlap or not overlap according to actual needs, and may be arranged adjacently or at a certain distance. The overlapping region may overlap by 5%, 10%, 20%, 30%, 40%, or 50%, and the non-overlapping region may be separated by 1 to 10, 10 to 20, 30 to 40, or 40 to 50 nucleotides.

[0043] 2.3 Formation of single-stranded template polynucleotide clusters in an array structure fixed on a solid support

[0044] The present invention defines that the single-stranded template polynucleotide is fixed on the solid support in the form of an array, which can be fixed on a flat solid support surface in the form of an array, and all the single-stranded template polynucleotides in the array structure are in a completely identical and uniform reaction environment; or the solid support is provided with an array of recessed structures, and each single-stranded template polynucleotide is fixed in a corresponding recessed structure, and each recessed structure forms an independent reaction chamber;

[0045] The present invention can use any amplification clustering method known in the art to construct a single-stranded polynucleotide template in an array structure fixed on a solid support, for example:

[0046] In some embodiments, bridge amplification is used to form a single-stranded template polynucleotide in an array structure fixed on a solid support;

[0047] In some other embodiments, a non-bridge amplification method is adopted, and a linker sequence that can hybridize and bind to a linker at one end of the fragmented DNA (usually used as the second linker of the formed single-stranded template polynucleotide) is pre-fixed on the solid support, and an amplification clustering method similar to that disclosed by Zhaochun Ma et al. in the paper "Isothermal amplification method for next-generation sequencing" is adopted to form a single-stranded template polynucleotide array structure fixed on the solid support; it should be understood that the present invention can also adopt other methods that can amplify single-stranded template polynucleotide clusters that can form an array by pre-fixing a linker on a solid support, and the cluster formation method does not determine the implementation of the sequencing method of the present invention.

[0048] 3. Sequencing of the first end of single-stranded template polynucleotide

[0049] In some embodiments, the first end sequencing method of the single-stranded template polynucleotide includes providing a single-stranded template polynucleotide cluster in an array fixed on a solid support according to the above method, setting a first adaptor at the 3' end of the single-stranded template polynucleotide, and fixing the 5' end on the solid support through a second adaptor, a first sequencing primer binding site is set on the first adaptor, adding a first sequencing primer, and the first sequencing primer is bound to a corresponding position of the first adaptor, and the first end sequencing of the single-stranded template polynucleotide can be performed by a synthetic sequencing method, a ligation sequencing method, or a pyrophosphate sequencing method to obtain an extended chain of the first sequencing primer and corresponding first end sequence information;

[0050] 4. Generation of complementary strands of single-stranded template polynucleotides

[0051] In one embodiment of the present invention, after the first-end sequencing is completed, the extended chain of the first sequencing primer is continued to be extended using the first-end sequencing template chain as a template to obtain a complementary chain complementary to the first-end sequencing template chain;

[0052] In another embodiment of the present invention, after the first end sequencing is completed, the extended strand of the first sequencing primer is removed, an amplification primer is added, an amplification primer binding site is set on the first adaptor, and the amplification primer is extended to form a complementary strand complementary to the first end sequencing template strand;

[0053] 5. Fixation of the second end sequencing template strand

[0054] The complementary strand of the first-end sequencing template strand formed as above is used as a template for second-end sequencing, and the complementary strand needs to be formed into a stable single-stranded structure and fixed on a solid support. First, the 3' end of the first-end sequencing template strand needs to be connected to the 5' end of the complementary strand, which can be achieved by chemical covalent connection or biological enzyme connection.

