Prokaryotic soluble expression method and application of recombinant African swine fever virus EP153R subunit transmembrane protein
By optimizing the EP153R protein sequence and achieving its soluble expression and purification in E. coli, the problem of difficulty in preparing effective EP153R protein on a large scale in the prior art is solved, and an important raw material for developing African swine fever vaccines is provided.
Patent Information
- Application Number
- CN202110289634.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-03-15
- Publication Date
- 2025-07-01
- Estimated Expiration
- 2041-03-15
AI Technical Summary
The prior art is difficult to prepare effective African swine fever virus EP153R protein on a large scale, resulting in the inability to develop effective vaccines or therapeutic drugs.
By optimizing the amino acid sequence of the EP153R protein, a suitable prokaryotic expression vector pET28a was designed, and soluble expression and purification were achieved in E. coli, a recombinant African swine fever virus EP153R subunit transmembrane protein was obtained.
The EP153R protein was effectively expressed and purified in E. coli, which overcomes the problem of low expression yield in the prior art, and provides an important raw material for preparing vaccines.
Smart Images

Figure BDA0002976884960000041 
Figure BDA0002976884960000051 
Figure BDA0002976884960000052
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of veterinary biological products. It relates to a prokaryotic soluble expression method and application of a recombinant African swine fever virus EP153R subunit transmembrane protein. Background Art
[0002] African swine fever (ASF) is an acute, febrile, highly contagious disease of pigs caused by African swine fever virus (ASFV), with a morbidity and mortality rate as high as 100%. After pigs are infected with ASFV, clinical symptoms characterized by skin congestion, bleeding of internal organs, and high fever appear. Pigs are the only mammalian hosts for natural infection with ASFV, including domestic pigs and wild boars, especially domestic pigs, which are highly susceptible and have a huge impact on the livestock industry. The World Organization for Animal Health has classified it as a Class A disease, and China has also classified it as a Class I animal infectious disease.
[0003] This disease was first confirmed in Kenya, Africa in 1921, causing a great blow to the pig farming industries in many countries in Africa and even the world. Since August 2018, it has broken out in many provinces in China, bringing serious economic losses to the pig farming industry in China. Although domestic and foreign scholars have done a lot of research on African swine fever, it has been found that the effect of conventionally prepared African swine fever inactivated vaccines is not obvious, while the protective effect of attenuated vaccines is also not good, and the safety is poor, and it is easy to cause virus dispersion. At present, there is no effective vaccine for preventing African swine fever and no drug for treating this disease in the world. There is an urgent need for the research and development and production of new vaccines to prevent African swine fever.
[0004] ASFV is an insect-borne DNA virus with an envelope. The virus particles have an icosahedral symmetric structure, an average diameter of 200nm, and are covered with a capsule containing glycolipids on the surface. The viral genome is a double-stranded linear DNA with a size of 170-190kb. The entire genome has approximately 150 ORFs, encoding 150-200 proteins. The EP153R protein is a viral transmembrane protein encoded by the EP153R gene. The EP153R gene is 474bp in length and encodes a lectin-like membrane protein containing 153 to 163 amino acids. It has significant homology with the N-terminal region of the CD44 molecule, and has multiple potential N-glycosylation, phosphorylation, and myristoylation sites in the protein. The EP153R protein contains a central transmembrane region C-type animal agglutination domain and a cell attachment sequence. The EP153R gene is expressed in both the early and late stages of virus infection. The EP153R protein is a multifunctional protein that can regulate cell apoptosis. The C-type animal agglutination domain has an inhibitory effect on the expression of MHC-I class antigens and is involved in the blood cell adsorption process after ASFV infected cells. In the absence of the possibility of large-scale preparation of inactivated or attenuated vaccines, it is of great significance to determine a method for preparing the immunogenic protein of the virus in order to study a vaccine that can prevent the disease or a subunit protein that can prevent the disease. Summary of the invention
[0005] In order to enable large-scale production of EP153R protein, the present invention provides a prokaryotic soluble expression method and application of a recombinant African swine fever virus EP153R subunit transmembrane protein.
[0006] In order to achieve the above-mentioned object, the present invention provides a recombinant African swine fever virus EP153R subunit transmembrane protein, the amino acid sequence of which is shown in SEQ ID NO.3, and the gene sequence is shown in SEQ ID NO.1.
[0007] According to another aspect of the present invention, the present invention provides a prokaryotic soluble expression method of a recombinant African swine fever virus EP153R subunit transmembrane protein, the prokaryotic soluble expression method comprising the following steps:
[0008] 1) According to the codon preference characteristics of Escherichia coli, the gene encoding the EP153R protein of the African swine fever virus was artificially optimized and synthesized, wherein the amino acid sequence is shown in SEQ ID NO.3, and the gene sequence is shown in SEQ ID NO.1;
[0009] 2) The codon-optimized gene encoding the EP153R protein of the African swine fever virus, such as the gene sequence shown in SEQ ID NO.1, was cloned into the prokaryotic expression vector pET28a to obtain a recombinant plasmid containing the gene encoding the subunit protein of the African swine fever virus EP153R;
[0010] 3) Expression and purification of the transmembrane protein of the EP153R subunit:
[0011] Transfer the recombinant plasmid screened in step 2) into an Escherichia coli strain for induced expression. Through cultivation and screening, a highly expressing strain is obtained. Ferment and culture this highly expressing strain, then perform lysis and centrifugation. Add the supernatant collected by centrifugation to a nickel column for separation and purification. Finally, add an imidazole elution solution to elute the target protein to obtain an imidazole elution solution containing the EP153R protein, and then replace this imidazole elution solution containing the EP153R protein with a phosphate buffer solution to obtain the soluble fusion protein of the African swine fever virus EP153R subunit.
