AAV vector targeted for infection of breast cancer cells and its application

Abstract

The present invention discloses a chimeric AAV2 capsid targeting breast cancer cells, a method for constructing an AAV2 vector that targets and infects breast cancer cells, a method for using the vector to target breast cancer cells, and a method for treating breast cancer by carrying a suicide gene. The present invention uses genetic engineering techniques to insert the EC1 protein into the surface of the AAV2 capsid and into the R585 and R588 sites of the mutated VP1 protein to obtain an AAV viral vector (AAV2M-EC1). Compared with wild-type AAV2, AAV2M-EC1 has the property of targeting breast cancer cells and significantly reduces its ability to infect liver and muscle tissue. Using AAV2M-EC1 as a vector carrying the suicide gene HSV-TK, when injected into the tail vein of mice with transplanted tumors, can significantly inhibit the proliferation of breast cancer cells in mice.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to an AAV virus that targets and infects breast cancer cells and an application thereof. Background Art

[0002] Breast cancer, a malignant tumor arising in the mammary epithelium, is one of the most common malignant tumors in women. Studies report that the number of new breast cancer cases and deaths in China each year accounts for 12.2% and 9.6% of the global total, respectively, and this trend is increasing annually. Due to the complex pathological classification of breast cancer, treatment is poorly targeted and response rates vary widely. With the deepening understanding of breast cancer and the development of personalized medicine, breast cancer treatment has entered an era of comprehensive therapies, evolving a treatment model that prioritizes both local and systemic therapies. Currently, clinical practice often utilizes a combination of surgical resection, chemoradiotherapy, endocrine therapy, targeted biological therapies, and adjuvant Traditional Chinese Medicine (TCM) based on tumor stage. The toxic side effects of chemotherapeutic drugs and the development of tumor resistance remain pressing clinical challenges. Targeted tumor therapy has been a hot topic in recent years. Compared to chemotherapy, molecularly targeted therapy offers significant advantages in targeting and toxicity. Therefore, the development of drug delivery vehicles that can target breast cancer cells holds significant clinical significance for the treatment of breast cancer.

[0003] Adeno-associated virus (AAV) is a gene delivery vector with advantages such as good safety, low immunogenicity, and stable expression, and has been widely used in gene therapy. In recent years, AAV-mediated tumor gene therapy has attracted much attention. AAV has been successfully used to deliver and transduce various tumor therapeutic genes (suicide genes, anti-angiogenic genes, immune-related genes, etc.) to inhibit tumor occurrence, development, and metastasis. How to eliminate the original tissue tropism (off-target effect) of AAV2 and impart new targeting capabilities is the key to the development of breast cancer-targeted vectors. Since the AAV capsid protein determines the AAV tissue cell specificity, modification and modification of the AAV capsid protein can improve the targeting of AAV. Epithelial cell adhesion molecule (EpCAM) is a type I transmembrane glycoprotein that is mainly involved in various physiological activities such as cell proliferation, differentiation, migration, and tumor cell immune escape. Studies have reported that the expression of EpCAM in primary breast cancer tissue is more than 100 times higher than that in normal tissue. Therefore, EpCAM can be used as a potential targeting molecule for breast cancer and can be introduced into AAV viral vectors to enhance the targeting of AAV viruses. Summary of the Invention

[0004] The purpose of the present invention is to provide a novel AAV viral vector that can target and infect breast cancer cells. This is mainly achieved through a novel AAV viral vector packaging method. The specific steps are as follows:

[0005] (1) Using the AAV2 capsid plasmid pRC as a template, the pRVP1 / 3 plasmid expressing VP1 and VP3 was obtained by mutating the T138 site of the VP1 protein to A. The capsid pRVP1 / 3 DNA sequence is SEQ ID NO: 1.

[0006] (2) Using the AAV2 capsid plasmid pRC as a template, site-directed mutagenesis was performed on the VP2 protein M1 and M203 sites of the pRC plasmid to obtain the plasmid pVP2, which provides the capsid protein VP2, the DNA sequence of which is SEQ ID NO: 2;

[0007] (3) combining the plasmid pRVP1 / 3 obtained in step (1), the plasmid pVP2 obtained in step (2), pHelper, and pAAV to construct an AAV four-plasmid packaging system;

[0008] (4) The packaging system obtained in step (3) is used to package AAV virus.

[0009] In step (1), plasmid RVP1 / 3 is used as a PCR template, and the arginine at position 585 of capsid protein VP1 is mutated to alanine, and the arginine at position 588 is mutated to alanine to obtain pRVP1 / 3M plasmid. The capsid pRVP1 / 3M plasmid DNA sequence is SEQ ID NO: 3.

[0010] The pRVP1 / 3M plasmid, the plasmid pVP2 obtained in step (2), pHelper, and pAAV were combined to construct an AAV four-plasmid packaging system, and packaged into AAV virus.