[0055] The implementation of the chemical covalent connection method includes, in one embodiment of the present invention, firstly, using terminal transferase to connect a modified nucleotide modified with a first functional group at the 3' end of the first end sequencing template chain, and the first functional group can be selected from azide, alkyne, cycloalkyne, alkene or cycloalkene; using a first sequencing primer with a second functional group modified at the 5' end to form a complementary chain of the first end sequencing template chain, in another embodiment of the present invention, using an amplification primer with a second functional group modified at the 5' end to form a complementary chain of the first end sequencing template chain, and the second functional group is correspondingly selected from alkyne, cycloalkyne, alkene, cycloalkene or azide; by stimulating the first functional group and the second functional group to produce a click chemical reaction, the 3' end of the first end sequencing template chain and the 5' end of the complementary chain are covalently connected as a whole;

[0056] The implementation method of the bio-enzymatic ligation includes, in the above-mentioned embodiment of the present invention in which a complementary chain of the first-end sequencing template chain is formed by adding an amplification primer, an amplification primer with a stem-loop structure is designed to extend and form a complementary chain, the 3' stem portion of the amplification primer has a protruding single-stranded region, the first adapter portion of the first-end sequencing template chain is provided with a binding site for the protruding single-stranded region of the amplification primer, so that the amplification primer and the first-end sequencing template chain are complementary and paired and hybridized, and a ligase is added to connect the 5' end of the amplification primer to the 3' end of the first-end sequencing template chain;

[0057] In another embodiment of the present invention, an amplification primer with another stem-loop structure is used, specifically, there is a single-stranded region at the 5' end of the amplification primer that is not complementary to the sequencing template chain at the first end, and then an auxiliary primer with a stem-loop structure that can complementarily pair and hybridize with the single-stranded region of the amplification primer is added, and a ligase is added to correspondingly connect the 5' end of the auxiliary primer to the 3' end of the sequencing template chain at the first end, and the 3' end of the auxiliary primer to the 5' end of the sequencing template chain at the first end.

[0058] After the 3' end of the first sequencing template strand is connected to the 5' end of the complementary strand, the complementary strand needs to be stabilized into a single strand. The implementation methods include:

[0059] In one embodiment of the present invention, under a denaturing environment, the double-stranded hybridization structure between the first-end sequencing template chain and the complementary chain is released, and the complementary chain forms a single-stranded structure. Since the first-end sequencing template chain is fixed on a solid support, the complementary chain is indirectly fixed on the solid support; then a first extension primer is added, and a first adapter sets a first extension primer binding site. The first extension primer is extended to form a double-stranded structure with the first-end sequencing template chain. By controlling the concentration and Tm value of the first extension primer and other properties, and controlling the reaction conditions, the extension rate of the first extension primer is made greater than the rate of renaturation hybridization and binding of the complementary chain with the first-end sequencing template chain, so that the complementary chain forms a stable single-stranded structure;

[0060] In another embodiment of the present invention, a second extension primer and a recombinase are added, and the second extension primer is complementary hybridized with the second extension primer binding site set on the first adaptor. In a chain displacement reaction environment, the second extension primer is extended and simultaneously displaces the complementary chain formed by the extension of the amplification primer. At the same time, the extended chain of the second extension primer forms a double-stranded structure with the template chain sequenced at the first end. Finally, the complementary chain forms a stable single-stranded structure and is indirectly fixed on the solid support through the template chain sequenced at the first end. In another embodiment of the present invention, no recombinase is added, and the binding site of the second extension primer is set upstream of the binding site of the amplification primer. For example, in the above-mentioned embodiment of using an amplification primer with a stem-loop structure to form a complementary chain, the binding site of the amplification primer can be set in the single-stranded loop region of the stem-loop structure. In a chain displacement reaction environment, the second extension primer is extended and simultaneously displaces the complementary chain formed by the extension of the amplification primer.

[0061] Strand displacement activity refers to the phenomenon that biological, chemical or physical agents cause paired nucleic acids to dissociate from their complementary chains in the 5' to 3' direction, bind and approach template-dependent nucleic acid synthesis, and displace downstream DNA encountered during the synthesis process; strand displacement begins at the 5' end of the paired nucleic acid sequence, so the enzyme immediately performs nucleic acid synthesis at the 5' end of the displacement site. The newly synthesized nucleic acid and the displaced nucleic acid usually have the same nucleotide sequence complementary to the template nucleic acid chain. The strand displacement activity can be located on the same molecule as the molecule that confers the activity of nucleic acid synthesis, or it can be a separate and independent activity. For example, DNA polymerases, such as Escherichia coli DNA polymerase I, Klenow fragment of DNA polymerase I, DNA polymerase of T7 or T5 phages, and HIV viral transcriptase, are enzymes with both polymerase activity and strand displacement activity. Reagents such as helicases can be used in combination with inducers that do not have strand displacement activity to produce a strand displacement effect.

