Nucleic acid reagent, kit and detection method for detecting poison hemlock

Abstract

The present disclosure relates to the field of biotechnology, and in particular, to a nucleic acid reagent, a kit and a detection method for detecting poison hemlock. The nucleic acid reagent is designed for the ITS1 gene of poison hemlock, and includes the primers shown in SEQ ID NO.1‑2 and the probe shown in SEQ ID NO.3. The nucleic acid reagent, the kit or the method provided by the present disclosure can quickly and accurately detect or identify poison hemlock in a sample to be tested, with good sensitivity and specificity.

Description

Technical Field

[0001] The present disclosure relates to the field of biotechnology, and in particular, to a nucleic acid reagent, a kit and a detection method for detecting poison hemlock. Background Art

[0002] Cicuta virosa L. is a perennial herbaceous plant of the Apiaceae family with about 20 species. There are two species in my country: the original variant of poison hemlock and the broad-leaved poison hemlock. The height of the plant of the genus Cicuta can reach 70 to 100 cm. It grows under mixed woods, wetlands or ditches at an altitude of 400-2900 meters. Both the dry and fresh grass of the genus Cicuta are poisonous. The whole plant is poisonous, among which the rhizome is the most poisonous, and the toxicity is even greater in early spring and late autumn. Because its appearance is very similar to celery, it is often mistaken for mountain celery, water celery and other plants and is eaten, resulting in poisoning of the eater. The toxic components of poison hemlock are cincutoxin and cicutin. The poisoning occurs very quickly, mainly causing excitement of the central nervous system, and has a significant spasmogenic effect. After poisoning, it can manifest as nausea, abdominal distension, dilated pupils, and coma, convulsions, and even death from suffocation in severe cases.

[0003] Currently, the identification of poison hemlock is mostly based on morphology or the detection of toxic components using chromatography. However, morphological identification is difficult for non-professionals to master, and chromatography is relatively complex and time-consuming. Summary of the invention

[0004] The purpose of the present disclosure is to provide a nucleic acid reagent, a kit and a detection method for rapid and accurate detection of poison hemlock with high specificity and sensitivity.

[0005] In order to achieve the above-mentioned object, the present disclosure provides a nucleic acid reagent for detecting poison hemlock, wherein the nucleic acid reagent is designed for the ITS1 gene of poison hemlock.

[0006] Optionally, the nucleic acid reagent includes the primers shown in SEQ ID NO.1-2 and the probe shown in SEQ ID NO.3.

[0007] Optionally, the primer shown in SEQ ID NO.1 can be an upstream primer CV-F: TACGAAATCGGGCGCGGAAA; the primer shown in SEQ ID NO.2 can be a downstream primer CV-R: CCGTTGCCGAGAGTCGTTTGTG; the probe shown in SEQ ID NO.3 can be: 5'-TTGCACGTGCCTTCCCGTACGCGGGAAG-3'.

[0008] Optionally, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end of the probe is labeled with a fluorescent quencher group.

[0009] Optionally, the fluorescent reporter group is selected from a FAM group, a VIC group, a JOE group and a HEX group, and the fluorescent quencher group is selected from a TAMAR group, a BHQ1 group, a BHQ2 group and a MGB group;

[0010] Optionally, the fluorescent reporter group is a FAM group, and the fluorescent quencher group is a MGB group.

[0011] The present disclosure also provides a kit for detecting poison hemlock, which contains any one of the nucleic acid reagents described above.

[0012] Optionally, the kit further comprises a blank control, a negative control and a positive control.

[0013] Optionally, the blank control may be ddH2O, the negative control may be genomic DNA containing no poison hemlock components, and the positive control may be genomic DNA containing poison hemlock components.

[0014] The present disclosure also provides use of any of the above-mentioned nucleic acid reagents in the preparation of a kit for detecting poison hemlock.

[0015] The present disclosure also provides use of any of the above-mentioned nucleic acid reagents or kits in detecting poison hemlock or poison hemlock components in a sample.