[0011] In step (2), based on the pVP2 plasmid, the EC1 protein sequence is inserted into the amino terminus of the VP2 protein to obtain the pVP2-EC1 plasmid.

[0012] The EC1 protein sequence described in step (2) was obtained by Nikolas Stefan et al. through phage display technology. The DNA sequence is SEQ ID NO: 5 and the amino acid sequence is SEQ ID NO: 6.

[0013] The pRVP1 / 3M plasmid or pRVP1 / 3 plasmid, pVP2-EC1 plasmid, pHelper, and pAAV were combined to construct an AAV four-plasmid packaging system and packaged into AAV virus.

[0014] The plasmid pAAV described in step (3) is any one of pAAV-eGFP, pAAV-Luciferase, and pAAV-TK expression plasmids.

[0015] As a preferred embodiment, taking a 10 cm dish as an example, the viruses packaged in the present invention include the following:

[0016] 8 μg pVP2, 8 μg pRVP1 / 3, 10 μg pHelper and 6 μg pAAV-luciferase were used to package AAV2-LUC virus.

[0017] 8 μg pVP2, 8 μg pRVP1 / 3, 10 μg pHelper and 6 μg pAAV-TK were used to package AAV2-TK virus.

[0018] 8 μg pVP2, 8 μg pRVP1 / 3M, 10 μg pHelper and 6 μg pAAV-luciferase were used to package AAV2M-LUC virus.

[0019] 8 μg pVP2-EC1, 8 μg pRVP1 / 3M, 10 μg pHelper, and 6 μg pAAV-luciferase were used to package AAV2M-EC1-LUC virus.

[0020] 8 μg pVP2-EC1, 8 μg pRVP1 / 3M, 10 μg pHelper, and 6 μg pAAV-TK were used to package AAV2M-EC1-TK virus.

[0021] The packaged AAV viral vector was purified by centrifugation, and then Western Blotting was used to detect the expression of three components in the AAV viral capsid: VP1, VP2, and VP3, so as to evaluate the modification of the AAV virus.

[0022] The present invention uses the obtained AAV viral vector in the preparation of a drug for targeted treatment of breast cancer.

[0023] The AAV viral vector carrying the suicide gene HSV-TK is used to prepare a drug for inhibiting the proliferation of breast cancer cells. The breast cancer cells are 4T1 breast cancer cells.

[0024] The distribution of AAV2-LUC, AAV2M-LUC, and AAV2M-EC1-LUC viral vectors in mouse tissues and organs was evaluated through a targeted infection mouse transplant tumor experiment. The method was to inject AAV virus carrying luciferase through the mouse tail vein, and then use in vivo imaging of small animals to detect the distribution of AAV virus in the mouse body; the distribution of AAV virus was imaged in various organs of the mouse.

[0025] The present invention also provides an application of AAV2-EC1 virus obtained by a packaging method based on an AAV virus vector. The technical solution is to construct a pAAV-TK plasmid to replace the pAAV-luciferase plasmid, then perform virus packaging, and inject the obtained virus into tumor-bearing mice by intravenous injection. The targeting effect of AAV2M-EC1-TK on mouse breast cancer cells is evaluated by detecting the weight, tumor volume, and survival rate of the tumor-bearing mice.

[0026] Beneficial effects

[0027] The present invention transforms the pRC plasmid into pRVP1 / 3 and pVP2 plasmids, constructs the obtained two types of plasmids with the pAAV plasmid and the pHelper plasmid into a four-plasmid packaging system, and successfully packages the AAV2 virus through the four-plasmid packaging system.

[0028] Furthermore, by further mutating pRVP1 / 3 to generate the pRVP1 / 3M plasmid, and inserting the EC1 sequence into pVP2 to generate the pVP2-EC1 plasmid, these two plasmids were then combined with the pAAV and pHelper plasmids to construct a four-plasmid packaging system. This system was then used to package AAV, resulting in the AAV2M-EC1 viral vector. Compared to wild-type AAV2 viral vectors and the modified AAV2M-EC1 viral vector, the AAV2-EC1 viral vector possesses the ability to target breast cancer cells, with high infection efficiency and strong infectivity, while significantly reducing its ability to infect liver and muscle tissues. This holds great promise for the development of therapeutics for breast cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of AAV2 capsid protein modification and plasmid enzyme digestion identification diagram, where A is the modification schematic diagram and B is the enzyme digestion identification diagram, where M: DNA Marker; 1: pR-EC1-VP2 plasmid; 2: pR-EC1-VP2 plasmid digested by endonucleases Nco I and EcoRV; 3: pR-VP2 plasmid; 4: pR-VP2 plasmid digested by endonucleases Nco I and EcoRV; 5: pR-VP1,3 plasmid; 6: pR-VP1,3 plasmid digested by endonucleases Nco I and EcoRV.

