Application of tobacco lectin in the preparation of medicine for treating liver disease and acute liver injury

Abstract

The present invention belongs to the field of biomedicine, and relates to a new use of tobacco agglutinin, and more specifically, to an application of tobacco agglutinin in the preparation of a drug for treating liver disease and acute liver injury. The present invention has been proven to have significant effects on various indicators of acute liver injury in animal experiments, especially for weight loss, abnormal liver index, abnormal liver tissue structure, and abnormal AST and ALT content in serum caused by liver disease and acute liver injury. The present invention provides a theoretical basis and a new approach for the treatment of liver disease and acute liver injury, and is expected to become a new treatment for liver disease and acute liver injury. It is a new use of tobacco agglutinin in drugs, and the present invention can better save social resources and scientific research resources.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to a new use of tobacco lectin, and more specifically, to an application of tobacco lectin in preparing a medicine for treating liver disease and acute liver injury. Background Art

[0002] Nicotiana tabacum agglutinin was first isolated from tobacco leaves in 2002 and is a natural product produced in tobacco. Its protein structure characteristics determine its physiological functions against viral diseases, bacterial diseases and fungal diseases. It has hemoglobin agglutination effect, and its protein amino acid sequence has a polysaccharide binding domain, so it has an inhibitory effect on the endotoxin of some polysaccharides.

[0003] A variety of diseases and toxins can cause acute liver damage. Pathologically, acute liver damage is actually the result of severe acute damage to the liver cell substance. Specific manifestations include weight loss, abnormal liver index, abnormal liver tissue structure, abnormal AST and ALT levels in serum, etc.

[0004] At present, the most common treatment for acute liver injury is traditional Chinese medicine, followed by antipyretic analgesics (NSAIDs) and antibiotics. Traditional Chinese medicine treatment is mainly divided into single herbal medicine research and herbal compound research. There are few studies on the application effect of single ingredients, and the therapeutic effect of tobacco lectin (Nictaba) on acute liver injury has not been reported.

[0005] The research of the present invention provides a theoretical basis and a new approach for the treatment of liver disease and acute liver injury, and is expected to become a new treatment for liver disease and acute liver injury, which has important scientific and social significance. Summary of the invention

[0006] The technical problem to be solved by the present invention is to overcome the defects and technical deficiencies in the above-mentioned prior art, and provide an application of tobacco lectin in the preparation of drugs for treating liver disease and acute liver injury, which is a new use of tobacco lectin.

[0007] The technical solution of the present invention is as follows:

[0008] The present invention firstly provides an application of tobacco lectin in preparing medicine for treating liver disease.

[0009] The present invention also provides an application of tobacco lectin in preparing a medicine for treating acute liver injury.

[0010] Furthermore, in the application of the above-mentioned tobacco lectin in the preparation of a drug for treating liver diseases or acute liver injury, the tobacco lectin is a pure tobacco lectin protein. The pure tobacco lectin protein is described as having a gene size of 510 bp; in the recombinant protein: the expression product is about 18 kDa, the tag is 26 kDa, and the total is 44 kDa; the tobacco lectin protein used is produced by bioengineering. Specifically, a recombinant protein is constructed with a PGEX-6P-1 vector, and the insertion sites are BamHI and XhoI. The recombinant protein is obtained according to the following sequence.

[0011] Gene sequence:

[0012] ggatccatgcaaggtcagtggattgcagcacgtgatctgagcattacctgggttgataatccgcagtat

[0013] tggacctggaaaaccgttgatccgaatattgaagttgcagaactgcgtcgtgttgcatggctggatatt

[0014] tatggtaaaatcgaaaccaaaaacctgatccgcaaaaccagctatgcagtttatctggtttttaaactg

[0015] accgacaatccgcgtgaactggaacgtgcaaccgcaagcctgcgttttgttaatgaagttgccgaaggt

[0016] gcaggtattgaaggcaccaccgtgtttattagcaaaaagaaagaactgcctggtgaactgggtcgtttt

[0017] ccgcatctgcgtagcgatagctggctggaaattaaactgggtgaatttttcaataacctgggcgaagat

[0018] ggtgaagttgaaatgcgtctgatggaaatcaatgataaaacccgcaaaagcggcattatcgtgaaaggttttgatatccgtccgaattaactcgag。

[0019] Furthermore, the tobacco lectin is used in the preparation of drugs for treating liver disease or acute liver injury, and the method for preparing the pure protein of the tobacco lectin includes: step 1: competent transformation and positive clone screening; step 2: small-scale expression and identification of positive clones; step 3: large-scale protein expression and bacterial lysis detection. The target protein is 44 kDa, which is consistent with the size of the protein after induction purification, and it is considered that the protein expression and purification are successful.

