Novel coronavirus 2019-nCoV nucleic acid detection kit
By designing multiple detection primer and probe combinations, combined with an internal standard quality control system, the problem of insufficient sensitivity and specificity of single-target detection reagents in existing technologies has been solved, achieving efficient and specific detection of the novel coronavirus 2019-nCoV and significantly improving the accuracy of virus identification.
Patent Information
- Application Number
- CN202080095688.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-02-05
- Filing Date
- 2020-12-30
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2040-12-30
AI Technical Summary
Existing nucleic acid detection technologies are mostly single-target detection reagents, lacking the ability to detect multiple genes simultaneously, and have problems with insufficient detection sensitivity and specificity, making it difficult to effectively identify the novel coronavirus 2019-nCoV.
A primer pair set and probe combination for multiplex detection of 2019-nCoV nucleic acid was designed, including specific primers and fluorescent probes, for multiplex PCR detection. Combined with an internal standard quality control system, the accuracy and reliability of the detection are ensured.
It achieves efficient, specific and low-cost detection of the novel coronavirus 2019-nCoV, and can simultaneously detect multiple target genes, preventing false positives and false negatives, thus improving the accuracy of virus identification.
Smart Images

Figure CN115052996B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biotechnology and molecular diagnostics. Specifically, this invention relates to primer-probe combinations and kits for detecting the novel coronavirus 2019-nCoV. Background Technology
[0002] Coronaviruses belong to the genus Coronavirus within the family Coronaviridae in systematic classification. Coronaviruses are enveloped, positive-sense, single-stranded RNA viruses, approximately 80–120 nm in diameter. Their genetic material is the largest of all RNA viruses, infecting humans, mice, pigs, cats, dogs, wolves, chickens, cattle, and avian vertebrates. One variant of coronavirus is the pathogen causing SARS (Severe Acute Respiratory Syndrome), which is also an RNA virus. Viral particles range in diameter from 60–200 nm, with an average diameter of 100 nm, and are spherical or elliptical in shape, exhibiting pleomorphism. Viruses have an envelope with spikes, giving the entire virus a corona-like appearance. The spikes of different coronaviruses show significant differences. Currently, seven coronaviruses are known to infect humans: HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV, MERS-CoV, and the novel coronavirus 2019-nCoV.
[0003] The novel coronavirus 2019-nCoV (SARS-CoV-2) belongs to the β genus. It is enveloped, and its particles are round or oval, often pleomorphic, with a diameter of 60-140 nm. Its genetic characteristics are significantly different from those of SARSr-CoV and MERSr-CoV.
[0004] The novel coronavirus 2019-nCoV is a newly discovered virus (gene sequence can be found in GISAID: BetaCov / Wuhan / WH01 / 2019|EPI_ISL_406798). Currently, the diagnosis of this virus mainly relies on clinical symptoms, viral isolation and culture, and viral nucleic acid detection technology. Clinical symptoms can be used to preliminarily determine suspected cases, but a positive nucleic acid test is required for confirmation. Culture methods have high specificity and sensitivity, but clinical testing is time-consuming and cumbersome, making them unsuitable for large-scale testing. Real-time fluorescent PCR technology involves adding a pair of primers and a specific fluorescent probe to the nucleic acid reaction tube. The probe is labeled with a reporter fluorescent group and a quencher fluorescent group at both ends. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group. During PCR amplification, the probe binds to one single strand of DNA. The Taq polymerase's 5'-3' exonuclease activity cleaves and degrades the probe, separating the reporter and quencher fluorescent groups. The fluorescence monitoring system then receives the fluorescent signal; that is, one fluorescent molecule is formed for each DNA strand amplified, achieving complete synchronization between the accumulation of the fluorescence signal and the formation of the PCR product. Fluorescent PCR is a nucleic acid detection technique with higher sensitivity, specificity, and precision. Its detection results are accurate and highly reproducible, reflecting changes in pathogens, while avoiding the post-processing problems required by traditional PCR and reducing the possibility of contamination.