[0030] Figure 2 Western blot was used to detect AAV virus capsid proteins VP1, VP2, and VP3.

[0031] Figure 3 In vivo imaging of AAV2M-EC1 virus targeted infection of 4T1 transplanted tumors.

[0032] Figure 4 Images of major tissues and organs in mice bearing 4T1 transplanted tumors after infection with AAV2M-EC1 virus.

[0033] Figure 5 This is a diagram of luciferase enzyme activity in various tissues and organs of mice.

[0034] Figure 6 This is the enzyme digestion identification diagram of pAAV-TK plasmid, which was double digested with EcoR1+Hind111.

[0035] Figure 7 Flow chart of experimental animals for AAV2M-EC1-TK gene therapy of breast cancer.

[0036] Figure 8 This is the body weight growth curve of mice after AAV2M-EC1-TK gene therapy for breast cancer.

[0037] Figure 9 This is the survival curve of mice after AAV2M-EC1-TK gene therapy for breast cancer.

[0038] Figure 10 This is a curve of the changes in tumor volume in mice after AAV2M-EC1-TK gene therapy for breast cancer.

[0039] Figure 11 This is a direct image of in vitro tumors after AAV2M-EC1-TK gene therapy for breast cancer.

[0040] Figure 12 This is a statistical chart of tumor mass in mice after AAV2M-EC1-TK gene therapy for breast cancer. DETAILED DESCRIPTION

[0041] The present invention is further described below with reference to the following examples. However, the scope of protection claimed in the present invention is not limited to the scope described in the examples.

[0042] Example 1 Construction of pRVP1 / 3 plasmid

[0043] (1) Design of mutation primers

[0044] Based on the DNA sequence of AAV2 capsid, a mutant primer was designed at the VP2 start codon to mutate the threonine T at the 138th amino acid position of VP1 to alanine A. The designed primer sequence was sent to Jinweizhi Biotechnology Co., Ltd. for synthesis.

[0045] T138-F: GAGGAACCTGTTAAGACCCTCCGGGAAAAAAGAGGCCGGT

[0046] T138-R:ACCGGCCTCTTTTTTCCCGGAGGGGTCTTAACAGGTTCCTC

[0047] (2) PCR site-directed mutagenesis of T138

[0048] AAV2 capsid plasmid pRC (kindly donated by Professor Zhang Ye of Peking Union Medical College) was used as a template and Prime STAR @ HS DNA Polymerase, combined with the primers obtained in step (1), was used for PCR amplification. The PCR reaction system is shown in Table 1, and the reaction procedure is shown in Table 2:

[0049] Table 1 PCR reaction system

[0050]

[0051] Table 2 PCR reaction procedure

[0052]

[0053]

[0054] After the PCR reaction, the PCR product was digested with Dpn I for 2 hours to digest the template plasmid. 5 μL of the digestion product was transferred into DH5α Escherichia coli competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) and spread on LB plate culture medium containing 100 mg / mL ampicillin. The cells were cultured at 37°C overnight to obtain positive colonies of the mutated plasmid pRVP1 / 3.

[0055] (3) Plasmid extraction and identification

[0056] The positive colonies obtained in step (3) were inoculated into LB culture medium containing 100 mg / mL ampicillin and cultured overnight at 37°C on a shaker. The overnight culture was centrifuged at 4000 rpm for 5 min, and the precipitate was collected. The plasmid was extracted using an endotoxin-free plasmid extraction kit purchased from Tiangen Biotechnology Co., Ltd., and double enzyme digestion (Table 3) was performed using restriction endonucleases Nde I and Xba I (purchased from Takara). DNA sequencing (Genwizhi Biotechnology Co., Ltd.) was also used for identification. The results are shown in Table 3. Figure 1 B, Two bands of 1000 bp and 6200 bp appeared after double enzyme digestion, indicating that the pRVP1 / 3 plasmid was successfully constructed.

[0057] Table 3 Double enzyme digestion detection system

[0058]

[0059] Example 2 Construction of pVP2 plasmid

[0060] The steps and methods were the same as those in Example 1, except for the site-directed mutagenesis primers, mutation sites, and plasmids.

[0061] The methionine at the 1st and 203rd amino acid positions of the VP2 protein were site-directedly mutated to alanine using the following primers:

[0062] M1-F: AATGATTTAAATCAGGTCTGGCTGCCGATGGTTAT

[0063] M1-R: ATAACCATCGGCAGCCAGACCTGATTTAAATCATT

[0064] M203-F: GTCTGGGAACTAATACGCTGGCTACAGGCAGTGGC

[0065] M203-R: GCCACTGCCTGTAGCCAGCGTATTAGTTCCCAGAC

[0066] See attached for the results Figure 1 B, Two bands of 1000 bp and 6200 bp appeared after double enzyme digestion. DNA sequencing confirmed that the methionine at the 1st and 203rd amino acid sites were site-directed mutated to alanine, indicating that the pVP2 plasmid was successfully constructed.