[0062] In some embodiments of the present invention, the strand displacement activity reaction environment is provided by using a DNA polymerase having strand displacement activity, such as phi29 polymerase, Bst polymerase, Bsu DNA polymerase, Vent DNA polymerase, and BsmDNA polymerase large fragment.

[0063] 6. Second-end sequencing

[0064] In the embodiment of the present invention, a second adapter of a known sequence is set at the 3' end of the template chain sequenced at the first end, and the 5' end of the complementary chain complementary to the template chain sequenced at the first end formed in the above embodiment has a sequence complementary to the second adapter. After the complementary chain with a stable single-stranded structure is formed, a second sequencing primer is added, and the second sequencing primer is identical to at least part of the sequence of the second adapter. Sequencing is performed using the complementary chain as a template by a synthetic sequencing method, a ligation sequencing method, or a pyrophosphate sequencing method to complete the second-end sequencing.

[0065] Example 1

[0066] In this example, in order to verify that a double-stranded template with a hairpin structure at one end can be used to perform a strand displacement reaction after adding a primer complementary to the single-stranded region of the loop structure of the hairpin structure to obtain the corresponding product

[0067] Experimental materials used in the examples:

[0068] Single-stranded template M02:

[0069] AATGATACGGCGACCACCGTCGAGGACTATCGGATCATTCGACTTACGTTACTCGATCAATCAAGTCAATCGAACT

[0070] Amplification primer M02-P: TTCGATTGACTTGATTG

[0071] Primer L-M02-1:

[0072] CGGGCTCGGAACGAAAGTTAGCTAAGCGTGCTTACCCCGAG

[0073] Strand displacement primer L-M02-P:

[0074] GTAAGCACGCTTAGCTAACTTTC

[0075] Taq Mix (2×Taq PCR Premix II, KT21, Tiangen Biochemical Technology (Beijing) Co., Ltd.), T4 PNKbuffer (T4 polynucleotide kinase reaction buffer, M0201S, NEB), T4 DNA ligase and buffer (T4 DNA ligase and reaction buffer, M0202S, NEB), Bsu DNA polymerase and buffer (Bsu DNA polymerase, large fragment, M0330S, NEB)

[0076] The verification test method of this embodiment includes the following steps:

[0077] 1) Amplification of single-stranded template into double-stranded structure:

[0078] Take 1 μl of single-stranded template M02, 1 μl of amplification primer M02-P, 25 μl of 2×Taq Mix, and ddH 2 O 23μl, 60℃ temperature, reaction for 30min, magnetic beads to recover the product, and obtain the double-stranded structure product D-M02 with a 3' base overhang;

[0079] 2) Hairpin structure annealing:

[0080] Take primer L-M02-1 5μl, T4 PNK buffer 5μl, ddH 2 O 40μl, run the annealing temperature program: 95℃5min, 95℃ slowly to 37℃, reduce 1℃ each cycle, 4℃5min, obtain the hairpin structure primer L-M02-T;

[0081] 3) Connection:

[0082] Take 5 μl of D-M02 obtained in step 1), 3 μl of L-M02-T, 1 μl of T4 DNA ligase, and 1 μl of T4 DNA ligase buffer, react at 37°C for 2 hours to obtain product D-M02-L;

[0083] 4) Strand displacement amplification:

[0084] Take 7 μl of D-M02-L, 1 μl of L-M02-P, 1 μl of Bsu polymerase, and 1 μl of buffer, react at 60°C for 30 min, and obtain the product D-M02-C.

[0085] D-M02, D-M02-T, D-M02-L, L-M02-P, and D-M02-C were analyzed by denaturing PAGE gel. Figure 2 As shown, the results show that the product D-M02-C includes a long fragment structure, indicating that the double-stranded template with a hairpin structure at one end can be subjected to a strand displacement reaction after adding a primer complementary to the stem-loop site of the hairpin structure to obtain the corresponding product.