[0012] Here, the prokaryotic expression vector of the transmembrane protein of the African swine fever virus EP153R subunit is constructed as follows:
[0013] Design PCR primers and perform PCR amplification on the synthesized EP153R subunit protein-encoding gene. The primer sequences are as follows:
[0014] The upstream primer is F: AGG CCATGG CGTTCAGCAACAAG, with the underlined part being the Nco I restriction enzyme site;
[0015] The downstream primer is R: GCA CTCGAG TTAGTGGTGGTGGTGGTGGTGCTT, with the underlined part being the Xho I restriction enzyme site;
[0016] Use Nco I and Xho I to double-digest the PCR product and the pET28a prokaryotic expression vector respectively, and screen for positive recombinant plasmids.
[0017] In the preferred technical solution of the present invention, in step 2), the prokaryotic expression vector is pET28a.
[0018] In the preferred technical solution of the present invention, in step 3), the Escherichia coli strain is selected from one of the C43(DE3) strain and the C41(DE3) strain.
[0019] In the preferred technical solution of the present invention, in step 3), IPTG is used as the inducer for the induced expression.
[0020] In the preferred technical solution of the present invention, in step 3), the induction temperature during the induced expression is 20 - 25 °C, and the induction time is 8 - 12 h.
[0021] In the preferred technical solution of the present invention, in step 3), the imidazole elution solution is a mixed solution of buffer A and buffer B, or buffer B; the concentration of the imidazole elution solution is 20 mM, 50 mM, or 500 mM.
[0022] In a preferred technical solution of the present invention, in step 3), the imidazole eluent is a mixture of buffer A: buffer B = 24:1, a mixture of buffer A: buffer B = 9:1, and buffer B containing 500 mM imidazole.
[0023] In a preferred technical solution of the present invention, in step 3), Buffer A is 50 mM NaH2PO4, 500 mM NaCl, 0.05% Tween 20, pH 7.4; Buffer B is 50 mM NaH2PO4, 500 mM NaCl, 500 mM imidazole, 0.05% Tween 20, pH 7.4.
[0024] In a preferred technical solution of the present invention, in step 3), the phosphate buffer is 50 mM NaH2PO4, 500 mM NaCl, 0.05% Tween 20, pH 7.4.
[0025] According to another aspect of the present invention, the present invention provides an application of the African swine fever virus EP153R subunit soluble fusion protein in the preparation of vaccines for diagnosing, preventing, and treating African swine fever.
[0026] Compared with the prior art, the expression sequence, expression vector, and corresponding purification and preparation method disclosed in the present invention overcome the defects in the prior art and solve the problems that the EP153R protein cannot be directly and highly soluble expressed in Escherichia coli and the yield is low. The present invention can directly and solubly express EP153R in Escherichia coli, overcomes many problems in the prior art, and has a simple preparation method and low cost. Description of the Drawings
[0027] Figure 1 Shows the comparison results of the EP153R gene sequence before and after optimization.
[0028] Figure 2 Shows the plasmid map of pET28a-OPTI-EP153R.
[0029] Figure 3 Shows the SDS-PAGE detection results of the induced expression of pET28a-OPTI-EP153R as Figure 3 shown, where M is the Marker, 1 is the supernatant before induction, 2 is the precipitate before induction, 3 is the supernatant after induction, 4 is the precipitate after induction, and the arrow points to the EP153R protein. It can be seen from the figure that the target protein is solubly expressed.
[0030] Figure 4The SDS-PAGE purification detection results of the recombinant EP153R are shown: 1 is the EP153R protein, and 2 is the purified protein Marker.
[0031] Figure 5 The Western-blot detection results after the purification of the EP153R protein are shown: 1 is the EP153R protein, and 2 is the purified protein Marker. Detailed implementation manners
[0032] The present invention will be further described below in conjunction with the drawings and embodiments. The embodiments of the present invention are only used to illustrate the technical solutions of the present invention and do not limit the present invention.
[0033] The strains, plasmids and reagents used in the embodiments of the present invention are all commercially available products.
[0034] Example 1 Expression and preparation of the EP153R protein
[0035] 1.1 Selection of the African swine fever EP153R protein
[0036] The African swine fever transmembrane protein EP153R is a polypeptide encoded by the EP153R gene. Existing studies have shown that the EP153R gene is expressed both in the early and late stages of virus infection, regulates cell apoptosis, the C-type animal lectin domain has an inhibitory effect on the expression of MHC-I antigens, and is involved in the hemadsorption process after ASFV infects cells. Therefore, using the EP153R protein as an antigen has good prevention and control effects on African swine fever infection. Although the EP153R protein has been reported to be expressed in eukaryotic expression systems. However, there is no report yet on the soluble expression of the full length and purification of this protein in a prokaryotic expression system, which is also an important technical problem to be solved by the present invention.