[0067] Example 3 Construction of pVP2-EC1 plasmid

[0068] (1) Design of homologous recombination primers:

[0069] AAV2-F: CATAGGTTCCTCAACCAGCTT

[0070] AAV2-R:GCTCCGGGAAAAAAGAGGCCGPCR

[0071] (2) PCR amplification of plasmid pVP2:

[0072] The pVP2 plasmid obtained in Example 2 was used as a template and the primers designed in step (1) were used for PCR amplification to obtain a linearized pVP2 plasmid. The PCR amplification system was the same as that in Example 1.

[0073] (3) Synthesis of EC1 sequence and its primers

[0074] The DNA sequence of EC1 is SEQ ID NO: 1, and the amino acid sequence is SEQ ID NO: 2. Primers were designed based on the EC1 sequence. Both the EC1 sequence and primer sequences were synthesized by GeneWeichi Biotechnology Co., Ltd.:

[0075] EC1-F:GTTAAGCTGGTTGAGGAA

[0076] EC1-R:TACCGGCCTCTTTTTTCC

[0077] The EC1 gene was amplified using PCR technology, and the reaction system and procedure were the same as in Example 1.

[0078] (4) PCR product purification and recombination

[0079] The PCR products obtained in step (2) and step (3) were separated by gel electrophoresis, and then the gel blocks containing the target bands were cut out and recovered using a DNA gel kit (purchased from Tiangen Biochemical Technology Co., Ltd.). The recovered products pVP2 and EC1 were mixed in a molar ratio of 1:3 and homologous recombination was performed. The homologous recombination kit was purchased from Beijing Quanshijin Biotechnology Co., Ltd. The reaction system was as follows:

[0080]

[0081] Gently mix the reaction system and incubate at 50°C for 15 minutes. After the reaction is complete, place the centrifuge tube on ice for a few seconds before using the recombinant product for transformation and amplification.

[0082] 5 μL of the above recombinant product was added to DH5α competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), gently mixed and placed on ice for 15 minutes, heat-shocked at 42°C for 60 seconds and then quickly placed on ice for 2 minutes, added 400 μL of room temperature LB culture medium, and cultured at 37°C on a shaker for 1 hour. 100 μL of cells were evenly spread on a plate and cultured at 37°C on a shaker overnight. Positive clones were picked, and plasmids were extracted and sequenced and double enzyme digestion was performed for verification. The results are shown in Figure 1B, Two bands of 1000 bp and 6600 bp appeared after double enzyme digestion, indicating that the pVP2-EC1 plasmid was successfully constructed.

[0083] Example 4 Construction of pRVP1 / 3M capsid expression plasmid

[0084] The method and steps were the same as those in Example 1, except that the template was changed to the plasmid pRVP1 / 3 obtained in Example 1, and primers were designed to mutate the arginine R at amino acid positions 585 and 588 of the capsid protein VP1 to alanine A. The primer sequences were:

[0085] MF:TCTGTATCTACCAACCTCCAGGCAGGCAACGCACAAGCAGCTACCGCAGATGTC

[0086] MR: GACATCTGCGGTAGCTGCTTGTGCGTTGCCTGCCTGGAGGTTGGTAGATACAGA;

[0087] After the PCR site-directed mutagenesis, the plasmid was identified by DNA sequencing, and the pRVP1 / 3M plasmid with mutations at R585 and R588 sites was successfully constructed.

[0088] Example 5 Packaging and purification of recombinant adeno-associated virus

[0089] (1) HEK293T cells were cultured in DMEM medium (purchased from Thermo Fisher Scientific) containing 10% fetal bovine serum (purchased from Biological Industries) and cultured in a cell culture incubator at 37°C and 5% CO2 until the logarithmic growth phase. The cells were collected and counted. The cells were seeded in a 10 cm diameter cell culture dish at a seeding size of 4 × 10 6 cells and continue culturing for 20 hours until the cell density reaches 80-90%; fresh cell culture medium should be replaced 4 hours before virus packaging.

[0090] (2) Virus packaging

[0091] 8 μg pVP2, 8 μg pRVP1 / 3, 10 μg pHelper and 6 μg pAAV-luciferase were used to package AAV2-LUC virus.

[0092] 8 μg pVP2, 8 μg pRVP1 / 3M, 10 μg pHelper and 6 μg pAAV-luciferase were used to package AAV2M-LUC virus.

[0093] 8 μg pVP2-EC1, 8 μg pRVP1 / 3M, 10 μg pHelper, and 6 μg pAAV-luciferase were used to package AAV2M-EC1-LUC virus.