[0020] Furthermore, the tobacco lectin is used in the preparation of a drug for treating liver disease or acute liver injury, wherein the drug is a drug for restoring body weight.

[0021] Furthermore, the tobacco lectin is used in the preparation of a drug for treating liver disease or acute liver injury, wherein the drug is a drug for regulating normal liver index values.

[0022] Furthermore, the tobacco lectin is used in the preparation of a drug for treating liver disease or acute liver injury, wherein the drug is a drug for regulating normal values ​​of serum AST and / or ALT levels.

[0023] Furthermore, in the application of the above tobacco lectin in the preparation of a drug for treating liver disease or acute liver injury, the drug is a drug for restoring liver tissue structure.

[0024] Furthermore, in the use of the above tobacco lectin in the preparation of a drug for treating liver disease or acute liver injury, the drug preparation is in the form of pills, capsules, oral liquids, emulsions, injections or sustained-release preparations.

[0025] The present invention has the following beneficial effects compared with the prior art:

[0026] The present invention discloses an application of tobacco lectin in the preparation of a medicine for treating liver disease or acute liver injury. The single-component tobacco lectin, in particular, the pure protein of tobacco lectin is used in the medicine. The therapeutic application of the single component avoids the therapeutic risks brought by the presence of other components in the composite component, and therefore has great production benefits and innovation.

[0027] The present invention has confirmed in animal experiments that tobacco agglutinin has significant effects on various indicators of acute liver injury, providing a theoretical basis and a new approach for the treatment of liver disease and acute liver injury, and is expected to become a new treatment for liver disease and acute liver injury. It has important scientific and social significance and is of great significance for saving social resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Electrophoresis diagram of tobacco lectin protein detection.

[0029] Figure 2 Results of serum ALT levels in mice among the groups.

[0030] Figure 3 Liver sections and HE staining results of mice in each group (liver tissue structure).

[0031] in, Figure 1 For the detection after the preparation of tobacco agglutinin protein; Figures 2 to 3 To verify the experimental effect of tobacco agglutinin on various functional indicators of acute liver injury through animal experiments. DETAILED DESCRIPTION

[0032] The present invention is further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any form.

[0033] Unless otherwise specified, the reagents, methods and equipment used in the following examples are conventional reagents, methods and equipment in the art.

[0034] Unless otherwise specified, the reagents and materials used in the following examples are all available from commercial sources.

[0035] The term "treatment" as used herein refers to relieving, alleviating, improving, or inhibiting (e.g., preventing the development of) a disease that a subject has already manifested or has previously experienced. With respect to a specific disease, "treatment" may include "curing" the disease, but in most cases it is not necessary to completely eliminate all of its symptoms. For example, if the administration of a relevant drug causes at least one symptom of the subject to be weakened or eliminated, the subject can be considered to have been "treated."

[0036] Example 1 Preparation of tobacco lectin protein

[0037] 1. Construct PGEX-6P-1 vector; insert site BamHI XhoI; according to the following sequence, the tobacco lectin gene size is 510 bp; the gene expression product in the recombinant protein is about 18 kDa, the tag is 26 kDa, and the total is 44 kDa.

[0038] Gene sequence:

[0039] ggatccatgcaaggtcagtggattgcagcacgtgatctgagcattacctgggttgataatccgcagtat

[0040] tggacctggaaaaccgttgatccgaatattgaagttgcagaactgcgtcgtgttgcatggctggatatt

[0041] tatggtaaaatcgaaaccaaaaacctgatccgcaaaaccagctatgcagtttatctggtttttaaactg

[0042] accgacaatccgcgtgaactggaacgtgcaaccgcaagcctgcgttttgttaatgaagttgccgaaggt

[0043] gcaggtattgaaggcaccaccgtgtttattagcaaaaagaaagaactgcctggtgaactgggtcgtttt

[0044] ccgcatctgcgtagcgatagctggctggaaattaaactgggtgaatttttcaataacctgggcgaagat

[0045] ggtgaagttgaaatgcgtctgatggaaatcaatgataaaacccgcaaaagcggcattatcgtgaaaggt

[0046] tttgatatccgtccgaattaactcgag

[0047] 2 Protein expression and purification

[0048] 2.1 Competent transformation and positive clone screening

[0049] 2.1.1 Take out the BL21 competent cells from the ultra-low temperature refrigerator and thaw them on ice;