[0037] 1.2 Codon optimization of the African swine fever EP153R protein
[0038] In our laboratory, using the African swine fever virus strain subtype reported in China in 2018 and referring to the full gene sequence of Georgia 2007 / 1 (GenBank: FR682468.1) as a template, the nucleotide sequence of EP153R encoding the African swine fever EP153R protein was codon-optimized to obtain the OPTI-EP153R sequence, as shown in SEQ ID NO.1. The synthesis work of this sequence was entrusted to Nanjing Genscript Biotech Co., Ltd. As Figure 1 shown, 30% of the nucleotide sequences are different before and after optimization.
[0039] 1.3 Construction of the pET28a-OPTI-EP153R recombinant plasmid
[0040] 1.3.1 PCR Amplification of the Target Fragment OPTI-EP153R
[0041] 1.3.1.1 PCR Reaction
[0042] (1) Primer Design and Synthesis
[0043] Forward Primer: 5’-AGG CCATGG CGTTCAGCAACAAG-3’
[0044] Reverse Primer: 5’-GCA CTCGAG TTAGTGGTGGTGGTGGTGGTGCTT-3’
[0045] (2) The reaction system is 50 μL as shown in the following table:
[0046]
[0047]
[0048] PCR Amplification Program:
[0049]
[0050] 1.3.1.2 Gel Extraction of PCR Products
[0051] (1) Label the sample collection EP tubes, adsorption columns, and collection tubes;
[0052] (2) Weigh the labeled empty EP tube and record the value;
[0053] (3) Carefully cut the single target DNA band from the agarose gel with a scalpel on the gel cutter and put it into a clean 1.5 mL centrifuge tube;
[0054] (4) Add 600 μL of PC buffer to the 1.5 mL centrifuge tube in step (3), place it in a 50 °C water bath for about 5 min, and gently invert the centrifuge tube up and down continuously during this period to ensure that the gel block is fully dissolved;
[0055] (5) Column equilibration: Add 500 μL of equilibration buffer BL to the adsorption column CB2 (the adsorption column is pre-placed in the collection tube), centrifuge at 12,000 rpm / min for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube;
[0056] (6) Add the solution obtained in step (5) to the adsorption column CB2, let it stand for 2 min, centrifuge at 10,000 rpm / min for 30 s, pour out the waste liquid in the collection tube, and then put the adsorption column CB2 into the collection tube;
[0057] (7) Add 600 μL of washing buffer PW buffer to the adsorption column, let it stand for 3 min, centrifuge at 10,000 rpm / min for 30 s, pour out the waste liquid in the collection tube, and place the adsorption column CB2 into the collection tube;
[0058] (8) Repeat step (7);
[0059] (9) Centrifuge the empty adsorption column at 12,000 rpm / min for 2 min to remove the washing buffer as much as possible. Place the adsorption column at room temperature for 10 min to dry it thoroughly;
[0060] (10) Place the adsorption column CB2 into the collection tube, and suspend and add 50 μL of Elution buffer (preheated at 65 °C) to the middle position of the adsorption membrane. Let it stand for 3 min, and centrifuge at 12,000 rpm / min for 2 min;
[0061] (11) Take out the centrifuge tube in step (10) from the centrifuge, discard the middle adsorption column CB2, cover the centrifuge tube lid, and retain the DNA sample in the centrifuge tube;
[0062] (12) Store the DNA sample in step 11 at 4 °C, and prepare to identify the gel-extracted DNA fragment by agarose gel electrophoresis.
[0063] 1.3.2 Double digestion reaction of PCR product and vector
[0064] (1) Label the required 1.5 mL EP tubes, and add samples and mix them in the 1.5 mL EP tubes according to the following table: 50 μL reaction system
[0065]
[0066] (2) Place the 1.5 mL EP tube in step (1) in a water bath at the optimal temperature of the corresponding enzyme for 2 - 3 h.
[0067] Gel extraction of double digestion products: Take out the above double digestion system, perform agarose gel electrophoresis to extract the DNA fragment therein, and the method is the same as the gel extraction of PCR products in 1.2.1.
[0068] 1.3.3 Ligation reaction
[0069] (1) Prepare several clean 1.5 mL EP tubes, make marks, and place them on the EP tube rack for later use.
[0070] (2) Add samples and mix them in the 1.5 mL EP tube according to the following table.
[0071]
[0072] (3) After adding samples according to the table in step (2), place each 10 μl reaction system in a 16 °C low-temperature coolant circulator and water bath for 10 - 16 h;
[0073] (4) Take out the EP tube in step (3) and place it in a 65 °C water bath for 15 min;
[0074] (5) Take out the EP tube in step (4) and store it at 4 °C.