[0086] Example 2

[0087] This example provides a specific example of double-end sequencing using the sequencing method of the present invention.

[0088] 1. Construction of single-stranded template polynucleotide clusters:

[0089] The first adapter sequence was designed as:

[0090] 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTCTCCGATCT-3';

[0091] The second adaptor sequence is:

[0092] 5'-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG-3';

[0093] The phix174 genome sequence with known sequence was used as the nucleotide chain to be sequenced.

[0094] Connecting the first adapter and the second adapter to the two ends of the nucleotide chain to be sequenced, using the amplification clustering method disclosed by Zhaochun Ma et al. in the paper "Isothermal amplification method for next-generation sequencing" to form a single-stranded template polynucleotide cluster in an array structure fixed on the chip;

[0095] 2. First-end sequencing:

[0096] The first sequencing primer was designed to be 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'; 1uM of the first sequencing primer was added to the flow channel of the chip reaction chamber where the single-stranded template polynucleotide cluster was formed, and reversible terminator nucleotides labeled with different fluorescent dyes were used as modified nucleotide raw materials, and sequencing was performed at 60°C for 50 cycles; a denaturing agent was added to denature the double-stranded structure, and the extended chain of the first sequencing primer was washed away;

[0097] 3. Second end sequencing:

[0098] Design of stem-loop amplification primers:

[0099] 5'-P-GCTCGGCGAAAGTTAGCTAAGCGTGCTTACCCCGAGCAATGATACGGCGAC-3'

[0100] The upstream amplification primer was designed as: 5'-ACGCTTAGCTAACTTTCG-3', which was used as the aforementioned second extension primer;

[0101] 2 μM of the stem-loop structure amplification primer was added to the chip reaction flow channel for completing the first-end sequencing. The stem-loop structure amplification primer was extended in a mixture containing Taq DNA polymerase and dNTP at 50°C for 30 minutes to form a complementary chain of the first-end sequencing template chain. T4 DNA ligase with a final concentration of 2 U was added, and after reacting at 37°C for 30 minutes, 2 μM of the upstream amplification primer was added and extended in a mixture containing Bsu polymerase and dNTP for 30 minutes to form a complementary chain as shown in the figure. Figure 1 The polynucleotide cluster structure shown, the single-stranded region in the structure is the complementary strand of the first-end sequencing template strand;

[0102] The second sequencing primer was designed as: 5'-CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3'. 1 μM of the second sequencing primer was added to the flow channel of the chip reaction chamber, and reversible terminator nucleotides labeled with different fluorescent dyes were used as modified nucleotide raw materials. Synthesis and sequencing were performed at 60°C for 50 cycles.

[0103] 4. Determination of sequence

[0104] The fluorescence signal image information obtained by the first-end sequencing and the second-end sequencing is processed and integrated, such as Figure 3 and Figure 4 As shown in Table 1, the results show that the nucleotide chain to be sequenced is sequenced correctly.

[0105] Table 1

[0106]