[0050] 2.1.2 Add plasmid (2 μL) to 30 μL competent cells, pipette gently to mix thoroughly, and place on ice for 30 min;

[0051] 2.1.3 Heat in a water bath at 42°C for 90 seconds and place on ice for 2 minutes;

[0052] 2.1.4 Add 200 μL of LLB liquid culture medium and culture at 37°C, 200 rpm for 45 min;

[0053] 2.1.5 Mix gently and pipette 100 μL of bacterial solution, drop it evenly on the plate (Amp resistance), and shake it horizontally to mix well;

[0054] 2.1.6 Invert the plate and incubate at 37°C for 12 to 16 hours until colonies (positive clones) appear.

[0055] 2.2 Small-scale expression and identification of positive clones

[0056] 2.2.1 Select a single colony containing the recombinant plasmid and place it in 3 mL LB liquid medium (Amp resistance), culture it at 37°C overnight, and then store it at -20°C;

[0057] 2.2.2 Select a single colony containing the recombinant plasmid and place it in 3 mL LB liquid medium (Amp resistance), and culture at 37°C with shaking until the OD600 is about 0.6;

[0058] 2.2.3 Take part of the bacterial solution as the control group, add IPTG inducer (final concentration 1mM) to the remaining bacterial solution, and culture at 37℃ with shaking for 3h;

[0059] 2.2.4 Take 0.15 mL of bacterial suspension from each group, centrifuge at 12000×g for 2 min, resuspend and lyse the bacterial pellet with 40 μL 1× loading buffer, and detect by SDS-PAGE.

[0060] 2.3 Protein mass expression and bacterial lysis detection

[0061] 2.3.1 Select a single colony containing the recombinant plasmid and place it in 8 mL LB liquid medium (Amp resistance) and culture it at 37°C with shaking overnight;

[0062] 2.3.2 Inoculate 8 mL of bacterial solution into 400 mL of LB liquid medium (Amp resistance) and culture at 37°C until OD600 is about 0.6;

[0063] 2.3.3 Add IPTG inducer to a final concentration of 0.1 mM and continue shaking culture at 16°C for 16 h;

[0064] 2.3. Collect the cells by centrifugation at 45000 rpm for 5 min and resuspend in 40 mL of pre-cooled GST equilibrium solution;

[0065] 2.3.5 Ultrasonic disruption of bacteria, the parameters are set as power 200W, ultrasonic 2.5s, pause 5s, 80 cycles;

[0066] 2.3.6 Centrifuge at 10000 rpm at 4°C for 5 min, collect the supernatant and precipitate;

[0067] 2.3.7 Take a small amount of supernatant and precipitate for SDS-PAGE detection, and store the remaining supernatant and precipitate at 4℃ for later use.

[0068] Transform BL21 competent cells, select the positive spots grown on the Amp resistance plate for expansion culture and expression purification. The target protein is 44kDa, which is consistent with the size of the protein after induction and purification, and it is considered that the protein expression and purification are successful.

[0069] As shown in the electrophoresis diagram of tobacco lectin protein detection in Figure 1, after the lane: after induction; lane P: bacterial lysate precipitate; lane pre: supernatant after loading onto the column; lane after: effluent after loading onto the column; lane 5: eluted protein (the expected fusion protein is 44 kDa, and the purified protein is 44 kDa, which is consistent with the expectation); lane 6: marker: M: 200; 140; 110; 75; 55; 42; 30; 23; 18; 10 kDa.

[0070] Example 2 Changes in mouse body weight

[0071] 1. Materials:

[0072] 1) Animals: C57BL / 6J, purchased from Guangdong Provincial Medical Experimental Animal Center, SPF grade, male, 5 weeks old, license number: SCXK(Yue)2016 - 0041. They were normally raised for one week before the experiment. The feed was purchased from Jiangsu Xietong Pharmaceutical Biotechnology Co., Ltd., SPF grade mouse feed, license number: Su Feed License (2019)01008.

[0073] 2) Protein: The protein expressed in Example 1 above.