[0075] 1.3.4 Transformation reaction
[0076] (1) Quickly add 10 μL of the ligation reaction solution to 100 μL of competent cells, pipette and mix well, and ice bath for 30 min;
[0077] (2) Take out the sample tube, place it in a 42 °C water bath for 100 s, and then immediately ice bath for 2 min;
[0078] (3) Take out the sample tube. In a laminar flow hood, add 600 μL of liquid LB medium to the sample tube, and then place the sample tube on a 37 °C constant temperature shaker at 220 rpm / min for 1 h;
[0079] (4) Plating: Take out the sample tube in step (3), centrifuge at room temperature at 8,000 rpm / min for 2 min, discard 600 μL of the supernatant, resuspend the bacteria at the bottom of the tube with the remaining supernatant, place the resuspended bacterial solution in the center of the corresponding transformation plate, and spread the bacterial solution in the center of the transformation plate evenly with a bacterium spreading rod.
[0080] (5) Place the transformation plate in step (4) upright in a biochemical constant temperature incubator. After culturing at 37 °C for 1 h, invert the transformation plate and culture for 15 h;
[0081] (6) Observe the transformation results.
[0082] 1.3.5 Plasmid extraction and double digestion identification
[0083] 1.3.5.1 Plasmid extraction
[0084] (1) Use a 10 μL pipette tip to pick a single colony from the transformation plate into 5 mL of LB liquid medium containing ampicillin resistance, and shake the bacteria overnight at 37 °C and 220 rpm / min;
[0085] (2) Transfer the bacterial solution to a 1.5 mL EP tube, centrifuge at room temperature at 12,000 rpm / min for 2 min, and discard the supernatant;
[0086] (3) Add 250 μL of plasmid extraction reagent P1 buffer to the EP tube in step (2) and suspend the bacteria thoroughly;
[0087] (4) Add 250 μL of P2 buffer to the solution in step (3), immediately invert the centrifuge tube gently 5 - 10 times to mix evenly, and let it stand at room temperature for 2 - 4 min;
[0088] (5) Add 350 μL of P3 buffer to the solution in step (4), immediately invert the centrifuge tube gently 5 - 10 times to mix evenly; let it stand at room temperature for 2 - 4 min;
[0089] (6) Centrifuge the solution in step (5) at room temperature at 14,000 rpm for 10 min;
[0090] (7) Transfer the supernatant solution in step (6) to the center of the adsorption column, centrifuge at room temperature at 12,000 rpm for 30 s, and pour out the liquid in the collection tube;
[0091] (8) Add 500 μL of Buffer DW1 to the center of the adsorption column, centrifuge at room temperature at 12,000 rpm for 30 s, and pour out the liquid in the collection tube;
[0092] (9) Add 500 μL of wash solution to the center of the adsorption column, centrifuge at room temperature at 12,000 rpm for 30 s, and pour out the liquid in the collection tube. Repeat once;
[0093] (10) Centrifuge the empty adsorption column at room temperature at 12,000 rpm for 2 min.
[0094] (11) Place the adsorption column into a clean 1.5 mL centrifuge tube, add 30 μL of Elution buffer to the center of the adsorption membrane, let it stand at room temperature for 5 min, and centrifuge at room temperature at 12,000 rpm for 2 min. Save the DNA solution in the tube.
[0095] 1.3.5.2 Double digestion identification
[0096] (1) Label the 1.5 mL EP tubes to be used and add samples according to the following table: 20 μL reaction system
[0097]
[0098] (2) Place the 20 μL reaction system in the EP tube in step (1) in a 37 °C constant temperature water bath for 2 h.
[0099] (3) Perform agarose gel electrophoresis on the double digestion system sample in step (2) to check whether the size of the inserted fragment is correct;
[0100] (4) Select the clone with the correct inserted fragment and send it to a sequencing company for sequencing. Save the plasmid with the correct sequencing result for future use.
[0101] 1.4 Expression of African swine fever EP153R protein
[0102] 1.4.1 Transformation of Escherichia coli C43(DE3)
[0103] Absorb 1 μL of plasmid (the plasmid extracted in 1.3.5.1) and add it to 100 μL of Escherichia coli C43(DE3) competent cells, and incubate on ice for 30 min; heat shock at 42 °C for 90 s; incubate on ice for 2 min; add 500 μL of LB culture medium without resistance in the laminar flow hood; shake at 37 °C and 220 rpm for 1 h; absorb 100 μL of the bacterial solution and spread it on a kanamycin-resistant LB plate, and culture overnight at 37 °C. Pick a single clone (Escherichia coli C43(DE3)pET28a-ASFV-EP153R) and add glycerol for storage at -80 °C for later use.
[0104] 1.4.2 Small-scale induction expression
[0105] (1) Activation of the strain in the glycerol storage tube: Thaw the glycerol storage tube of Escherichia coli C43(DE3)pET28a-ASFV-EP153R strain, and use an inoculation loop to pick the bacterial suspension in the glycerol tube and streak it on a kanamycin-resistant plate (50 μg / mL), and culture overnight at 37 °C.