[0107] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for paired-end sequencing of immobilized polynucleotide templates, characterized in that: The steps include: S1. providing a single-stranded template polynucleotide array fixed on a solid support as a first-end sequencing template chain, adding a first sequencing primer, sequencing at least a portion of the sequence of the single-stranded template polynucleotide, and obtaining an extended chain of the first sequencing primer and corresponding first-end sequence information; S2: Using the first-end sequencing template strand as a template, a polynucleotide strand complementary to the first-end sequencing template strand is formed, which is called a complementary strand; S3: Connect the 3' end of the first sequencing template chain to the 5' end of the complementary chain, release the double-stranded hybrid structure of the first sequencing template chain and the complementary chain, and block the first sequencing template chain to prevent the complementary chain from re-hybridizing with the first sequencing template chain in the renaturing environment; S4: adding a second sequencing primer that complementarily pairs with the 3' end of the complementary chain, sequencing at least a portion of the sequence of the complementary chain, and obtaining second end sequence information; The specific method for forming the complementary chain in step S2 is to release the double-stranded structure of the extended chain of the first sequencing primer and the first-end sequencing template chain, remove the extended chain of the first sequencing primer, add an amplification primer that is at least partially complementary to the 3' end of the first-end sequencing template chain, and use the first-end sequencing template chain as a template to extend the amplification primer to form a polynucleotide chain complementary to the full length of the first-end sequencing template chain as a complementary chain; The amplification primer is a stem-loop structure, and the 3' stem portion of the amplification primer has a protruding single-stranded region, and at least part of the protruding single-stranded region is complementary to the 3' end of the first end sequencing template strand; The method for connecting the 3' end of the first sequencing template strand to the 5' end of the complementary strand in step S3 is: adding a ligase to connect the 5' end of the amplification primer to the 3' end of the first sequencing template strand; The method for releasing the double-stranded hybridization structure of the first-end sequencing template chain and the complementary chain and sealing the first-end sequencing template chain in step S3 is as follows: under denaturing conditions, the first-end sequencing template chain and the complementary chain release the double-stranded hybridization structure to form a long single chain, and then a first extension primer that is complementary to the 3' end of the long single chain is added, and the first extension primer is extended with the first-end sequencing template chain as a template to form a first extension primer chain that is complementary to the first-end sequencing template chain, and the first-end sequencing template chain is sealed.

2. The method for paired-end sequencing of immobilized polynucleotide templates according to claim 1, wherein: Step S3 also includes adding a single-strand binding protein after the long single strand is formed, and then adding a first extension primer that is complementary to the 3' end of the first end sequencing template strand of the long single strand.

3. The method for paired-end sequencing of immobilized polynucleotide templates according to claim 1, wherein: In step S3, the method for releasing the double-stranded hybrid structure of the first-end sequencing template chain and the complementary chain and blocking the first-end sequencing template chain is as follows: a second extension primer complementary to the 3' end of the first-end sequencing template chain is added, and in the environment of a chain displacement reaction, the second extension primer is extended using the first-end sequencing template chain as a template, and simultaneously displaces the complementary chain hybridized with the first-end sequencing template chain, and the second extension primer chain formed by the second extension primer that complementarily pairs with the first-end sequencing template chain and hybridizes blocks the first-end sequencing template chain.

4. The method for paired-end sequencing of immobilized polynucleotide templates according to claim 3, wherein: The second extension primer is hybridized to the 3' end of the first sequencing template strand by the recombinase.

5. The method for paired-end sequencing of immobilized polynucleotide templates according to any one of claims 1 to 4, characterized in that: The method for connecting the 3' end of the first sequencing template chain and the 5' end of the complementary chain in step S3 is: forming a first functional group at the 3' end of the first sequencing template chain, using an amplification primer with a second functional group modified at the 5' end, inducing a click chemistry reaction between the first functional group and the second functional group, and covalently connecting the 3' end of the first sequencing template chain and the 5' end of the complementary chain.

6. The method for paired-end sequencing of immobilized polynucleotide templates according to claim 5, wherein: The method for forming a first functional group at the 3' end of the first sequencing template chain comprises using a terminal transferase to connect a modified nucleotide having a first functional group at 3' to the 3' end of the first sequencing template chain.

7. The method for paired-end sequencing of immobilized polynucleotide templates according to claim 6, wherein: The first functional group is azide, alkyne, cycloalkyne, cycloalkene or heterocycloalkene; the corresponding second functional group is cycloalkene, heterocycloalkene, alkyne, cycloalkyne or azide.

8. The method for paired-end sequencing of immobilized polynucleotide templates according to any one of claims 1 to 4, 6 to 7, characterized in that: There is a single-stranded region at the 5' end of the amplification primer that is not complementary to the sequencing template chain at the first end; the method for connecting the 3' end of the sequencing template chain at the first end to the 5' end of the complementary chain in step S3 is: adding a stem-loop structure auxiliary primer that can complementarily pair and hybridize with the single-stranded region of the amplification primer, and then adding a ligase to correspondingly connect the 5' end of the auxiliary primer to the 3' end of the sequencing template chain at the first end, and correspondingly connect the 3' end of the auxiliary primer to the 5' end of the sequencing template chain at the first end.

Images