[0005] While some nucleic acid detection kits based on real-time quantitative PCR technology are currently available on the market, most are single-target detection kits, lacking the ability to simultaneously detect multiple genes for viral confirmation. Furthermore, the performance of these kits varies significantly, hindering viral detection and diagnosis. Therefore, developing a highly sensitive, specific, and reproducible product for the nucleic acid detection of the novel coronavirus 2019-nCoV is essential. Summary of the Invention
[0006] The purpose of this invention is to provide a novel coronavirus 2019-nCoV nucleic acid detection kit so as to enable high-efficiency, high-specificity and low-cost detection of patients infected with the novel coronavirus 2019-nCoV.
[0007] In a first aspect of the invention, a primer pair set for multiplex detection of the novel coronavirus 2019-nCoV nucleic acid is provided, the primer pair set comprising:
[0008] The first primer pair set includes:
[0009] Forward primers as shown in SEQ ID NO.1; and reverse primers as shown in SEQ ID NO.2.
[0010] In another preferred embodiment, the primer pair set further includes:
[0011] The second primer pair set includes:
[0012] Forward primers as shown in SEQ ID NO.4; and reverse primers as shown in SEQ ID NO.5.
[0013] In another advantage
[0014] In the selected example, the primer pair set further includes:
[0015] The third primer pair set includes:
[0016] Forward primers as shown in SEQ ID NO.7; and reverse primers as shown in SEQ ID NO.8.
[0017] In another preferred embodiment, the primer pair set further includes:
[0018] An internal standard primer pair set, comprising:
[0019] Forward primers as shown in SEQ ID NO.10; and reverse primers as shown in SEQ ID NO.11.
[0020] In a second aspect, the present invention provides a probe kit for multiplex detection of the nucleic acid of the novel coronavirus 2019-nCoV, the probe kit comprising a first probe with a nucleotide sequence as shown in SEQ ID NO.3.
[0021] In another preferred embodiment, the probe set further includes a second probe with a nucleotide sequence as shown in SEQ ID NO.6.
[0022] In another preferred embodiment, the probe set further includes a third probe with a nucleotide sequence as shown in SEQ ID NO.9.
[0023] In another preferred embodiment, the probe set further includes an internal control probe with a nucleotide sequence as shown in SEQ ID NO.12.
[0024] In another preferred embodiment, the 5' end of each probe contains a fluorescent reporter group; and / or, the 3' end of each probe contains a fluorescent quencher group.
[0025] In another preferred embodiment, the fluorescent reporter groups labeled on each probe are different.
[0026] A third aspect of the present invention provides a kit for multiplex detection of the novel coronavirus 2019-nCoV nucleic acid, the kit comprising the primer pair set described in the first aspect of the present invention.
[0027] In another preferred embodiment, the kit further includes the probe set described in the second aspect of the present invention.
[0028] In another preferred embodiment, the kit includes a first container containing a primer-probe mixture containing the polynucleotide sequences shown in SEQ ID NO. 1-9.
[0029] In another preferred embodiment, the kit includes a first container containing a primer-probe mixture, the primer-probe mixture further containing the polynucleotide sequences shown in SEQ ID NO. 10-12.
[0030] In another preferred embodiment, the primer-probe mixture is prepared using a PCR buffer.
[0031] In another preferred embodiment, the kit further includes a second container containing a PCR enzyme system, the PCR enzyme system including a hot-start enzyme and reverse transcriptase M-MMLV; preferably, it also includes an RNase inhibitor.
[0032] In another preferred embodiment, the kit further includes a third container containing a positive control sample.
[0033] In another preferred embodiment, the kit further includes a fourth container containing a negative control sample.
[0034] A fourth aspect of the present invention provides a method for multiplex detection of novel coronavirus 2019-nCoV nucleic acid, the method comprising the steps of:
[0035] (1) Provide nucleic acid samples from the individuals to be tested;
[0036] (2) Prepare the PCR reaction system and perform PCR detection:
[0037] The PCR reaction system includes: the nucleic acid sample provided in step (1), the primer pair set described in the first aspect of the present invention, and the probe set described in the second aspect of the present invention.