[0106] (2) Pick a single clone for activation: Pick a single clone from the cultured plate and transfer it to 3 mL of kanamycin-resistant LB medium, and culture it on a shaker at 37 °C and 220 r / min for 5 - 6 h until the OD600 reaches 0.5 - 0.8;
[0107] (3) Fermentation inoculation: Take 150 μL of the activated bacterial suspension and inoculate it into 15 mL of kanamycin-resistant LB medium, and culture at 37 °C and 220 r / min;
[0108] (4) Cooling induction: When the OD600 reaches 0.6 - 0.8, take out 5 mL of the bacterial solution, centrifuge at 12,000 rpm for 5 min, and place the bacterial cells at -20 °C for storage, which is the "before induction". Place the remaining bacterial solution in an ice-water bath for 10 min, add 2 μL of 1 M IPTG, and the final concentration of IPTG is 0.2 mM. Lower the shaker temperature to 20 °C and induce for 10 h;
[0109] (5) Bacterial cell collection: After the fermentation is completed, measure the OD600, collect the same amount of bacterial cells as the "before induction", centrifuge at 12,000 r / min for 5 min, and collect the bacterial cells and store them at -20 °C, which is the "after induction".
[0110] The detection results of SDS-PAGE for induction expression are as Figure 3As shown, where M is the Marker, 1 is the supernatant before induction, 2 is the precipitate before induction, 3 is the supernatant after induction, 4 is the precipitate after induction, and the arrow points to the EP153R protein. It can be seen from the figure that the target protein is expressed in a soluble form.
[0111] 1.4.3 Large-scale Inductive Expression
[0112] (1) Activation of the strain in the glycerol preservation tube: Take out the strain glycerol preservation tube and thaw it. Use an inoculation loop to pick up the bacterial suspension in the glycerol tube and streak it on a kanamycin-resistant plate, and culture it overnight at 37°C.
[0113] (2) Pick a single colony for activation: Pick a single colony from the cultured plate into 3 mL of kanamycin-resistant LB medium, and culture it on a shaker at 37°C and 220 r / min for 5 - 6 h until the OD600 reaches 0.5 - 0.8;
[0114] (3) Cultivation of the seed liquid: Take 150 μL of the activated bacterial suspension and inoculate it into 150 mL of kanamycin-resistant LB medium, and culture it at 37°C and 220 r / min for 9 - 10 h;
[0115] (4) Preparation of the fermentation medium: Prepare the components of fermentation medium component 1 according to the fermentation medium formula in a 3 L fermenter, install the combined fermenter, prepare fermentation medium component 2 and the feeding medium in a blue-mouth bottle, and sterilize them at 121°C with high-pressure steam for 20 min.
[0116] (5) Setting of fermentation parameters: Agit 400 r / min; Tempreture 37°C; pH 7.00; DO 40; Air 100%; Gasflow 2.0;
[0117] (6) Fermentation inoculation: Add 450 mL of fermentation medium component 2, 1 mL of fermentation medium component 3, 200 μL of antifoaming agent, and 3 mL of kanamycin antibiotic (50 mg / mL) to the fermenter at the inoculation port; Inoculate the cultured 150 mL of seed liquid into 3 L of fermentation medium for large-scale cultivation in the fermenter, and culture it for 5 - 6 h until the OD600 value reaches 12 - 14;
[0118] (7) Cooling and induction: Set the temperature parameter, lower the temperature of the fermenter to 20°C, take a sample, add 0.9 mL of IPTG (1 M) to make the final concentration of IPTG 0.3 mM, and induce and culture it at 20°C for 8 h;
[0119] (8) Fermentation feeding: When the fermentation culture reaches an OD600 of 17 - 19, continuously add the feeding medium at a rate of 5% (first mix the components 1 and 2 of the feeding medium).
[0120] (9) Bacterial cell collection: After fermentation, the fermentation broth was collected and centrifuged at 8000 r / min for 10 min, and the collected bacterial cells were stored at -20°C.
[0121] Among them, the culture media used in the above process are as follows:
[0122] Components of the fermentation medium 1: Yeast extract 10 g / L, Tryptone 20 g / L, KH2PO4 1.14 g / L, K2HPO4 0.9 g / L, (NH4)2SO4 3.0 g / L, MgSO4·7H2O 0.3 g / L, NaCl 5 g / L, pH 7.0; (Weigh each component of the culture medium according to the amount of 3 L, and add dd H2O to make up the volume to 2.4 L);
[0123] Components of the fermentation medium 2: Glycerol 30 g / L; (Weigh each component of the culture medium according to the amount of 3 L, and add dd H2O to make up the volume to 450 mL);
[0124] Components of the fermentation medium 3: VB1 2 mg / L; (Prepare VB1 at 6 mg / mL and filter sterilize it with 0.22 μm);
[0125] Components of the feeding medium 1: Yeast extract 16.67 g / L; Tryptone 33.33 g / L; (Weigh each component of the culture medium according to the amount of 450 mL, and add dd H2O to make up the volume to 300 mL);
[0126] Components of the feeding medium 2: Glycerol 100 g / L; (Weigh each component of the culture medium according to the amount of 450 mL, and add dd H2O to make up the volume to 150 mL).
[0127] 1.5 Purification of African swine fever EP153R protein
[0128] 1.5.1 Resuspension and disruption of bacterial cells
[0129] Weigh a certain amount of bacterial cells, resuspend them with the lysis buffer and disrupt them with a homogenizer, and centrifuge to collect the supernatant. Before loading, 80 μL of the supernatant and precipitate of the disrupted bacterial cells were respectively sampled for SDS-PAGE analysis.