[0016] The present disclosure also provides a method for detecting poison hemlock, the method comprising:

[0017] Extracting nucleic acid from the sample to obtain sample DNA;

[0018] The sample DNA is subjected to a real-time fluorescent PCR reaction using any of the nucleic acid reagents described above.

[0019] The sample may be a poison hemlock plant, a processed product of a poison hemlock plant, a plant containing poison hemlock, or a processed product of a plant containing poison hemlock. The nucleic acid in the sample may be extracted by a boiling method or a commercial kit to obtain sample DNA.

[0020] Optionally, the reaction system of the real-time fluorescent PCR reaction can be:

[0021] 2× Taqman PCR Mix premix reagent 12.5 μL;

[0022] Upstream primer (10 μmol / L) 0.6 μL;

[0023] Downstream primer (10 μmol / L) 0.6 μL;

[0024] Probe (10 μmol / L) 0.6 μL;

[0025] Sample DNA (1-100 μmol / L) 0.6 μL;

[0026] ddH2O 10.1μL.

[0027] Optionally, the conditions of the real-time fluorescence PCR reaction may be:

[0028] a: 95℃10min;

[0029] b: 95℃15s;

[0030] c: 60℃20s, collecting fluorescence signals; a cycle is 1 reaction, bc cycles are 40 reactions.

[0031] Optionally, the method further includes:

[0032] Use any of the above nucleic acid reagents to perform real-time fluorescence PCR reaction on blank control, negative control and positive control, and make the following judgments:

[0033] If the test results of the blank control, negative control and positive control are established, the test results of the sample DNA are valid;

[0034] If the amplification curve detected by the fluorescent channel of the sample DNA is S-shaped and the Ct value is ≥40, the test result is determined to be negative;

[0035] If the amplification curve detected by the fluorescent channel of the sample DNA is S-shaped and the Ct value is ≤36, the test result is determined to be positive;

[0036] If the amplification curve detected by the fluorescence channel is S-shaped and 36<Ct value<40, the sample DNA is re-extracted and retested. If the amplification curve obtained by the retest is S-shaped and the Ct value is <40, the test result is judged to be positive, otherwise it is negative.

[0037] Optionally, when a real-time fluorescence PCR reaction is performed on a blank control substance, a real-time fluorescence PCR reaction is performed using ddH2O as a template, and a Ct value detected by a fluorescence channel is greater than or equal to 40, then the detection result of the blank control substance is determined to be valid;

[0038] When the negative control is subjected to real-time fluorescence PCR reaction, the real-time fluorescence PCR reaction is carried out using the non-poison hemlock component genomic DNA as a template. If the Ct value of the fluorescence channel detection is greater than or equal to 40, the detection result of the negative control is determined to be valid;

[0039] When the real-time fluorescence PCR reaction is performed on the positive control, the real-time fluorescence reaction is performed using the genomic DNA containing the poison hemlock component as a template. If the Ct value of the fluorescence channel detection is less than or equal to 36, the detection result of the positive control is determined to be valid.

[0040] The beneficial effects of the present disclosure are:

[0041] By using the nucleic acid reagent, kit or method provided in the present disclosure, it is possible to quickly and accurately detect or identify poison hemlock in a sample to be tested, with good sensitivity and specificity.

[0042] Other features and advantages of the present disclosure will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the specific embodiments of the present disclosure or the technical solutions in the prior art, the drawings required for use in the specific embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0044] Figure 1 is a specific fluorescence curve diagram of the poison hemlock sample detected by Example 1 of the present disclosure;

[0045] Figure 2 is a specific fluorescence curve diagram of the evaluation template at various concentrations in Example 2 of the present disclosure;

[0046] Figure 3 is a standard curve diagram drawn in Example 2 of the present disclosure;

[0047] Figure 4 3 is a specific fluorescence curve diagram of each specific evaluation sample in Example 3 of the present disclosure. DETAILED DESCRIPTION

[0048] The following examples are provided to further better understand the present disclosure, but are not limited to the best implementation mode described herein, and do not limit the content and protection scope of the present disclosure. Any product identical or similar to the present disclosure that is obtained by anyone under the inspiration of the present disclosure or by combining the features of the present disclosure with other prior arts shall fall within the protection scope of the present disclosure.