[0038] In another preferred embodiment, the nucleic acid sample may be derived from a pharyngeal swab sample, a bronchoalveolar lavage fluid sample, a blood sample, or an environmental sample.
[0039] In another preferred embodiment, the method is a detection method for non-diagnostic purposes.
[0040] In another preferred embodiment, the PCR reaction system further includes a positive control and / or a negative control.
[0041] In another preferred embodiment, the PCR reaction system further includes a PCR enzyme system.
[0042] A fifth aspect of the present invention provides the use of the primer pair set described in the first aspect of the present invention and / or the probe set described in the second aspect of the present invention for preparing a PCR detection kit for detecting the nucleic acid of the novel coronavirus 2019-nCoV.
[0043] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description
[0044] Figure 1 : N gene detection limit;
[0045] Figure 2 ORF1ab gene detection limit test;
[0046] Figure 3 E-gene detection limit test;
[0047] Figure 4 Internal standard test results;
[0048] Figure 5 Specificity test results;
[0049] Figure 6 Specific detection of internal standard test results;
[0050] Figure 7 .N gene precision detection results;
[0051] Figure 8 .ORF1ab gene precision detection results;
[0052] Figure 9 .E gene precision test results;
[0053] Figure 10 .N gene interference detection results;
[0054] Figure 11 .ORF1ab gene interference detection results;
[0055] Figure 12 .E gene interference detection results;
[0056] Figure 13 Clinical sample test results;
[0057] Figure 14 Detection results of the ORF1ab gene control primer pair;
[0058] Figure 15Detection results of the .ORF1ab gene control primer pair. Detailed Implementation
[0059] Through extensive and in-depth research, the inventors have developed a kit and method for multiplex detection of the novel coronavirus 2019-nCoV nucleic acid. This kit can simultaneously detect three nucleic acid targets of the novel coronavirus 2019-nCoV. It can prevent false positives by cross-validating different targets and confirm missed detections that may be caused by mutations, thus significantly improving the accuracy of virus identification.
[0060] Before describing this invention, it should be understood that the invention is not limited to the specific methods and experimental conditions described, as such methods and conditions can be varied. It should also be understood that the terminology used herein is intended only to describe particular embodiments and is not intended to be limiting; the scope of the invention will be limited only by the appended claims.
[0061] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. As used herein, when referring to a specifically enumerated numerical value, the term “about” means that the value can vary from the enumerated value by no more than 1%. For example, as used herein, the expression “about 100” includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
[0062] While any methods and materials similar to or equivalent to those described herein may be used in the implementation or testing of this invention, preferred methods and materials are exemplified herein.
[0063] Multiplex PCR
[0064] Multiplex PCR, also known as multiple primer PCR or complex PCR, is a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to amplify multiple nucleic acid fragments at the same time. Its reaction principle, reaction reagents and operation process are the same as those of general PCR.
[0065] There are many factors that affect multiplex PCR reactions, such as:
[0066] (1) Imbalance in the reaction system: Imbalance in the reaction system leads to rapid amplification of certain dominant primers and their templates in the early rounds of reaction, resulting in a large amount of amplification products. These amplification products are also good inhibitors of DNA polymerase. Therefore, as a large amount of amplification products appear, the polymerization ability of polymerase is increasingly inhibited. As a result, primers and templates that were initially at a disadvantage become even more difficult to react, ultimately leading to a very small amount of amplification products that cannot be detected.
[0067] (2) Primer specificity: If the primer has a stronger binding affinity to other non-target gene fragments in the system, then the ability of the target gene to bind to the primer will be subject to competition, which will lead to a decrease in amplification efficiency.
[0068] (3) The optimal annealing temperature is inconsistent. Multiple pairs of primers are placed in one system for amplification. Since the annealing temperature for PCR reaction is the same, the optimal annealing temperature of each pair of primers is required to be close.