[0094] Among them, pVP2 was prepared in Example 2, pRVP1 / 3 was prepared in Example 1, pVP2-EC1 was prepared in Example 3, and pRVP1 / 3M was prepared in Example 4. pHelper was purchased from the Addgene website, and pAAV-luciferase was donated by Professor Zhang Ye of Peking Union Medical College.

[0095] The above plasmids were added to 500 μL serum-free DMEM medium (Solution A), mixed gently, and then allowed to stand for 5 minutes;

[0096] (3) Add 13 μL of Imafect transfection reagent (purchased from Beijing Mayin Technology Co., Ltd.) to 500 μL of serum-free DMEM medium (Solution B), mix gently, and let it stand for 5 minutes. Gently add a drop of Solution B to Solution A, let it stand for a few seconds, then gently mix. The mixture is allowed to stand for 15 minutes.

[0097] (4) Add the mixture dropwise into the cell culture dish and mix gently. Replace with fresh cell culture medium after 6 hours. After the cell culture medium turns yellow, replace the medium and collect the supernatant. After 72 hours of culture, use 600 μL PBS (8.0 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4, 0.24 g KH2PO4 are weighed and dissolved in 800 mL distilled water, and the solution is adjusted to 7.4 with HCl. Finally, distilled water is added to make up to 1 L. After high-pressure sterilization, store at 4°C) to gently blow off the adherent cells in the dish and store in a -80°C refrigerator for later use.

[0098] (5) The packaged AAV virus obtained in step (2) was taken out and repeatedly frozen and thawed three times between -80°C and 37°C, and the precipitate was vortexed each time to allow for better release of the virus from the cells;

[0099] (6) 100 U of universal nuclease (purchased from Shanghai Yisheng Biotechnology Co., Ltd.) was used to incubate the cells that had been frozen and thawed three times at 37°C for 2 h, and then centrifuged at 10,000 rpm for 10 min to collect the supernatant;

[0100] (7) Gently add 15% (3 mL), 25% (2 mL), 40% (2 mL), and 60% (1 mL) density gradient iodixanol (Table 4) from top to bottom in a 10 mL ultracentrifuge tube. After each layer stabilizes, slowly add the supernatant obtained in step (6) to the top layer and centrifuge at 40,000 rpm for 4 h.

[0101] (8) The target virus is present at the location of 40% iodixanol. The liquid in the layer where the target virus is located (40% iodixanol) is aspirated and added to a 10,000 kDa filter tube. The filter tube is filled with PBS and centrifuged at 3,000 rpm for 4 minutes. Repeat the centrifugation to remove the iodixanol and concentrate the target virus. The concentrated virus is stored in a -80°C refrigerator for later use.

[0102] Table 4 Iodixanol solution formulas of different concentrations

[0103]

[0104] 60% iodixanol stock solution was purchased from Stem Cell Company;

[0105] 10×PBS-MK: 10×100 mL PBS solution + 0.2 g MgCl2·6H2O + 0.19 g KCl, dissolved;

[0106] 0.5% phenol red: Weigh 0.1 g of phenol red powder into 20 mL of 50% ethanol and heat to dissolve.

[0107] Example 6 Western Blotting Detection of Protein-Expressing AAV Virus

[0108] (1) Take 20 μL of the virus obtained in Example 5, add 5 μL of protein preparation buffer (purchased from Thermo Fisher Scientific), and boil the sample in boiling water at 100°C for 7 minutes. Immediately place the sample on ice to obtain an AAV virus sample, which was stored at -20°C.

[0109] (2) 20 μL of the AAV sample obtained in step (1) was subjected to 10% SDS-PAGE electrophoresis at a constant voltage of 80 V. After the electrophoresis, the PAGE gel was removed and transferred to a membrane at a constant current of 300 mA for 90 min.

[0110] (3) The PVDF membrane (purchased from Merck Millipore) after protein sample transfer was placed in 5% milk prepared in 1×TBST (2.42 g Tris-base, 8.80 g NaCl dissolved in 900 mL ddH2O, 500 μL Tween-20 added, pH adjusted to 7.40, and the volume was adjusted to 1000 mL) and blocked on a shaker at room temperature for 1 h. After blocking was complete, the milk was discarded and TBST was added to the membrane several times and shaken at room temperature for 7 min to wash away the residual milk.

[0111] (4) Place the PVDF membrane in 3% BSA-containing anti-CAP antibody (1:1000) (purchased from American Research Products) and incubate on a shaker at 4°C overnight. The next day, rinse with TBST several times to remove the primary antibody. Place the PVDF membrane in 3% BSA-containing anti-mouse IgG (1:2000) (purchased from Proteintech) and incubate on a shaker at room temperature for 1 hour. Rinse three times with TBST and observe the results after ECL color development.