[0130] 1.5.2 Nickel column purification
[0131] (1) Column equilibration: Equilibrate with ultrapure water for 2 - 3 CV (column volume), and drain the ethanol preservation solution; then equilibrate with Buffer A for 2 - 3 CV.
[0132] (2) Loading: Load the supernatant with a peristaltic pump, set an appropriate flow rate according to the volume of the nickel column, and flow through and collect the flow-through liquid. After mixing, take 80 μL of the flow-through liquid for SDS-PAGE analysis.
[0133] (3) Wash: Wash endotoxin with 30 column volumes (CV) of wash buffer.
[0134] (4) Rinse: Rinse with 10 column volumes (CV) of Buffer A to reduce the residue of Triton X-114.
[0135] (5) Elution:
[0136] Wash impurities with 20 mM imidazole eluent (mixed with buffer A: buffer B = 24:1): Wash impurities with 10 column volumes of 20 mM imidazole eluent, and take 80 μL of the mixture for SDS-PAGE analysis;
[0137] Wash impurities with 50 mM imidazole eluent (mixed with buffer A: buffer B = 9:1): Further wash impurities with 2 column volumes of 50 mM imidazole eluent, and take 80 μL of the mixture for SDS-PAGE analysis;
[0138] Elute the target protein with buffer B: Elute the target protein with buffer B containing 500 mM imidazole and collect it. Take 80 μL of the mixture for SDS-PAGE analysis respectively.
[0139] 1.5.3 Dialysis and buffer exchange
[0140] Pour the imidazole eluent buffer B containing EP153R protein into the dialysis bag, dialyze with buffer A (phosphate solution) at least 1,000 times, and take 80 μl of the sample for testing.
[0141] 1.5.4 Sterile filtration
[0142] In the biosafety cabinet, filter through a 0.22 μm low-protein-binding needle filter, or filter a large amount of protein solution through a sterilized 0.22 μm Nalgene filter membrane. Store the filtered protein solution sample in a -80 °C refrigerator.
[0143] The purification solutions used above are as follows:
[0144] (1) Lysis buffer: 50 mM NaH2PO4, 500 mM NaCl, 0.2% Triton X-114, 0.05% Tween 20, pH 8.0;
[0145] (2) Wash buffer: 50 mM NaH2PO4, 500 mM NaCl, 0.4% Triton X-114, 0.05% Tween 20, pH 7.4;
[0146] (3) Buffer A: 50 mM NaH2PO4, 500 mM NaCl, 0.05% Tween 20, pH 7.4;
[0147] (4) Buffer B: 50 mM NaH2PO4, 500 mM NaCl, 500 mM imidazole, 0.05% Tween 20, pH 7.4.
[0148] 1.6 Identification of African swine fever EP153R protein
[0149] 1.6.1 SDS-PAGE detection
[0150] The purified protein from step 1.5 was subjected to SDS-PAGE detection. The concentration of EP153R protein in the sample used was 1 μg / well. The results are as Figure 4 shown: It can be calculated from the figure that the SDS-PAGE purity of the purified EP153R protein is 70%, and the molecular weight is approximately 19.3 kD.
[0151] 1.6.2 WESTERN-BLOT detection
[0152] The purified protein from step 1.5 was subjected to WESTERN-BLOT detection. The membrane transfer time was 1 h. The antibody used was AntiHis-Tag Mouse, and the dilution ratio was 1:2000. The incubation time was 1 h. The results are as Figure 5 shown: It can be seen from the results in the figure that the purified EP153R protein can bind effectively with the antibody.
[0153] 1.7 Verification of the stability of African swine fever EP153R protein
[0154] The purified protein from Example 1 was diluted to 0.9 mg / ml with PBS and divided into 20 portions, each portion being 0.5 mL; ten portions were placed in a refrigerator at 4°C, and one portion was sampled weekly for 10 consecutive times; ten portions were placed in a refrigerator at -20°C, and one portion was sampled weekly for 10 consecutive times; after each sampling, the protein concentration was detected by BCA. The results are shown in the following table:
[0155]
[0156] Judging from the change in protein concentration, the protein remained basically stable during the two groups of experiments.
[0157] 1.8 Immunogenicity experiment of recombinant EP153R protein
[0158] 1.8.1 Vaccine preparation
[0159] 1.8.1.1 Mix according to the ratio of oil adjuvant: aqueous phase (v:v) = 54:46.
[0160] 1.8.1.2 Antigen preparation: The purified recombinant African swine fever EP153R protein is filtered through a 0.22 μm filter membrane for sterilization, and its concentration and purity are detected for standby.
[0161] 1.8.1.3 Aqueous phase preparation: According to the content of EP153R protein in the vaccine, the EP153R protein is diluted to an appropriate concentration with 1XPBS and stirred for 10 min to make it fully mixed.
[0162] 1.8.1.4 Oil phase preparation: According to the water-oil ratio in 1.8.1.1, an appropriate amount of ISA 201VG adjuvant is measured.
[0163] 1.8.1.5 Emulsification: The requirement for emulsification is that the temperature of the oil phase is 33 ± 1 °C. Turn on the stirrer with a stirring speed of 350 rpm / min. Under stirring conditions, the aqueous phase is added to the oil phase at a constant speed and continuously stirred for 10 min to make the aqueous phase and the oil phase fully mixed and emulsified into a double-phase oil emulsion vaccine.
