Wheat calcium ion effect site marker qCa.hnaas-3D

Abstract

The present application belongs to the field of wheat genetic engineering technology, and specifically relates to a genetic marker on wheat chromosome 3D that is linked to calcium ion accumulation in grains. The genetic marker is named SNP1655, and there is an allele mutation of 36C‑36T at the 36th base of the genetic marker. In the present application, based on the results of genotyping with a high-density SNP chip and combined with genome-wide association analysis technology, the inventors preliminarily identified and obtained a SNP site related to a genetic locus that affects calcium ion accumulation in wheat grains. Analysis shows that there is a C→T mutation at this site. When the site is CC, it has a higher calcium ion content in wheat grains than the CT (Y) genotype, indicating that the CC genotype is a dominant haplotype that controls calcium ion accumulation in wheat grains, and is a favorable allele for increasing the calcium ion content in wheat grains. It can lay a certain theoretical and technical foundation for wheat breeding technology with high calcium ion content.

Description

Technical Field

[0001] The present application belongs to the technical field of wheat genetic engineering, and specifically designs a molecular genetic marker on wheat 3D chromosome that is linked to grain calcium ion accumulation. Background Art

[0002] wheat( Triticum aestivum As one of the three major food crops in the world, wheat accounts for about 40% of my country's grain consumption, and its products are the main source of nutrients for residents. Therefore, wheat quality improvement and breeding technology enhancement are of great technical significance to my country's food security.

[0003] Calcium ions are essential trace elements for the human body and play an important role in maintaining normal physiological and biochemical functions of the body. To date, diseases related to trace element malnutrition caused by calcium ion deficiency have caused health threats to at least 2 billion people worldwide. The World Health Organization defines this trace element deficiency phenomenon as "hidden hunger", which is one of the important causes of human dysfunction and various diseases. Using biofortification breeding methods to increase the trace element content of major food crops and improve the human body's trace element intake is considered to be one of the most effective strategies to solve the problem of trace element deficiency in the human body.

[0004] Existing studies have shown that the calcium ion content in wheat grains is a typical quantitative trait controlled by multiple genes. The use of traditional breeding methods to screen wheat germplasm resources with high calcium ion content in grains and breed new varieties has the characteristics of low selection efficiency, long cycle, and poor stability. Therefore, if the calcium ion content of wheat grains can be predicted in the field earlier, the breeding efficiency of new wheat varieties with high calcium ion content in grains can be effectively improved. SNP (Single-Nucleotide Polymorphisms), a sequence polymorphism caused by single nucleotide variation at the genome level, can represent the genetic differences between different individuals to the greatest extent and is an important genetic marker for studying complex quantitative traits. Therefore, identifying SNP markers that are closely linked to the genetic loci for calcium ion accumulation in wheat grains and combining them with molecular marker-assisted breeding technology is expected to improve the breeding efficiency of new wheat varieties with high calcium ion content in grains and serve breeding practice quickly and efficiently. Summary of the invention

[0005] Based on the analysis of the wheat genome, the purpose of this application is to provide a genetic marker on wheat chromosome 3D that is linked to grain calcium ion accumulation, thereby laying a certain technical foundation for the breeding of new wheat varieties with high calcium ion content.

[0006] The technical solution adopted in this application is briefly described as follows.

[0007] The wheat calcium ion effect locus marker qCa.hnaas-3D was named SNP1655 (QTL qCa.hnaas-3D ), refer to the wheat "Chinese Spring" genome v1.1 version sequence, which is located on wheat chromosome 3D; its nucleotide sequence (71bp) is as follows:

[0008] GTTTTCTTCGCAAAAAAGTGCTGGTAACTCTTCCT[C / T]TTTTACATTCCCCAAGTTGCCAAATCTAGAGCTC;

[0009] There is an allele mutation of 36C-36T at the 36th base of the genetic marker, which leads to nucleotide polymorphism in the gene sequence, thus making the wheat grains have different calcium ion content phenotypes; specifically:

[0010] When the locus is homozygous for CC, the wheat grains have a higher calcium ion content compared to the CT (Y) genotype, and the wheat variety is of the high calcium type;

[0011] When the locus is CT(Y) heterozygous, the wheat grain has a lower calcium ion content compared to the CC genotype, and the wheat variety belongs to the low calcium type;