[0049] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the field can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be obtained commercially.

[0050] The sources of the biological material samples involved in the embodiments of the present disclosure are as follows:

[0051] Poison hemlock sample: from the Institute of Botany, Chinese Academy of Sciences, collected from Songshan, Yanqing, Beijing, identified as poison hemlock by morphology and molecular analysis.

[0052] Celery sample: purchased from the market and identified as Celery through morphology and molecular analysis.

[0053] Water celery sample: collected from Yudu Mountain in Yanqing, Beijing, and identified as water celery through morphology and molecular analysis.

[0054] Poisonous cucumber sample: collected from Kurdening Town, Gongliu County, Yili Kazakh Autonomous Prefecture, Xinjiang, and identified as poisonous cucumber through morphology and molecular analysis.

[0055] Example 1 Detection method and detection result determination

[0056] 1. Primer and probe synthesis

[0057] The GenBank database (https: / / www.ncbi.nlm.nih.gov / genbank / ) was used to search for specific sequences of Cicuta, and the ITS1 gene was determined to be used. Its GenBank Accession number is MH807966.1. Real-time fluorescence PCR specific amplification primers and probes were designed and synthesized.

[0058] The primer sequences for real-time fluorescence PCR detection of poison hemlock components are:

[0059] Upstream primer CV-F: TACGAAAATCGGGCGCGGAAA;

[0060] Downstream primer CV-R: CCGTTGCCGAGAGTCGTTTGTG.

[0061] The fluorescent probe sequence for real-time fluorescent PCR detection of poison hemlock components is: 5'-TTGCACGTGCCTTCCCGTACGCGGGAAG-3', and the 5' end of the fluorescent probe is labeled with FAM and the 3' end is labeled with MGB.

[0062] 2. Extraction and purification of sample DNA

[0063] (1) Take 0.5 g of poison hemlock sample, crush it and put it into a 50 ml centrifuge tube;

[0064] (2) Add 10 mL of preheated CTAB extraction and lysis buffer (add 20 μL of proteinase K, 20 μL of RNA, and 200 μL of β-mercaptoethanol before use), oscillate and suspend, incubate at 65 °C for 1 h, shake continuously, cool to room temperature, and centrifuge at 5000 g for 10 min;

[0065] (3) Take 950 μL of the supernatant and add it to a 2 mL centrifuge tube. Add an equal volume of chloroform and isoamyl alcohol (volume ratio 24:1), mix gently, let stand for 5 min, and centrifuge at 12000 rpm for 15 min.

[0066] (4) Take 750 μL of the supernatant and add it to a 2 mL centrifuge tube. Add an equal volume of chloroform and isoamyl alcohol (volume ratio 24:1), mix gently, let stand for 5 min, and centrifuge at 12000 rpm for 15 min.

[0067] (5) Take 500 μL of the supernatant and add it to a 1.5 mL centrifuge tube. Add 300 μL of isopropanol and 50 μL of potassium acetate solution. Gently invert to mix. Let stand at room temperature. Centrifuge at 12,000 rpm and discard the supernatant.

[0068] (6) Add 1.0 mL of 70% ethanol solution to suspend the precipitate, tilt the centrifuge tube, gently rotate it for several turns, let it stand at room temperature for 2 min, centrifuge it at 12,000 rpm for 10 min, discard the supernatant, and repeat this step once more if there is a precipitate.

[0069] (7) Carefully discard the supernatant, dry the DNA precipitate, add 50-100 μL ddH20, and dissolve the DNA at 65°C to obtain sample DNA.

[0070] 3. Build a testing system

[0071] (1) Sample measurement

[0072] Dilute the upstream primer, downstream primer and probe to 10 μmol / L respectively and prepare the reaction system as follows:

[0073]

[0074] Add the prepared template DNA solution to the real-time fluorescence PCR reaction tube, cover the tube tightly, centrifuge for 5-10 seconds, and then place the reaction tube with the sample into the real-time fluorescence detection system. Select FAM as the reporter group. The reaction procedure is as follows:

[0075] a: 95℃10min;

[0076] b: 95℃15s;

[0077] c: 60℃20s, collect fluorescence signals; a cycle is 1 reaction, bc cycle is 40 reactions. The specific fluorescence curve of the poison hemlock sample obtained by detection is as follows Figure 1 shown.