[0074] 3) Reagents: Carbon tetrachloride (MACKLIN; 56 - 23 - 5); Corn oil (reagent grade MACKLIN; 8001 - 30 - 7); Paraformaldehyde fixative (Servicebio; G1101); Aspartate aminotransferase (AST) test kit (Nanjing Jiancheng; C010 - 2 - 1); Alanine aminotransferase (ALT) test kit (Nanjing Jiancheng; C009 - 2 - 1).

[0075] 4) Intelligent independent ventilation cage IVC system: Model: H6, produced by Suzhou Suhang Scientific and Technical Equipment Co., Ltd. 2. Test methods:

[0076] 1) Quarantine and domestication

[0077] After the animals were purchased, they were quarantined for 5 - 7 days. Only the animals that passed the quarantine could enter the experiment.

[0078] 2) Breeding conditions

[0079] The animals were raised in IVC cages. Each cage could hold a maximum of 5 animals of the same sex. The temperature was controlled at 20 - 26 °C, the humidity was controlled at 40 - 70%, and the animal lighting was alternated between 12 hours of darkness.

[0080] 3) Animal marking

[0081] When the animals were received, they were marked using the ear tag method.

[0082] 4) Animal grouping

[0083] After the animals passed the quarantine, they were randomly divided into normal group, model group and treatment group (LN protein = 1.5 mg / kg and HN protein = 3 mg / kg, intraperitoneal injection), with 3 repetitions.

[0084] 5) Animal modeling

[0085] After fasting for 12 hours, mice except the normal group were intraperitoneally injected with 30% Ccl4 (dissolved in corn oil), with each mouse injected intraperitoneally at a volume of 8ul / g (4ul / g for the first injection, and blood was collected three days after administration to test AST and ALT. The results showed that both the model group and the experimental group had recovered) to establish the model.

[0086] 6) Animal collection (dissection on ice throughout the process):

[0087] Three days after administration, fast for 12 hours, take blood from the eyeball, and take liver tissue (the last weighing before dissection); the blood is naturally allowed to stand for 30 minutes, centrifuged at 4°C, 2500rpm for 20 minutes, and the supernatant is stored at -80°C; the liver tissue is taken out and washed with cold saline, photographed and weighed to facilitate the assessment of liver index and damage. Half of the tissue is stored in formalin, and the other half is divided into two parts and stored in a -80°C refrigerator. The liver index = liver weight (g) / body weight (g) × 100%; the serum is tested for AST, ALT levels to evaluate damage (KIT), liver index, and HE staining of damaged liver in strict accordance with the instructions of the Nanjing Detection Kit.

[0088] 3. The test results are as follows:

[0089] Mouse weight

[0090] The trend of the change in the average weight of mice between the groups shows that: in the initial stage of the experiment, the average weight of mice between the groups was not much different (control group = 20.87g, model group = 19.43g, LN protein = 21.07g, HN protein = 79.93g). After modeling, the difference between the average weight of the control group and the average weight of the other groups increased significantly (control group = 22.8g, model group = 18.93g, LN protein = 20.3g, HN protein = 19.7g). Compared with the model group (weight = 17.07g), the weight of the treatment group on the seventh day after administration was restored on the eighth day (LN protein = 19.53g, HN protein = 19.83g), and the visual observation of the mice also improved, indicating that tobacco agglutinin has a positive effect on mice with acute liver injury.

[0091] Example 3 Mouse Liver Index

[0092] Liver index, the normal liver index is only between 0 and 40. Generally, the alanine aminotransferase is checked, which is an important criterion for detecting liver function. If this is normal, it means that there is no inflammatory damage to the liver. Liver index is equal to liver weight / body weight.

[0093] The other steps of this embodiment are the same as those of Example 2, except that the mouse liver index test results show that the treatment group (LN protein liver index 5.21, HN protein liver index 5.02) is between the control group (liver index 7.13) and the model group (liver index 4.60), indicating that it has a certain effect on the recovery of liver function.

[0094] Example 4: Detection of AST and ALT levels in mouse serum

[0095] Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) are two commonly used indicators for testing liver function. ALT and AST are mainly distributed in the hepatocytes of the liver. The normal values ​​are 0 to 40 international units.