[0012] That is, the genetic marker sequence of the high calcium CC genotype is shown in SEQ ID No.1, which is as follows:

[0013] GTTTTCTTCGCAAAAAAGTGCTGGTAACTCTTCCTCTTTTAACATTCCCCAAGTTGCCAAATCTAGAGCTC;

[0014] The genetic marker sequences for the low calcium heterozygous CT(Y) genotype are as follows:

[0015] GTTTTCTTCGCAAAAAAGTGCTGGTAACTCTTCCTYTTTTAACATTCCCCAAGTTGCCAAATCTAGAGCTC.

[0016] The genetic marker SNP1655 (QTL) on wheat chromosome 3D linked to grain calcium accumulation qCa.hnaas-3D ) is used in the detection of calcium content in wheat grains, and the calcium ion content in wheat grains is determined by detecting 36 base sites;

[0017] If the 36th base of the corresponding sites of the two 3D chromosomes is C, it belongs to the high calcium CC genotype wheat variety, and the wheat grain has a high calcium ion content;

[0018] If the 36th base of the corresponding sites of the two 3D chromosomes is C and the other is T, the wheat variety belongs to the low-calcium CT (Y) genotype wheat variety, and the wheat grain has a low calcium ion content

[0019] The genetic marker SNP1655 (QTL) on wheat chromosome 3D linked to grain calcium accumulation qCa.hnaas-3D ) in the breeding of new wheat varieties, using molecular marker breeding technology, by detecting the genetic marker SNP1655 (QTL qCa.hnaas-3D ) base sequence at position 36, thereby breeding new wheat varieties with high or low calcium content.

[0020] In the prior art, genome-wide association analysis (GWAS) is a statistical method for identifying genetic loci of quantitative traits. Relying on representative and diverse genomic information of natural populations, non-random associations between genotypes and phenotypes can be detected, thereby improving the resolution and accuracy of QTL positioning. In the present application, based on the results of high-density SNP chip genotype identification and combined with genome-wide association analysis (GWAS) technology, the inventors preliminarily identified a SNP site related to the genetic locus affecting wheat grain calcium ion accumulation. Analysis shows that there is a C→T mutation at this site. When the site is CC, it has a higher calcium ion content in wheat grains compared to the CT (Y) genotype, indicating that the CC genotype is the dominant haplotype that controls the calcium ion accumulation of wheat grains, and is a favorable allele for improving the calcium ion content of wheat grains. In general, based on the in-depth study and analysis of this site, combined with molecular marker-assisted breeding technology, a certain theoretical and technical foundation can be laid for high calcium ion content wheat breeding technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Manhattan and QQ-plots of genome-wide association analysis of wheat grain calcium ion content using three analysis models. In the color view, the red dotted line is the threshold line of -log10P=4, and the SNP sites above the threshold line are significantly associated with the calcium ion content of wheat grains; the red circle represents the SNP site SNP1655 identified by the three analysis models screened by the present invention and significantly associated with the calcium ion content of wheat grains;

[0022] Figure 2This is the genotyping and phenotypic distribution diagram of the molecular marker SNP1655 in the natural population; in the color view, orange represents the phenotypic distribution of CC genotype varieties (lines), and green represents the phenotypic distribution of CT(Y) genotype varieties (lines). The calcium ion content of wheat grains of CC genotype varieties (lines) is significantly higher than that of CT(Y) varieties (lines), which is the dominant haplotype that controls the accumulation of calcium ions in wheat grains. DETAILED DESCRIPTION

[0023] The present application is further explained below in conjunction with the embodiments. Before introducing the specific embodiments, some experimental backgrounds in the following embodiments are briefly introduced as follows.

[0024] Wheat materials: The wheat varieties (lines) involved in the following examples were all provided by the Wheat Research Institute of Henan Academy of Agricultural Sciences. The wheat was planted in the Modern Agricultural Science and Technology Experimental Demonstration Base of Henan Academy of Agricultural Sciences in 2017 and harvested after physiological maturity (different tissue samples at different growth stages were harvested and frozen in the laboratory for later use) and used for subsequent analysis.