[0078] (2) Blank control: Using ddH2O as template, repeat the operation (1) to perform real-time fluorescence PCR reaction.

[0079] (3) Negative control: Using double distilled water as the template, repeat the procedure (1) and perform real-time fluorescence PCR reaction.

[0080] (4) Positive control: Using genomic DNA containing poison hemlock components as a template, repeat the procedure (1) and perform a real-time fluorescence reaction.

[0081] 4. Result determination

[0082] If the Ct value of the blank control fluorescent channel detection is greater than or equal to 40, the Ct value of the negative control fluorescent channel detection is greater than or equal to 40, and the Ct value of the positive control fluorescent channel detection is less than or equal to 36, then the test results of the blank control, the negative control and the positive control are determined to be valid, and the test result of the sample DNA is valid;

[0083] If the amplification curve detected by the fluorescent channel of the sample DNA is S-shaped and the Ct value is ≥40, it is determined that no poison hemlock component is detected in the sample;

[0084] If the amplification curve detected by the fluorescent channel of the sample DNA is S-shaped and the Ct value is ≤36, it is determined that poison hemlock components are detected in the sample;

[0085] If the amplification curve detected by the fluorescence channel of the sample DNA is S-shaped, and 36<Ct value<40, the sample DNA is re-extracted and re-tested. If the amplification curve obtained by the re-test is S-shaped, and the Ct value is <40, it is determined that poison hemlock components are detected in the sample; otherwise, it is determined that poison hemlock components are not detected in the sample.

[0086] Example 2 Minimum detection limit verification

[0087] Evaluation test sample: The sample DNA prepared in operation 2 of Example 1 was prepared at a concentration of 2.5×10 1 copies / mL, 2.5×10 2 copies / mL, 2.5×10 3 copies / mL, 2.5×10 4 copies / mL, 2.5×10 5 copies / mL, 2.5×10 6 copies / mL, 2.5×10 7 Template for evaluation of copies / mL.

[0088] The evaluation templates of each concentration were tested according to the detection method of Example 1, and each concentration gradient was tested 5 times, and the average value was taken as the final test result, as shown in Table 1 and Figure 2 Draw the standard curve as shown Figure 3 shown.

[0089] Table 1 Results of minimum detection limit verification experiment

[0090] concentration Detection rate <![CDATA[2.5×10 1 copies / mL]]> +，4 / 5 <![CDATA[2.5×10 2 copies / mL]]> +，5 / 5 <![CDATA[2.5×10 3 copies / mL]]> +，5 / 5 <![CDATA[2.5×10 4 copies / mL]]> +，5 / 5 <![CDATA[2.5×10 5 copies / mL]]> +，5 / 5 <![CDATA[2.5×10 6 copies / mL]]> +，5 / 5 <![CDATA[2.5×10 7 copies / mL]]> +，5 / 5

[0091] Note: “+” represents positive, n / 5 represents the detection rate of 5 repeated n times

[0092] From Table 1 and Figure 2 It can be seen that the nucleic acid reagent or kit disclosed herein has a concentration of 2.5×10 1 It can still be detected when the detection sensitivity is 0.1 copies / mL, indicating that the nucleic acid reagent or kit disclosed in the present invention is high.

[0093] Example 3 Specificity Verification

[0094] Other plant samples that are easily confused with poison hemlock, such as water celery, water celery, and poison ginseng, are selected as specificity evaluation samples. The nucleic acid reagent or kit provided by the present disclosure is used to detect the above specificity evaluation samples according to the detection method of Example 1. The detection results are as follows: Figure 4 As shown, Figure 4 Curve 1 is the fluorescence curve of the poison hemlock sample, curve 2 is the fluorescence curve of the herbaceous celery sample, curve 3 is the fluorescence curve of the water celery sample, and curve 4 is the fluorescence curve of the poisonous ginseng sample.