[0164] 1.8.1.6 Stabilization: After emulsification, turn off the stirrer and place the emulsified vaccine at 20 °C for 1 h for stabilization.
[0165] 1.8.1.7 Sub-packaging and storage: Sub-package according to the immunization requirements and store at 2 - 8 °C for standby after passing the inspection.
[0166] 1.8.2 Immunogenicity experiment
[0167] 1.8.2.1 Mouse immunization experiment
[0168] Take 10 healthy female BALB / c mice weighing about 16 - 18 g, randomly divide them into 2 groups with 5 mice in each group, and use the vaccine prepared in 1.8.1 for immunization experiments. Blood samples are collected before the first immunization and 14 days after the second immunization, and the sera are separated for ELISA antibody detection.
[0169] 1.8.2.2 ELISA detection experiment
[0170] (1) Coating: Dilute the purified EP153R protein to 0.2 μg / ml with coating buffer (50 mM carbonate buffer, pH 9.5), add 100 μl / well to a 96-well plate, seal it with a sealing film, and place it in a 4 °C refrigerator overnight;
[0171] (2) Washing: After taking out the enzyme-linked immunosorbent assay (ELISA) plate from the refrigerator, wash the plate 5 times with PBST;
[0172] (3) Blocking: Add 200 μl of blocking solution (5% skim milk) to each well, seal it with a sealing film, and incubate at 37 °C for 2 h;
[0173] (4) Serum dilution: Dilute the pre-immune serum and the serum 14 days after the second immunization of the mice immunized with EP153R protein 10,000 times with the blocking solution (the dilution method is stepwise dilution: ① Add 5 μl of serum to 495 μl of the diluent; ② Take 5 μl of the serum in ① and add it to 495 μl of the diluent, and mix well.);
[0174] (5) Washing: The same as (2);
[0175] (6) Sample addition: Add the diluted serum, and at the same time use the blocking solution as a negative control, and incubate at 37 °C for 1 h;
[0176] (7) Washing: The same as (2);
[0177] (8) Addition of secondary antibody: Add 100 μl of the HRP-labeled rabbit anti-mouse IgG secondary antibody diluted (dilution ratio is 1:5000) to each well, and incubate at 37 °C for 0.5 h;
[0178] (9) Washing: The same as (2);
[0179] (10) Color development: Add 100 μl of TMB color development solution to each well under light-proof conditions, and incubate at 37 °C for 10 min;
[0180] (11) Termination: Add 50 μl of the termination solution (2M H2SO4) to each well to terminate the reaction;
[0181] (12) Detection: Measure the OD value of the sample at a wavelength of 450 nm and analyze the data;
[0182] (13) The results are shown in the following table: The coated EP153R protein can specifically bind to the serum after immunization with EP153R protein, and the average OD450 value is 2.202; there is no specific binding between the coated EP153R protein and the pre-immune serum of mice, and the average OD450 value is 0.365. This shows that the EP153R protein can be used as an antigen for the Elisa kit, and the immunized serum can specifically bind to the EP153R protein, laying a foundation for the later development of a diagnostic kit for detecting African swine fever infection and immunity and as a candidate antigen for subunit vaccines.
[0183]
[0184]
[0185] The present invention is illustrated by the above embodiments. However, it should be understood that the present invention is not limited to the specific examples and implementation schemes described herein. The purpose of including these specific examples and implementation schemes here is to help those skilled in the art practice the present invention. Any person skilled in the art can easily make further improvements and refinements without departing from the spirit and scope of the present invention. Therefore, the present invention is only limited by the content and scope of the claims of the present invention, and it is intended to cover all alternative and equivalent solutions included within the spirit and scope of the present invention defined by the appended claims.