[0112] See the results Figure 2 Like the unmodified AAV, the modified AAV2-EC1 virus has obvious capsid protein bands. However, since the EC1 protein was inserted into VP2 in the experimental design, the position of the VP2-EC1 protein has changed and is located above VP1. This result fully demonstrates that the present invention successfully inserts the EC1 sequence into VP2, and the VP2 inserted with the EC1 sequence can be assembled into AAV virus in cells together with VP1 and VP3.

[0113] Example 9

[0114] (1) 4T1 cells were passaged one day before subcutaneous tumor loading, retaining 1 / 2 of the original cell number in the dish;

[0115] (2) The next day, when the cell confluence reached about 80%, the adherent cells were digested with trypsin, and DMEM cell culture medium containing serum was added to terminate the digestion. The cells were centrifuged at 800 rpm for 3 min, the supernatant was discarded, and PBS was added to fully resuspend the cells into single cells.

[0116] (3) Count the cells using a cell counting plate and inoculate 2.5×10 cells subcutaneously on the back of each mouse. 5 The number of cells was 100 μL, and the total volume was 75 μL for tumor loading. After the tumor loading was completed, the mice were returned to the cage and raised normally for about one week.

[0117] (4) The tumor volume of the tumor-bearing model mice was measured, and local skin hair removal was performed when the tumor diameter was about 3 mm;

[0118] (5) Eighteen mice were randomly divided into three groups: AAV2-LUC group, AAV2M-LUC group, and AAV2M-EC1-LUC group, with 6 mice in each group;

[0119] (6) 1×10 11vg virus was injected into tumor-bearing mice. Seven days later, each mouse was intraperitoneally injected with luciferase substrate Luciferin at a dose of 1.5 mg / 10 g, i.e., a 20 g mouse was intraperitoneally injected with 100 μL of 30 mg / mL Luciferase substrate working solution. Luciferase substrate working solution was purchased from Shanghai Yisheng Biotechnology Co., Ltd.

[0120] (7) Within 10-12 minutes after the injection of luciferase substrate, the distribution of AAV virus in mice was observed using an animal live imaging device. The results are shown in Figure 4 In the AAV2-LUC group, the fluorescence was mainly distributed in the liver; in the AAV2M-LUC group, the fluorescence was mainly distributed in the back muscles, and the liver fluorescence signal was significantly weakened; in the AAV2M-EC1-LUC group, the fluorescence signal was mainly distributed in the tumor site. These results indicate that the AAV2M-EC1 virus designed in this invention has significantly enhanced its targeting ability to breast cancer, and that the AAV2M-EC1 virus can effectively target breast cancer cells in mice.

[0121] (8) After obtaining the in vivo imaging results of individual small animals, the mice were immediately dissected and the individual organ tissues were imaged in vivo. The time from substrate injection to the end of imaging should not exceed 25 minutes. The imaging results of the main tissues and organs of mice are shown in Figure 5 The results showed that the fluorescence of mice in the AAV2-LUC group was mainly distributed in the liver; the fluorescence of mice in the AAV2M-LUC group was slightly enriched in tumors and muscle tissues; the fluorescence signal of mice in the AAV2M-EC1-LUC group was mainly distributed in the tumor site, and almost no fluorescence signal was detected in other tissues and organs. This result shows that the AAV2M-EC1 virus designed by the present invention has the strongest ability to infect breast cancer and can effectively target breast cancer cells in mice.

[0122] (9) After imaging, take about 100 mg of tissue, wash each tissue in an EP tube containing 1 mL of PBS, centrifuge at 3000 rpm for 3 minutes, add the precipitate to a homogenization tube containing 400 μL of RIPA lysis buffer (purchased from Beijing Solebau Technology Co., Ltd.), add 6 small ceramic beads, and place it in an electric homogenizer for homogenization: homogenize for 10 seconds, rest for 10 seconds, for a total of 3 times. If large pieces of tissue still exist after homogenization for 3 times, continue to homogenize for 1-2 rounds, incubate the homogenized suspension on ice for 10 minutes, and mix it on an oscillator for a total of three times. Centrifuge at 12000 rpm for 10 minutes to obtain the supernatant;

[0123] (10) Transfer the supernatant obtained in step (9) to a new EP tube, then adjust the concentration of mouse tissue total protein to a consistent 25 μg / μL, a total of 20 μL, and add it to the assay tube to prepare fresh luciferase substrate working solution: dilute the Luciferin substrate 50 times and mix it in the detection buffer, store it in the dark; turn on the fluorescence detector in a dark room. Add 50 μL of substrate reaction solution to each assay tube, mix it quickly, and detect it on the machine after 10 seconds to obtain the enzyme activity value of Luciferase in each tissue organ. The results are shown in the attached Figure 6 The results showed that AAV2-LUC was distributed in tumors, liver and muscle tissues, but mainly in liver tissues; due to mutations in the R585 and R588 sites in the viral capsid protein, the ability of AAV2M-LUC to infect various tissues of mice was weakened; and due to the insertion of EC1 protein, AAV2M-EC1-LUC mainly infects tumor cells, and its ability to infect liver and muscle tissues was significantly lower than that of the other two viruses. Therefore, the AAV2M-EC1-LUC virus has the best targeting effect on breast cancer cells.