[0069] (4) Primer dimers, including dimers between primers and hairpin structures formed by the primers themselves, and third-party DNA-mediated dimers. These dimers, like non-specific primers, will interfere with the competition between the primer and the target binding site and affect the amplification efficiency.
[0070] While several factors affecting amplification efficiency have been mentioned above, many more remain unclear. To date, there is no effective method to definitively predict amplification efficiency.
[0071] This invention provides an oligonucleotide sequence combination for specifically detecting the N, ORF1ab, and E genes of the novel coronavirus 2019-nCoV in a sample, and a kit containing this combination.
[0072] The primer sequences used for N gene amplification are as follows:
[0073] SEQ ID NO.1: AAGAAATTCAACTCCAGGCAGC and SEQ ID NO.2: GCTGGTTCAATCTGTCAAGCAG,
[0074] The corresponding detection probe sequence is SEQ ID NO.3:TCACCGCCATTGCCAGCCA;
[0075] The primer sequences used for ORF1ab amplification are as follows:
[0076] SEQ ID NO.4:TTATCACCCGCGAAGAAG and SEQ ID NO.5:TCTAGTAGCATGACACCCCT,
[0077] The corresponding detection probe sequence is SEQ ID NO.6: TAAGACATGTACGTGCATGGATTGGC;
[0078] The primer sequences used for E gene amplification are as follows:
[0079] SEQ ID NO.7: CTTTCGTGGTATTCTTGCTAGTT and SEQ ID NO.8:CACGTTAACAATATTGCAGCA,
[0080] The corresponding detection probe sequence is SEQ ID NO.9:TAGCCATCCTTACTGCGCTTCGATTG.
[0081] The probe labeling for each gene in this invention is not limited to a single label of the same wavelength listed, but includes multiplex detection reagents with different combinations of different labels.
[0082] In one embodiment, the kit further includes internal standard quality control, amplification primers, and detection probes;
[0083] The internal standard quality control contains the target gene fragment with the sequence shown in SEQ ID NO.13;
[0084] The internal standard quality control amplification primer sequences are SEQ ID NO.10: CTAACACTGGCTCGTGTG and SEQ ID NO.11: TGGGATGGGGAGTCTGT.
[0085] The corresponding detection probe sequence is SEQ ID NO.12: AGGCTGGTGTAAAGCGGCCTT.
[0086] The sequence of the target gene fragment shown in SEQ ID NO.13 is as follows:
[0087] CTAACACTGGCTCGTGTGACAAGGCCATGAGGCTGGTGTAAAGCGGCCTTGGAGTGTGTATTA AGTAGGCGCACAGTAGGTCTGAACAGACTCCCCATCCCA.
[0088] Using the target gene fragment as an internal standard can monitor both sample collection and the sample extraction process, preventing false negatives caused by failed nucleic acid extraction.
[0089] In one embodiment, the kit includes a positive control containing MS2 pseudovirus with N / ORF1ab / E gene fragment and a negative control containing sterile saline.
[0090] The gene sequence of the novel coronavirus 2019-nCoV in this invention can be found in GISAID: BetaCov / Wuhan / WH01 / 2019|EPI_ISL_406798; information on the oligonucleotide sequences of its N, ORF1ab and E genes can be found in the literature (Roujian Lu, Xiang Zhao, Juan Li, et al., Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. Lancet. 2020 Jan 30).
[0091] In one embodiment, the kit includes a PCR reaction solution containing the N / ORF1ab / E gene and internal standard primers, probes, dNTPs, and PCR buffer, and a PCR enzyme system containing hot-starting Hot.Taq enzyme, reverse transcriptase M-MMLV, and RNase inhibitor, wherein the concentrations of primers and probes are 0.1-1 μM, the concentrations of dNTPs are 0.2-0.4 mM, the concentrations of MgCl2 are 2-5 mM, the hot-starting Hot.taq is 2.5-10 U, the reverse transcriptase M-MMLV is 40-100 U, and the RNase inhibitor is 8-20 U.