[0096] This example has the same steps as Example 2, but the difference is the experimental effect. The results of the test on the serum AST content of mice in each group are as follows: Figure 2 The results of the ALT content test in the serum of mice among the groups further proved that tobacco agglutinin has a good therapeutic effect on acute liver injury. Although after the treatment with tobacco agglutinin protein, the low-concentration protein (LN group, AST content 107.98U / L) and high-concentration protein group (HN group AST content 107.09U / L) were higher than the control group (AST content 22.95U / L), they were far lower than the model group (AST content 293.18U / L). Figure 2 The trend of the experimental results: the ALT content in the protein treatment group (LN and HN) (83.71U / L for LN and 75.44U / L for HN) was higher than that in the control group (ALT content was 9.38U / L), but much lower than that in the model group (ALT content was 219.57U / L).

[0097] The experimental results showed that although the AST and ALT content values ​​in the treatment group could not be completely restored to normal values, compared with the model group, both indicators were alleviated and their values ​​were significantly lower than those in the model group.

[0098] Example 5: HE staining of mouse liver sections

[0099] The other steps of this embodiment are the same as those of embodiment 2, except that Figure 3In the liver sections of mice and the HE staining results among each group, compared with the normal liver tissue of the control group, the liver tissue structure in the model group was severely abnormal. Some hepatocytes showed ground-glass changes, and the cytoplasm was filled with eosinophilic fine granular substances, as shown by white arrow 1; individual hepatocytes were necrotic, and no obvious cell structure was seen, as shown by gray arrow 2; a large number of inflammatory cells were also seen infiltrating in the liver parenchyma, as shown by black arrow 3. Only a small amount of residual inflammatory cells were seen in the treatment group, and other pathological symptoms were rare or absent.

[0100] In this invention, it has been confirmed through animal experiments that tobacco lectin has significant effects on various indicators of acute liver injury, providing a theoretical basis and a new approach for the treatment of liver diseases and acute liver injury. It is expected to become a new therapy for liver diseases and acute liver injury, with important scientific and social significance, and great significance for saving social resources.

[0101] In the preparation of drugs for treating liver diseases and acute liver injury in this invention, the pharmaceutical preparation form can be any one of tablets, pills, capsules, oral liquids, emulsions, injections, sustained-release agents, etc.

[0102] This invention has first discovered that a single tobacco lectin has significant therapeutic effects on acute liver injury. The therapeutic application of a single component avoids the therapeutic risks brought by other components in a composite component, determining the potential therapeutic role of tobacco lectin and tobacco lectin protein in future clinical applications, with great production benefits and innovation.

[0103] The above are only the preferred embodiments of the present invention and do not limit the present invention. Those of ordinary skill in the art can understand that: various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and purposes of the present invention. The scope of the present invention is defined by the claims and their equivalents. Improvements, etc., should all be included within the protection scope of the present invention. For the experimental methods without specific conditions noted in the examples, they are usually implemented according to conventional conditions or the conditions recommended by the manufacturers for detection.

Claims

1. A use of tobacco agglutinin in the preparation of a drug for treating acute liver injury, characterized in that: The tobacco agglutinin is a pure tobacco agglutinin protein; The tobacco lectin protein is produced by bioengineering, specifically, the recombinant protein is constructed using the PGEX-6P-1 vector, the insertion site BamHI XhoI, and the recombinant protein is obtained according to the following sequence; Gene sequence: Ggatccatgcaaggtcagtggattgcagcacgtgatctgagcattacctgggttgataatccgcagtattggacctggaaaaccgttgatccgaatattgaagttgcagaactgcgtcgtgttgcat ggctggatatttatggtaaaatcgaaaccaaaaacctgatccgcaaaaccagctatgcagtttatctggtttttaaactgaccgacaatccgcgtgaactggaacgtgcaaccgcaagcctgcgtttt gttaatgaagttgccgaaggtgcaggtattgaaggcaccaccgtgtttattagcaaaaagaaagaactgcctggtgaactgggtcgttttccgcatctgcgtagcgatagctggctggaaattaaact gggtgaatttttcaataacctgggcgaagatggtgaagttgaaatgcgtctgatggaaatcaatgataaaacccgcaaaagcggcattatcgtgaaaggttttgatatccgtccgaattaactcgag.

2. The use according to claim 1, characterized in that: The method for preparing pure protein of tobacco agglutinin comprises: Step 1, competent transformation and positive clone screening; Step 2: small-scale expression and identification of positive clones; Step 3: protein mass expression and bacteriostasis detection; The target protein is 44 kDa, which is consistent with the size of the protein after induction and purification, and it is considered that the protein expression and purification are successful.

3. The use according to claim 1, characterized in that: The pharmaceutical preparation is in the form of tablets, pills, capsules, oral liquids, emulsions, injections or sustained-release preparations.

Images