[0095] Depend on Figure 4 It can be seen that under the conditions that blank control, negative control and positive control are established, no non-specific fluorescence signals appear in the detection results of the specificity evaluation samples, indicating that the nucleic acid reagent or kit disclosed in the present invention can effectively distinguish non-detection target plants and has good specificity.

[0096] The preferred embodiments of the present disclosure are described in detail above; however, the present disclosure is not limited to the specific details in the above embodiments. Within the technical concept of the present disclosure, a variety of simple modifications can be made to the technical solution of the present disclosure, and these simple modifications all fall within the protection scope of the present disclosure.

[0097] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction, for example, the detection target of tube A and the detection target of tube B can be interchangeable. In order to avoid unnecessary repetition, the present disclosure will not further describe various possible combinations.

[0098] In addition, various embodiments of the present disclosure may be arbitrarily combined, and as long as they do not violate the concept of the present disclosure, they should also be regarded as the contents disclosed by the present disclosure. Sequence Listing <110> Institute of Occupational Health and Poison Control, Chinese Center for Disease Control and Prevention <120> Nucleic acid reagent, kit and detection method for detecting poison hemlock <130> HFY20220147-FM <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 tacgaaatcg ggcgcggaaa 20 <210> 2 <211> twenty two <212> DNA <213> Artificial Sequence <400> 2 ccgttgccga gagtcgtttg tg 22 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <400> 3 ttgcacgtgc cttcccgtac gcgggaag 28

Claims

1. A nucleic acid reagent for detecting poison hemlock, characterized in that: The nucleic acid reagent includes the primers shown in SEQ ID NO.1-2 and the probe shown in SEQ ID NO.

3.

2. The nucleic acid reagent according to claim 1, characterized in that The 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end of the probe is labeled with a fluorescent quencher group.

3. The nucleic acid reagent according to claim 2, characterized in that The fluorescent reporter group is selected from the group consisting of a FAM group, a VIC group, a JOE group and a HEX group, and the fluorescent quencher group is selected from the group consisting of a TAMAR group, a BHQ1 group, a BHQ2 group and a MGB group.

4. The nucleic acid reagent according to claim 3, characterized in that The fluorescent reporter group is a FAM group, and the fluorescent quencher group is a MGB group.

5. A kit for detecting poison hemlock, characterized in that: The kit contains the nucleic acid reagent according to any one of claims 1 to 4.

6. The kit according to claim 5, characterized in that The kit also includes a blank control substance, a negative control substance and a positive control substance.

7. Use of the nucleic acid reagent according to any one of claims 1 to 4 in the preparation of a kit for detecting poison hemlock.

8. Use of the nucleic acid reagent according to any one of claims 1 to 4 or the kit according to claim 5 or 6 in detecting poison hemlock or poison hemlock components in a sample.

9. A method for detecting poison hemlock, characterized in that The method includes: Extracting nucleic acid from the sample to obtain sample DNA; The sample DNA is subjected to a real-time fluorescent PCR reaction using the nucleic acid reagent described in any one of claims 1 to 4.

10. The method according to claim 9, characterized in that The method further comprises: The blank control, negative control and positive control are respectively subjected to real-time fluorescence PCR reaction using the nucleic acid reagent described in any one of claims 1 to 4, and the following determination is performed: If the test results of the blank control, negative control and positive control are established, the test results of the sample DNA are valid; If the amplification curve detected by the fluorescent channel of the sample DNA is S-shaped and the Ct value is ≥40, the test result is determined to be negative; If the amplification curve detected by the fluorescent channel of the sample DNA is S-shaped and the Ct value is ≤36, the test result is determined to be positive; If the amplification curve detected by the fluorescence channel is S-shaped and 36<Ct value<40, the sample DNA is re-extracted and retested. If the amplification curve obtained by the retest is S-shaped and the Ct value is <40, the test result is judged to be positive, otherwise it is negative.

Images