[0092] A method for using a novel coronavirus 2019-nCoV nucleic acid detection kit includes the following steps: extracting the sample to be tested (the extraction reagent used is a nucleic acid extraction or purification reagent produced by Sun Yat-sen University Da An Gene Co., Ltd. (Guangdong-Guangzhou Medical Device Registration No. 20150348), to obtain a nucleic acid sample (positive and negative quality controls are extracted simultaneously); adding 5 μL to the above PCR reaction solution (17 μL) and enzyme mixture (3 μL), and performing the amplification reaction in a real-time fluorescence PCR instrument, with the fluorescence channels selected sequentially as FAM, VIC / HEX, Texas red, and Cy5, and the PCR amplification program as follows;
[0093] 50℃, 15min, 95℃, 15min; 1 cycle
[0094] 94℃, 15 sec, 55℃, 45 sec (collect fluorescence); 45 cycles.
[0095] After PCR, the negative and positive results of the corresponding pathogen DNA are determined by different fluorescence channel curves and Ct values. The test results can be used for auxiliary diagnosis of novel coronavirus 2019-nCoV infection and provide a reliable basis for virus identification and prevention and control.
[0096] The components of this kit are detailed in Tables 1 and 2. It can simultaneously detect three target genes of the novel coronavirus 2019-nCoV. It can prevent false positives by cross-validating different targets and confirm missed detections that may be caused by mutations, thus significantly improving the accuracy of virus identification.
[0097] Table 1. Kit Components
[0098]
[0099] The primer and probe sequences required for the kit are shown in Table 2:
[0100] Table 2 Primers, probes, and sequence numbers
[0101] Primer and probe names Primer / probe sequences SEQ ID NO. N-F1 AAGAAATTCAACTCCAGGCAGC 1 N-R1 GCTGGTTCAATCTGTCAAGCAG 2 NP 5'FAM-TCACCGCCATTGCCAGCCA-BHQ1 3 ORF1ab-F1 TTATCACCCGCGAAGAAG 4 ORF1ab-R1 TCTAGTAGCATGACACCCCT 5 ORF1ab-P 5'HEX-ACGTGCATGGATTGGCTTCGAATGT BHQ1-3' 6 E-F1 CTTTCGTGGTATTCTTGCTAGTT 7 E-R1 CACGTTAACAATATTGCAGCA 8 EP 5'Texas red-TAGCCATCCTTACTGCGCTTCGATTG-BHQ2-3' 9 Internal Standard - F1 CTAACACTGGCTCGTGTG 10 Internal standard - R1 TGGGATGGGGAGTCTGT 11 Internal standard - P 5'Cy5-AGGCTGGTGTAAAGCGGCCTT-BHQ2-3' 12
[0102] Preferably, the fluorescent group is selected from the group consisting of: FAM, HEX, NED, ROX, TET, JOE, TAMRA, CY3, and CY5.
[0103] Preferably, the quenching gene is selected from the group consisting of: MGB, BHQ-1, BHQ-2, and BHQ-3.
[0104] In the primer design of this invention, specific primers and probes were screened through a large number of experiments, and then combined, optimized and verified. Finally, the optimal primer-probe combination for multiple detection was selected, which does not interfere with each other, has high amplification efficiency and good specificity.
[0105] The reagent kit of this invention is used to determine the validity of the test as follows:
[0106] Each test includes both negative and positive controls. The test result is considered valid when the positive control is positive and the negative control is negative.
[0107] The method of using the reagent kit of the present invention includes the following steps:
[0108] (1) Extract total nucleic acid from the test sample to obtain a nucleic acid sample.
[0109] (2) The nucleic acid sample is mixed with PCR reaction solution and PCR enzyme system to prepare PCR reaction system.