[0025] It should be noted that, as a professional agricultural research institution, the applicant has long preserved relevant germplasm materials, and the relevant wheat varieties are publicly available on the market or in existing germplasm banks.

[0026] Example 1

[0027] Based on the harvest of 215 wheat grains from natural populations of different wheat varieties (lines), in order to screen for favorable genes that affect the content of trace element calcium ions in wheat grains, the inventors first tested the calcium ion content in wheat grains to preliminarily determine whether the calcium ion content phenotype differs between different varieties (lines). The specific method for detecting calcium ion content in wheat grains is briefly described as follows.

[0028] Determination of calcium ion content in wheat grains

[0029] Microwave digestion and inductively coupled plasma mass spectrometry were used to measure the calcium ion concentration in wheat grains. The specific operation is as follows.

[0030] (1) Sample pretreatment

[0031] The wheat grains were crushed with a small crusher and passed through a sieve with a pore size of 0.15 mm;

[0032] Take 0.5g of sample and put it into the microwave digestion inner tank, add 5mL nitric acid, cover and place for 1h, tighten the tank cover, and digest according to the digestion steps (120℃, 5 minutes, 150℃, 10 minutes, 190℃, 20 minutes); after cooling, ultrasonic degas for 5 minutes, dilute to 50ml with water and mix well for later use;

[0033] (2) Establishing a standard curve

[0034] The mixed standard solution is injected into an inductively coupled plasma mass spectrometer, and the signal response values ​​of calcium and the internal standard element are measured. A standard curve is drawn with the concentration of calcium as the abscissa and the ratio of the response signal value of calcium to the selected internal standard element as the ordinate;

[0035] (3) Determination of calcium ion content

[0036] The blank solution and the sample solution were injected into the inductively coupled plasma mass spectrometer respectively, and the signal response values ​​of calcium and the internal standard element were determined. The concentration of calcium in the digestion solution was obtained according to the standard curve. The measurement was repeated 3 times and the average value was taken as the measurement result.

[0037] Example 2

[0038] Based on the principle of SNP chip technology, in order to screen for target genes that cause some physiological phenotype differences in wheat, the inventors conducted further pre-screening of relevant genotype difference sites on the basis of the aforementioned natural population. The specific process is briefly described as follows.

[0039] 1. Extraction of genomic DNA from wheat leaves

[0040] The CTAB (Cetyl trimethylammonium bromide) method was used to extract wheat leaf genomic DNA. The specific operation is as follows:

[0041] Take 0.5g wheat leaf sample and freeze it in liquid nitrogen, then grind it into pieces quickly;

[0042] Add 700 μL of CTAB extraction solution and incubate in a 65°C water bath for 30 min to lyse the tissue;

[0043] After cooling to room temperature, an equal volume of chloroform:isoamyl alcohol (24:1) solution was added to extract the sample;

[0044] Centrifuge at room temperature for 5 min (12000 rpm / min), aspirate 450 μL of supernatant and transfer it to a 1.5 mL centrifuge tube;

[0045] Add an equal volume of chilled isopropanol to precipitate flocculent DNA; centrifuge for 5 min (12000 rpm / min), discard the supernatant, and obtain DNA precipitate;

[0046] 75% ethanol solution was added, rinsed twice and dried for 8 hours, and 400 μL ddH2O was added to dissolve the DNA for later use; the dissolved DNA was tested for concentration and purity using the NanoDrop™ One (Thermo Fisher Scientific, Wilmington, DE, USA) system to ensure that it met the standards for subsequent detection applications.

[0047] (II) Genotype screening and detection using SNP chips

[0048] The Axiom® Wheat 660K SNP chip (which contains more than 630,000 specific SNP sites evenly distributed throughout the wheat genome and can provide a relatively sufficient SNP marker density) is used to screen and detect genotypes of all varieties (lines) in natural populations.

[0049] 3. Genotype quality control

[0050] PLINK v1.9 software was used to perform quality control on the genotype data obtained from 215 natural populations. SNP markers with a detection rate lower than 90% and a minimum allele frequency (MAF) lower than 0.05 were eliminated. Finally, a total of 224,706 potentially significant SNP markers were obtained for further research.

[0051] Example 3

[0052] Based on the work of Examples 1 and 2, combined with the GWAS method of genome-wide association analysis, the inventors further attempted to screen and obtain SNP sites related to calcium ion accumulation in wheat grains. The specific process is briefly described as follows.

