Aptamer specifically binding to domoic acid and uses thereof

Abstract

The application relates to the technical field of biological medicine engineering, and provides an aptamer specifically combined with chondroitin acid and application thereof. The sequence general formula of the aptamer is 5'-ATTGGCACTCCACGCATAGG-N 40 -CCTATGCGTGCTACC GTGAA-3'; wherein N is any one of A, T, G and C, the four deoxyribonucleotide bases, 40 represents the number of random bases, preferably the sequence shown in any one of SEQ ID NO. 10, SEQ ID NO. 12 and SEQ ID NO. 14, and most preferably the sequence shown in any one of SEQ ID NO. 14. The aptamer can be prepared into a chondroitin acid separation and enrichment reagent, a purification reagent, an antagonist or a neutralizer, and can also be prepared into a chondroitin acid detection reagent, a kit or a sensor, applied to the detection of DA in a drinking water body sample, and can lay a foundation for the preparation of a medicine for preventing or treating DA poisoning and the removal of DA in water bodies or aquatic products.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine engineering, and particularly relates to an aptamer specifically combined with domoic acid and application thereof. BACKGROUND

[0002] Domoic acid (DA) belongs to Amnesic Shellfish Toxins (AST or Amnesic Shellfish Poisoning, ASP), is an excitatory proline derivative and strong neurotoxic biological toxin, and the main symptoms of poisoning are abdominal pain, diarrhea, vomiting, accompanied by memory loss, confusion, unable to recognize family and friends, and the like, and severe poisoning can lead to coma and even death.

[0003] Domoic acid is produced by diatoms of Pseudo-nitzschia and Nitzschia, and when these diatoms proliferate in large quantities, DA can be enriched by filter-feeding of shellfish and clams and accumulated through food chain. After human beings mistakenly eat aquatic products contaminated by DA, amnesic shellfish poisoning occurs, DA can affect the digestive tract, cardiovascular system and central nervous system of human beings and animals, has an excitatory effect on the brainstem region related to visceral function, and has obvious neurotoxic effect on the brain region related to memory. In addition, DA combines with glutamate receptors in the central nervous system (hippocampus) of human beings, causes nervous system paralysis and leads to brain damage. It is found that DA content in shellfish tissue of 40mg / kg can cause poisoning of eaters, 150mg / kg can be fatal, and the maximum tolerable limit of human beings through eating is 20mg / kg. In the world, Canada first established a safety limit standard of 20μg / g shellfish meat, and Europe and Japan also successively listed this toxin as a routine detection item of shellfish.

[0004] The chemical structure of domoic acid is very similar to kainic acid (KA) and glutamate (Glu). Domoic acid has eight isomers of A-H, which may be the reaction products of DA after ultraviolet irradiation, rather than natural products of algae; the main DA contaminated shellfish and crustaceans have the strongest toxicity among all isomers. Domoic acid is distributed worldwide, although there are still few reports on detection of domoic acid in China, but in Chinese sea areas, a variety of Pseudo-nitzschia have been detected, which are widely distributed in Chinese coastal areas, and nine of them are potential toxin-producing species, and there are reports of production of domoic acid in non-Chinese sea areas. At present, there is almost no detection of domoic acid in China, which may be due to the fact that Pseudo-nitzschia pollution is not very serious, but it may also be due to the fact that the existing detection method is not sensitive enough and lacks effective detection technology.

[0005] Domoic acid (DA) is one of the red tide toxins, which is closely related to the outbreak of red tide. Its detection and protection are related to the global ecological balance and marine environmental safety. In addition, as an important neurotoxin, DA can cause human memory loss and even disability. If it is used as a biological warfare agent in war, the consequences will be unimaginable. At present, there is no effective treatment for DA poisoning, so the research on DA can provide a theoretical basis for maintaining national defense security, consolidating the sea defense and clinical treatment. Furthermore, DA can harm human health through filter-feeding enrichment and food chain pollution of aquatic organisms. China is a big country in aquaculture and consumption, so the food safety of marine products is related to the health of every citizen. In addition, DA has thermal stability, so general cooking methods cannot completely eliminate its toxicity. Therefore, effective detection and quality control of marine products from the source are the best means to prevent poisoning. Therefore, the detection and protection of marine toxin DA are very important.

[0006] At present, researchers have developed various methods for detecting DA, mainly including biological analysis, physical and chemical analysis, and immunochemical analysis. Among them, the mouse bioassay (MBA) is the earliest biological analysis method for detecting DA, and the LD50 of DA in mice is about 10 mg / kg. However, this method has poor reproducibility, low sensitivity, cannot be used for quantitative analysis, and has ethical and moral problems. The physical and chemical analysis method combined with various chemical instruments has the advantage of high detection sensitivity. For example, high-performance liquid chromatography (HPLC) is the most widely used method for detecting DA, and has been listed as a national standard method in many countries. The edible standard safety concentration of DA analyzed by HPLC is 2 mg / 100 g. This method has been the focus of research and has derived many new methods with very high accuracy. However, physical and chemical analysis methods usually take a long time, require expensive equipment, and have a complicated sample pretreatment process that requires professional technicians. In addition, immunochemical methods, such as enzyme-linked immunosorbent assay (ELISA), are simple to operate, and many commercial kits have been developed based on ELISA. Colloidal gold test strips are suitable for on-site detection. However, the preparation of antibodies is complex and time-consuming, especially for small molecular marine toxins, which have low or no immunogenicity, but their toxicity is harmful to experimental animals and cells. The prepared antibodies are not easy to store for a long time, and cross-reactions are also unavoidable disadvantages. In summary, the common methods for detecting DA still have some defects, so new detection techniques need to be developed to avoid the drawbacks of the above methods.