[0110] (3) Real-time fluorescence PCR reaction, the procedure is as follows:
[0111] Phase 1: 50℃ for 2-15 min, 95℃ for 10-15 min, 1 cycle;
[0112] Second stage: 94℃ for 10-15s, 55-60℃ for 45s, 45 cycles.
[0113] After PCR, the negative or positive results of the corresponding pathogen nucleic acid are determined by different fluorescence channel curves and Ct values, and the detection results are given.
[0114] The beneficial effects of this invention are as follows:
[0115] Current detection reagents are mostly single-target reagents. RNA viruses mutate rapidly, easily leading to missed detections of mutated viruses, which is detrimental to the timely detection and control of the virus. This invention simultaneously detects three targets of the novel coronavirus 2019-nCoV, allowing for cross-validation between different targets to prevent false positives and confirming potential missed detections due to mutations, significantly improving the accuracy of virus identification. Simultaneously, the system includes an endogenous internal standard quality control system, enabling full monitoring of the entire process from sampling, sample preservation, nucleic acid extraction, and PCR amplification, preventing false negatives.
[0116] This invention is applicable to the detection of nucleic acid of the novel coronavirus 2019-nCoV, providing a reliable basis for virus identification and prevention and control, and is worthy of widespread application. Furthermore, the method of this invention is also applicable to non-diagnostic purposes, such as detecting viral nucleic acid in the environment during epidemic prevention and control, and this viral nucleic acid information can be used for public health management.
[0117] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in *Molecular Cloning: A Laboratory Manual* by Sambrook J. et al. (translated by Huang Peitang et al., Beijing: Science Press, 2002), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated. Unless otherwise specified, all experimental materials and reagents used in the following embodiments are commercially available.
[0118] Example 1: Detection Limit Test of Novel Coronavirus 2019-nCoV Nucleic Acid Detection Kit
[0119] The pre-defined pseudovirus was used as the initial sample and diluted to a concentration of 10. 5 copies / ml, diluted sequentially to 10. 4 10 3 500 and 250 copies / ml were added to each concentration sample to a final concentration of 10. 4 A sample of pseudovirus containing an internal standard amplification fragment was used as the test sample, and the sensitivity of the triplet detection reagent was tested. The PCR reaction system contained the primer and probe combinations shown in SEQ ID NO.:1-12 of this invention.
[0120] See test results Figure 1-4 :
[0121] Figure 1 : N gene detection limit;
[0122] Figure 2 ORF1ab gene detection limit test;
[0123] Figure 3 E-gene detection limit test;
[0124] Figure 4 : Internal standard test results.
[0125] The results showed that the lowest detectable concentration of positive control samples of different concentrations was 500 copies / ml.
[0126] Example 2: Specificity test of the novel coronavirus 2019-nCoV nucleic acid detection kit
[0127] Other pathogens that are similar in species to or cause similar symptoms to the 2019 novel coronavirus (such as seasonal influenza A (H1N1), novel influenza A (H1N1 (2009)), influenza A (H3N2, H5N1, H7N9), influenza B (Yamagata), influenza B (Victoria), respiratory syncytial virus (RSV) A, respiratory syncytial virus (RSV) B, parainfluenza virus, adenovirus, enterovirus, human metapneumovirus (human metapneumovirus), Epstein-Barr virus (EBV), measles virus, human cytomegalovirus, rotavirus) Norovirus, mumps virus, varicella-zoster virus, mycoplasma pneumoniae, chlamydia pneumoniae, Legionella, Bordetella pertussis, Haemophilus influenzae, Staphylococcus aureus, Streptococcus pneumoniae, Streptococcus pyogenes, Klebsiella pneumoniae, Mycobacterium tuberculosis, Aspergillus fumigatus, Candida albicans, Candida glabrata, Cryptococcus neoformans, coronaviruses (HKU1, OC43, NL63, 229E), and human genomic DNA were used as specific references to test the specificity of the novel coronavirus 2019-nCoV nucleic acid detection kit.