[0053] 1. Genome-wide association analysis

[0054] Combining the calcium ion content data of wheat grains of 215 different wheat varieties (lines) in Example 1 and the genotype data screened in Example 2, association analysis was performed using the GLM, MLM and FarmCPU models of the GAPIT analysis software (Genome Association and Prediction Integrated Tool). The SNP site SNP1655 located on chromosome 3D identified by the three analysis models as a stable genetic site that affects calcium ion accumulation in wheat grains, such as Figure 1 shown.

[0055] (II) Genetic marker SNP1655 (QTL qCa.hnaas-3D )

[0056] Further reference to the wheat "Chinese Spring" genome v1.1 sequence can clarify the genetic marker SNP1655 (QTL qCa.hnaas-3D ) is as follows:

[0057] GTTTTCTTCGCAAAAAAGTGCTGGTAACTCTTCCT[C / T]TTTTACATTCCCCAAGTTGCCAAATCTAGAGCTC;

[0058] That is, there is an allele mutation of 36C-36T at the 36th base of the sequence.

[0059] Combined with the sequence information, the calcium ion content of wheat grains in the natural population constructed above was further statistically analyzed. The results are shown in Tables 1 and Figure 2 shown.

[0060] Table 1. Effects of different genotypes of SNP1655 marker on calcium accumulation in wheat grains

[0061]

[0062] "Number 1 ”: The statistics do not include 8 wheat varieties (lines) with unidentified genotypes (NA) in natural populations;

[0063] "Calcium ion content 2 ”: Average calcium ion content of wheat grains of different genotypes (mg / Kg);

[0064] “P-value 2 ”: Analysis of the significance of differences between individuals with different genotypes, P<0.05 was considered significant, and P<0.01 was considered extremely significant.

[0065] From the results in the table above, we can see that the calcium ion content of wheat grains of individuals with CC genotype is significantly higher than that of individuals with CT(Y) heterozygous genotype. Therefore, it can be determined that the grains of CC genotype wheat varieties have a stronger ability to accumulate calcium ions, or in other words, CC genotype is a dominant haplotype relative to CT(Y) genotype ( Figure 2 ). SEQUENCE LISTING <110> Henan Academy of Agricultural Sciences <120> Wheat calcium ion effect site marker qCa.hnaas-3D <130> none <160> 1 <170> PatentIn version 3.5 <210> 1 <211> 71 <212> DNA <213> Triticum aestivum <400> 1 gttttcttcg caaaaaagtg ctggtaactc ttcctctttt aacattcccc aagttgccaa 60 atctagagct c 71

Claims

1. Application of wheat calcium ion effect site marker qCa.hnaas-3D in wheat grain calcium content detection, characterized in that: The calcium ion content of wheat grains was determined by testing its 36 base sites; If the 36th base of the corresponding sites of the two 3D chromosomes is C, the wheat variety belongs to the high calcium CC genotype wheat variety, and the wheat grain has a high calcium ion content; The wheat calcium ion effect site marker qCa.hnaas-3D is named as SNP1655, and its nucleotide sequence is as follows: GTTTTCTTCGCAAAAAAGTGCTGGTAACTCTTCCT[C / T]TTTTACATTCCCCAAGTTGCCAAATCTAGAGCTC; The 36th base of the genetic marker has an allele mutation of 36C-36T; the genetic marker sequence of the high calcium CC genotype is shown in SEQ ID No.

1.

2. Application of wheat calcium ion effect site marker qCa.hnaas-3D in breeding of new wheat varieties, characterized in that: Molecular marker breeding technology is used to breed new wheat varieties with high calcium content by detecting the 36th base sequence of the genetic marker; The wheat calcium ion effect site marker qCa.hnaas-3D is named as SNP1655, and its nucleotide sequence is as follows: GTTTTCTTCGCAAAAAAGTGCTGGTAACTCTTCCT[C / T]TTTTACATTCCCCAAGTTGCCAAATCTAGAGCTC; The 36th base of the genetic marker has an allele mutation of 36C-36T; the genetic marker sequence of the high calcium CC genotype is shown in SEQ ID No.1.

Images