[0124] Example 10 Construction of pAAV-TK plasmid

[0125] The TK coding sequence was synthesized by Genewise Biotech and directly constructed into the pAAV vector. The 5′ end restriction site is EcoR1 and the 3′ end restriction site is Hind111. After the pAAV-TK plasmid was digested with EcoR1+Hind111, it was separated by 1% agarose gel electrophoresis, and two restriction fragments of 1200 bp and 5000 bp were observed ( Figure 6 The results were consistent with expectations. DNA sequencing of the recombinant plasmids that were positive for enzyme digestion confirmed that the inserted sequence in the plasmid was correct and the reading frame docking was correct.

[0126] Example 11 Packaging of AAV virus containing suicide gene TK

[0127] The steps and methods were the same as those in Example 5, except that the packaging plasmids were changed, wherein pVP2 was prepared in Example 2, pVP2-EC1 was prepared in Example 3, pRVP1 / 3 was prepared in Example 1, pRVP1 / 3M was prepared in Example 4, and pAAV-TK was prepared in Example 10.

[0128] pVP2, pRVP1 / 3, pHelper, and pAAV-TK were used to package AAV2-TK virus;

[0129] pVP2, pRVP1 / 3M, pHelper, and pAAV-TK were used to package AAV2M-TK virus;

[0130] pVP2-EC1, pRVP1 / 3M, pHelper, and pAAV-TK were used to package AAV2M-EC1-TK virus.

[0131] Example 12 AAV virus mediates suicide gene TK therapy for tumors in mice

[0132] (1) Measure the tumor size of the tumor-bearing model mice, and perform local skin depilation when the tumor size is approximately 3 mm;

[0133] (2) Eighteen mice were randomly divided into three groups: AAV2-TK group, AAV2M-TK group, and AAV2M-EC1-TK group, with 6 mice in each group.

[0134] (3) 1×10 11 vg virus was injected into tumor-bearing mice. 48 h later, each mouse was intraperitoneally injected with 100 mg / kg of ganciclovir GCV (purchased from Selleck). The experimental design is shown in Figure 7 ;

[0135] (4) Within 12 days after the first injection of GCV, 100 mg / kg of GCV was injected intraperitoneally every 24 hours; the weight of the mice was recorded. The changes in the weight of the mice are shown in Figure 8 The results showed that overall, there was no significant difference in the body weight of mice in the AAV2-TK, AAV2M-TK, and AAV2M-EC1-TK groups. The long diameter a and short diameter b of the mouse tumor were recorded regularly, and the formula V=ab was used to calculate the long diameter a and short diameter b of the mouse tumor. 2 / 2 to calculate tumor volume. Figure 10 The tumor volume of mice in the AAV2-TK and AAV2M-TK groups gradually increased over time, while the tumor volume in the AAV2M-EC1-TK group was significantly smaller than that in the above two groups, indicating that AAV2M-EC1-TK injection effectively inhibited the proliferation of breast cancer cells.

[0136] according to Figure 9 The mouse survival curve showed that mice in the AAV2-TK group died on the 6th day after virus injection, and mice in the AAV2M-TK group died on the 5th and 6th days after injection. This may be because the AAV2-TK and AAV2M-TK viruses have weak tumor targeting capabilities. After entering the mouse body, the virus mainly infects its major organs and tissues, resulting in off-target effects, thus causing the suicide gene to kill normal cells and thus cause death. However, mice in the AAV2M-EC1-TK group never died. This experiment further shows that the AAV2M-EC1-TK virus has a strong targeting ability for breast cancer cells and causes less damage to mice.