[0128] See test results Figure 5-6 :
[0129] Figure 5 Specificity test results;
[0130] Figure 6 Specific detection of internal standard test results;
[0131] The specific reference samples were tested, and all results were negative, while the internal standard control was positive. This indicates that the kit of the present invention has excellent specificity.
[0132] Example 3: Precision Test of the Novel Coronavirus 2019-nCoV Nucleic Acid Detection Kit
[0133] The N / ORF1ab / E gene pseudoviruses were diluted to 10⁻⁶. 5 and 10 3 Copies / ml were used as precision references, and each concentration was repeated 10 times to calculate the coefficient of variation for each concentration of precision reference.
[0134] See test results Figure 7-9 :
[0135] Figure 7 .N gene precision detection results;
[0136] Figure 8 .ORF1ab gene precision detection results;
[0137] Figure 9 .E gene precision test results;
[0138] The coefficients of variation for high- and low-concentration precision reference materials for the novel coronavirus 2019-nCoV were 1.16% and 1.54% for the N gene, 1.16% and 1.54% for the ORF1ab gene, and 1.16% and 1.54% for the E gene; the coefficients of variation for different concentrations of precision reference materials for the three detection targets were all less than 5%.
[0139] Example 4: Interference substance test of the novel coronavirus 2019-nCoV nucleic acid detection kit
[0140] To 10 respectively 3 Respiratory pathogen treatment drugs, such as phenylephrine, oxymetazoline, sodium chloride, beclomethasone, dexamethasone, flunisolone, triamcinolone, budesonide, mometasone, fluticasone, histamine hydrochloride, interferon, zanamivir, ribavirin, oseltamivir, peramivir, lopinavir, mupirocin, levofloxacin, azithromycin, tobramycin, ritonavir, meropenem, ceftriaxone, ritonavir, tobramycin, meropenem, and arbidol, were added to pseudovirus cultures at copies / ml as interfering substances. Samples without interfering substances were used as controls to test the effect of interfering substances on primer and probe amplification.
[0141] See test results Figure 10-15 :
[0142] Figure 10 .N gene interference detection results;
[0143] Figure 11 .ORF1ab gene interference detection results;
[0144] Figure 12 .E gene interference detection results;
[0145] The results showed that the addition of phenylephrine, oxymetazoline, sodium chloride, beclomethasone, dexamethasone, flunisulfonamide, triamcinolone acetonide, budesonide, mometasone, fluticasone, histamine hydrochloride, interferon, zanamivir, ribavirin, oseltamivir, peramivir, lopinavir, mupirocin, levofloxacin, azithromycin, tobramycin, ritonavir, meropenem, ceftriaxone, ritonavir, tobramycin, meropenem, and arbidol to the test samples did not significantly interfere with the test results and did not affect the interpretation of the results.
[0146] Example 5: Clinical Sample Testing
[0147] Nucleic acid extraction from test samples:
[0148] (1) Extraction of nucleic acid template from clinical test samples
[0149] Twenty-two suspected pharyngeal swab clinical samples were collected. Nucleic acid extraction or purification reagents (Guangdong-Guangxi Medical Device Registration No. 20150348) from Sun Yat-sen University Da An Gene Co., Ltd. were used to obtain nucleic acid samples (positive and negative quality controls were extracted simultaneously). 5 μL of the samples were added to the above PCR reaction solution (17 μL) and enzyme mixture (3 μL), and amplification was performed in a real-time fluorescence PCR instrument. The fluorescence channels were selected sequentially as FAM, VIC / HEX, Texas red, and Cy5. The PCR amplification program is as follows.
[0150] 50℃, 15min, 95℃, 15min; 1 cycle
[0151] 94℃, 15 sec, 55℃, 45 sec (collect fluorescence); 45 cycles.
[0152] After PCR, the negative and positive results of the corresponding pathogen DNA were determined by different fluorescence channel curves and Ct values.
[0153] Of the 22 suspected clinical samples tested, 17 tested positive for 2019-nCoV nucleic acid. Typical test results are as follows: Figure 13 As shown.