[0186]
[0187] Sequence Listing <110> Zhejiang Hailong Biotechnology Co., Ltd. <120> A Recombinant African Swine Fever Virus EP153R Subunit Protein, Its Preparation Method and Application <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 477 <212> DNA <213> Codon-Optimized Nucleotide Sequence of EP153R Protein (DNA) <400> 1 atggcgttca gcaacaagaa gtacatcggt ctgatcaaca agaaagaggg cctgaagaaa 60 aagatcgacg attacagcat tctgatcatt ggtatcctga ttggcaccaa catcctgagc 120 ctgatcatca acatcatcgg tgaaatcaac aagccgattt gctaccagaa cgacgataaa 180 attttctatt gcccgaagga ctgggtgggt tacaacaacg tttgctacta ttttggcaac 240 gaggagaaga actacaacaa cgcgagcaac tattgcaagc aactgaacag caccctgacc 300 aacaacaaca ccatcctggt gaacctgacc aaaaccctga acctgaccaa gacctataac 360 cacgagagca actactgggt gaactatagc ctgatcaaga acgaaagcgt tctgctgcgt 420 gatagcggct actataaaaa gcagaaacac gttagcctgc tgtacatttg cagcaag 477 <210> 2 <211> 474 <212> DNA <213> Nucleotide sequence (DNA) of the EP153R protein before codon optimization <400> 2 atgttttcta acaaaaagta catcggtctt atcaataaga aggagggttt gaaaaaaaaa 60 atagatgatt atagtatatt aataattgga atattaattg gaactaacat cttaagcctt 120 attataaata taataggaga gattaataaa ccaatatgtt accaaaatga tgataagata 180 ttttattgcc ctaaagattg ggttggatat aataatgttt gttattattt tggcaatgaa 240 gaaaaaaatt ataataatgc aagtaattat tgtaagcaat taaatagtac gcttactaat 300 aataatacta ttttagtaaa tcttactaaa acattaaatc ttactaaaac atataatcac 360 gaatctaatt attgggttaa ttattcttta attaaaaatg agtcagtact attacgtgat 420 agtggatatt acaaaaaaca aaaacatgta agtttattat atatttgtag taaa 474 <210> 3 <211> 159 <212> PRT <213> Amino acid sequence of EP153R protein (PRT) <400> 3 Met Ala Phe Ser Asn Lys Lys Tyr Ile Gly Leu Ile Asn Lys Lys Glu 1 5 10 15 Gly Leu Lys Lys Lys Ile Asp Asp Tyr Ser Ile Leu Ile Ile Gly Ile 20 25 30 Leu Ile Gly Thr Asn Ile Leu Ser Leu Ile Ile Asn Ile Ile Gly Glu 35 40 45 Ile Asn Lys Pro Ile Cys Tyr Gln Asn Asp Asp Lys Ile Phe Tyr Cys 50 55 60 Pro Lys Asp Trp Val Gly Tyr Asn Asn Val Cys Tyr Tyr Phe Gly Asn 65 70 75 80 Glu Glu Lys Asn Tyr Asn Asn Ala Ser Asn Tyr Cys Lys Gln Leu Asn 85 90 95 Ser Thr Leu Thr Asn Asn Asn Thr Ile Leu Val Asn Leu Thr Lys Thr 100 105 110 Leu Asn Leu Thr Lys Thr Tyr Asn His Glu Ser Asn Tyr Trp Val Asn 115 120 125 Tyr Ser Leu Ile Lys Asn Glu Ser Val Leu Leu Arg Asp Ser Gly Tyr 130 135 140 Tyr Lys Lys Gln Lys His Val Ser Leu Leu Tyr Ile Cys Ser Lys 145 150 155
Claims
1. A prokaryotic soluble expression method for a recombinant African swine fever virus EP153R subunit transmembrane protein, characterized in that, The prokaryotic soluble expression method includes the following steps: 1) According to the codon preference characteristics of Escherichia coli, the coding gene of African swine fever virus EP153R protein was artificially optimized and synthesized. The amino acid sequence is shown in SEQ ID NO.3, and the gene sequence is shown in SEQ ID NO.
1. 2) The coding gene sequence of African swine fever virus EP153R protein shown in SEQ ID NO.1 after codon optimization was cloned into the prokaryotic expression vector pET28a to obtain a recombinant plasmid containing the coding gene of African swine fever virus EP153R subunit protein. 3) Expression and purification of EP153R subunit transmembrane protein: The recombinant plasmid screened in step 2) was transferred into an Escherichia coli strain for induced expression. A highly expressed strain was obtained through culture and screening. The highly expressed strain was fermented and cultured, then lysed and centrifuged. The supernatant collected by centrifugation was added to a nickel column for separation and purification. Finally, an imidazole eluent was added to elute the target protein to obtain an imidazole eluent containing EP153R protein. Then, the imidazole eluent containing EP153R protein was replaced with a phosphate buffer to obtain the soluble fusion protein of African swine fever virus EP153R subunit.
2. The prokaryotic soluble expression method according to claim 1, wherein In step 3), the Escherichia coli strain is selected from one of the strains C43(DE3) strain and C41(DE3) strain.
3. The prokaryotic soluble expression method according to claim 1, wherein In step 3), IPTG is used as an inducer for the induced expression. The induction temperature is 20-25 °C and the induction time is 8-12 h during the induced expression.
4. The prokaryotic soluble expression method according to claim 1, wherein In step 3), the imidazole eluent is a mixture of buffer A:buffer B = 24:1, a mixture of buffer A:buffer B = 9:1, and buffer B containing 500 mM imidazole; wherein, Buffer A is 50 mM NaH2PO4, 500 mM NaCl, 0.05% Tween 20, pH 7.4; Buffer B is 50 mM NaH2PO4, 500 mM NaCl, 500 mM imidazole, 0.05% Tween 20, pH 7.
4.
5. The prokaryotic soluble expression method according to claim 1, characterized in that In step 3), the phosphate buffer is 50 mM NaH2PO4, 500 mM NaCl, 0.05% Tween 20, pH 7.4.
Citation Information
Patent Citations
CHO cell strain for efficiently expressing African swine fever EP153R protein and construction method of CHO cell strain
CN110862436A
Screening, preparation and application of dominant antigen of African swine fever virus
CN115160411A
African swine fever mRNA vaccine composition and application thereof
CN118001384A
Immunogenic compositions and vaccines comprising african swine fever virus peptides and proteins and uses thereof
US20200306360A1