[0137] After 10 days of continuous intraperitoneal injection of GCV, the tumor proliferation of mice in the AAV2M-EC1-TK group was significantly inhibited. On the 12th day after GCV injection, the tumors of mice in each group were surgically removed, measured and weighed. The results are shown in Figure 10 、 Figure 11 and Figure 12 The tumor diameter of the AAV2-TK group was 10-12 mm, the tumor diameter of the AAV2M-TK group was 10-12 mm, and the tumor diameter of the mice in the AAV2M-EC1-TK group was smaller, with an average diameter of 5-7 mm; the tumor mass of the AAV2-TK group was 0.5 g, the tumor mass of the AAV2M-TK group was 0.3 g, and the tumor mass of the mice in the AAV2M-EC1-TK group was about 0.15 g, which was statistically different, indicating that the proliferation of mouse breast cancer cells was significantly inhibited after injection of AAV2M-EC1-TK. Sequence Listing <110> China Three Gorges University <120> AAV vector targeted for infection of breast cancer cells and its application <160> Total number 6 <210> 1 <211> 2208 <212> DNA <213> Artificial sequence <223> VP1 / 3 DNA <400> SEQ ID NO: 1 <210> 2 <211> 2208 <212> DNA <213> Artificial sequence <223> pVP2 <400> SEQ ID NO: 2 <210> 3 <211> 2207 <212> DNA <213> Artificial sequence <223> VP1 / 3M <400> SEQ ID NO: 3 <210> 4 <211> 2745 <212> DNA <213> Artificial sequence <223> VP2-EC1 <400> SEQ ID NO: 4 <210>5 <211>537 <212>DNA <213>Artificial sequence <223>EC1 <400>SEQ ID NO: 5 ATGGACCTGGGCAAGAAGCTGCTGGAGGCCGCTAGAGCCGGCCAAGACGACGAGGTGAGAATCCTGGTGGCCAACGGCGCCGACGTCAACGCCTACTTCGGTACCACACCGCTACACCTTGCGGCTGCTCACGGCAGACTTGAGATAGTGGAAGTTCTGTTGAAGAATGGAGCTGACGTCAACGCGCAAGACGTGTGGGGCATCACGCCCCTGCACTTAGCCGCATACAATGGACACCTGGAGATCGTGGAAGTCCTGCTGAAGTATGGAGCCGACGTAAACGCACACGACACAAGAGGCTGGACTCCCCTGCACCTGGCCGCCATCAACGGCCACCTGGAAATAGTTGAGGTGCTGCTCAAGAATGTAGCCGACGTAAATGCGCAAGACAGAAGCGGCAAGACCCCCTTCGACCTGGCCATCGACAACGGCAACGAGGACATCGCCGAGGTGCTGCAGAAGGCCGCCAAGCTGAACGGCGGCGGCGGCAGC GGCGGCGGCGGATCC GGCGGCGGCGGATCCGGCGGCGGCGGATCC <210>6 <211>179 <212>Amino acid sequence <213>Artificial sequence <223>EC1 <400>SEQ ID NO: 6 MDLGKKLLEAARAGQDDEVRILVANGADVNAYFGTTPLHLAAAHGRLEIVEVLLKNGADVNAQDVWGITPLHLAAYNGHLEIVEVLLKYGADVNAHDTRGWTPLHLAAINGHLEIVEVLLKNVADVNAQDRSGKTPFDLAIDNGNEDIAEVLQKAAKLNGGGGSGGGGSGGGGSGGGGS

Claims

1. A method for packaging an AAV viral vector, characterized in that: The specific steps include: (1) Using the AAV2 capsid plasmid pRC as a template, the pRVP1 / 3 plasmid expressing VP1 and VP3 was obtained by mutating the T138 site of the VP1 protein to A. The capsid VP1 / 3 DNA sequence is SEQ ID NO: 1; Plasmid RVP1 / 3 was used as a PCR template to mutate the arginine at position 585 of the capsid protein VP1 to alanine, and the arginine at position 588 to alanine to obtain the pRVP1 / 3M plasmid. The capsid VP1 / 3M DNA sequence is SEQ ID NO: 3; (2) Using the AAV2 capsid plasmid pRC as a template, the VP2 protein M1 and M203 sites of the pRC plasmid were site-directedly mutagenized to alanine to obtain the plasmid pVP2, which provides the capsid protein VP2, and its DNA sequence is SEQ ID NO:

2. Based on the pVP2 plasmid, the EC1 protein sequence was inserted into the amino terminus of the VP2 protein to obtain the pVP2-EC1 plasmid, and the VP2-EC1 DNA sequence is SEQ ID NO:

4. (3) The plasmid pRVP1 / 3M obtained in step (1), the plasmid pVP2-EC1 obtained in step (2), pHelper, and pAAV were combined to construct an AAV four-plasmid packaging system; (4) The packaging system obtained in step (3) is used to package AAV virus.

2. The packaging method of an AAV viral vector according to claim 1, characterized in that: The DNA sequence of EC1 described in step (2) is SEQ ID NO: 5, and the amino acid sequence is SEQ ID NO:

6.

3. The packaging method of an AAV viral vector according to claim 1, characterized in that: The plasmid pAAV in step (3) is any one of pAAV-Luciferase and pAAV-TK expression plasmids.

4. Use of an AAV viral vector carrying the suicide gene HSV-TK prepared according to the packaging method of any one of claims 1 to 3 in the preparation of a drug for targeted treatment of breast cancer, characterized in that: Inhibit breast cancer cell proliferation.

5. The use according to claim 4, characterized in that The breast cancer cells are 4T1 breast cancer cells.

Images