[0154] Sequencing verification results showed that the detection system of the present invention achieved a detection accuracy of 100%, further proving the clinical detection accuracy of the system of the present invention.
[0155] Comparative Example 1
[0156] During the research process, the inventors screened dozens of PCR primers and probes targeting the nucleic acid sequence of the novel coronavirus 2019-nCoV. After extensive testing, they finally obtained a primer and probe combination with sensitivity and specificity that can meet the needs of clinical testing and can perform multiplex detection.
[0157] The inventors conducted extensive screening and combination of primers targeting the N, ORF1ab, and E genes of the novel coronavirus 2019-nCoV. For example, some typical primer sequences designed for the ORF1ab gene are as follows:
[0158] ORF1ab gene control upstream primer ORF1ab-F2: ATCAAGTTAATGGTTACCCTAACATG (SEQ ID NO. 14)
[0159] ORF1ab gene control downstream primer ORF1ab-R2: CAACAGCTTCTCTAGTAGCATGACA (SEQ ID NO. 15)
[0160] ORF1ab gene control upstream primer ORF1ab-F3: TGGGTTTTAAAATGAATTATCAAGTT (SEQ ID NO. 16)
[0161] ORF1ab gene control downstream primer ORF1ab-R3: AACCTAGCTGTAAAGGTAAATTGG (SEQ ID NO. 17)
[0162] The specific detection steps, detection conditions, and probe sequences are the same as in the above examples, and PCR detection is performed.
[0163] The detection results using ORF1ab-F2 and ORF1ab-R2 are as follows: Figure 14 As shown, the detection results indicate that this primer pair has poor specificity. Detection results using ORF1ab-F3 and ORF1ab-R3 show that this primer pair has good specificity and sensitivity for the ORF1ab gene target nucleic acid in a single detection system, but in a multiplex detection system, the amplification of low concentrations of the ORF1ab gene target nucleic acid is significantly inhibited. The results for both single- and multiplex detection systems are shown below. Figure 15 As shown, this indicates that the control primer pairs ORF1ab-F3 and ORF1ab-R3 cannot be used in multiplex detection systems.
[0164] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.
Claims
1. A kit for multiplex detection of novel coronavirus 2019-nCoV nucleic acid, characterized in that, The kit includes a primer pair set and a probe set: The primer pair set includes a first primer pair set, a second primer pair set, a third primer pair set, and an internal standard primer pair set; The first primer pair set includes: For example, the forward primer shown in SEQ ID NO.1 and the reverse primer shown in SEQ ID NO.2; The second primer pair set includes: For example, the forward primer shown in SEQ ID NO.4 and the reverse primer shown in SEQ ID NO.5; The third primer pair set includes: For example, the forward primer shown in SEQ ID NO.7 and the reverse primer shown in SEQ ID NO.8; The internal standard primer pair set includes a forward primer as shown in SEQ ID NO.10 and a reverse primer as shown in SEQ ID NO.11; The probe set includes a first probe with a nucleotide sequence as shown in SEQ ID NO.3, a second probe with a nucleotide sequence as shown in SEQ ID NO.6, a third probe with a nucleotide sequence as shown in SEQ ID NO.9, and an internal control probe with a nucleotide sequence as shown in SEQ ID NO.12; The kit also includes an internal control containing a target gene fragment with a sequence as shown in SEQ ID NO.
13.
2. The kit according to claim 1, characterized in that, The kit includes a first container containing a primer-probe mixture containing the polynucleotide sequences shown in SEQ ID NO. 1-12.
3. The kit according to claim 2, characterized in that, The kit also includes a second container containing a PCR enzyme system, which includes a hot-start enzyme and a reverse transcriptase M-MMLV.
4. The kit according to claim 3, characterized in that, The kit also includes a third container containing a positive control sample.
5. The kit according to claim 4, characterized in that, The kit also includes a fourth container containing a negative control.
Citation Information
Patent Citations
Novel Coronavirus 2019-nCoV Nucleic Acid Detection Kit
CN111235320B