[0007] The nucleic acid aptamer refers to a single-stranded DNA or RNA which forms a specific tertiary structure by folding itself in the absence of a complementary strand and has a certain function, and the function is similar to that of an antibody. The nucleic acid aptamer is generally obtained by a system evolution of ligands by exponential enrichment (SELEX) screening, and the nucleic acid aptamer forms a complex with a target by hydrogen bonds, hydrophobic interaction, electrostatic interaction and van der Waals force, etc. In addition, the binding between the aptamer and the target molecule has a mutual induction fitting effect. When a single-stranded oligonucleotide is close to a target molecule, the spatial structure of the single-stranded oligonucleotide changes, so that a spatial structure fitting the target molecule is formed. The current target in the field of nucleic acid aptamer research involves small molecules, proteins, pathogenic bacteria, viruses, cells, tissues and even living animals, and the application range covers environmental monitoring, diagnosis, drug delivery and treatment, and has a very far-reaching prospect. The new molecular recognition element aptamer has the advantages of high affinity and specificity, is easy to be chemically synthesized in large quantities, and is easy to be modified and fixed on the surface of a carrier, so as to facilitate the construction of a biosensor and the development of a kit. The emergence of the aptamer brings new enlightenment to the detection and prevention of the domoic acid.

[0008] However, there is almost no related report about a molecular recognition probe specifically combined with the domoic acid, a high-affinity aptamer specifically combined with the domoic acid, and identification, optimization and application of the affinity constant of the aptamer. SUMMARY

[0009] The present application is carried out to solve the above technical problems, and aims to provide an aptamer specifically combined with the domoic acid and application thereof.

[0010] The first object of the present application is to provide a plurality of single-stranded DNA aptamers which can be specifically combined with DA at a very high affinity, and to test the affinity between the plurality of aptamers and DA, so as to obtain five aptamers C1, C12, C58, C87 and C100 with a smaller affinity constant (K d ) value.

[0011] The second object of the present application is to optimize C1 with the lowest affinity constant (K d ) among the above aptamers in a truncated manner, and to provide DA aptamers C1-s, C1-b and C1-d with equivalent or even better binding capacity but shorter length. Among them, the affinity constant (K d ) of C1-d is the lowest, which is 1.09x10 -7 M, and the binding force is much higher than that before truncation.

[0012] The third object of the present application is to provide the application of the aptamer, such as the application of the aptamer in the preparation of DA separation and enrichment reagent, purification reagent, neutralizing agent or antagonist; the application in the preparation of DA detection reagent, kit or sensor; the application in the preparation of medicine for preventing or treating DA poisoning; and the application in the rapid detection of DA in water body or aquatic products. Meanwhile, the foundation is laid for the preparation of medicine for preventing or treating DA poisoning, the removal of DA in water body or aquatic products, and the application in exploring the biological function and mechanism of DA.

[0013] The main technical scheme of the present application is that a single-stranded DNA aptamer (C1) capable of specifically binding to DA with high affinity is screened and obtained through capture-SELEX (Capture-SELEX) technology. According to the prediction result of the secondary structure of the aptamer C1 by the online tool the mfold web server, the aptamer C1 is truncated, and the optimized aptamer C1-d is obtained. Through the combination with the biosensor platform, the DA aptamer sensor can be prepared, and it can be used for the rapid detection of DA. In addition, the DA aptamer can lay the foundation for the preparation of medicine for preventing or treating DA poisoning and the removal of DA in water body or aquatic products.

[0014] In the first aspect of the present application, an aptamer specifically binding to domoic acid is provided, and the sequence of the aptamer is as follows: 5'-ATTGGCACTCCACGCATAGG-N 40 -CCTATGCGTGCTACCGTGAA-3'; wherein N represents any one of bases A, T, C and G, and N 40 represents a random sequence with a length of 40 nt.

[0015] The following representative sequences are obtained through capture-SELEX (Capture-SELEX) technology screening:

[0016] C1: as shown in SEQ ID NO: 1;

[0017] C12: as shown in SEQ ID NO: 3;

[0018] C58: as shown in SEQ ID NO: 5;

[0019] C87: as shown in SEQ ID NO: 7;

[0020] C100: as shown in SEQ ID NO: 8.

[0021] The second aspect of the present application optimizes the C1 with the strongest binding force in the above-mentioned aptamers in a truncated manner, and provides five DA aptamers with equivalent binding capacity but shorter length, which are named as aptamer C1-s, aptamer C1-a, aptamer C1-b, aptamer C1-c and aptamer C1-d respectively, and the sequences are shown in SEQ ID NO. 10-SEQ ID NO. 14.

[0022] The five aptamers can all bind with DA, wherein the affinity of the aptamer C1-s and the aptamer C1-b is equivalent to that before truncation, the affinity between the aptamer C1-d and DA is much higher than that before truncation, reaching 1.09 x 10 -7 M. Therefore, the aptamer C1-d is preferred.

[0023] Preferably, the above-mentioned aptamer or preferred aptamer can be chemically modified by biotin, FITC and thiol at the 3' end or the 5' end.

[0024] The third aspect of the present application provides the application of the aptamer, such as the application in the preparation of a cartilage acid separation and enrichment reagent, a purification reagent, a neutralizing agent or an antagonist; the application in the preparation of a cartilage acid detection reagent, a kit or a sensor for rapid detection of cartilage acid in water or aquatic products; the application in the preparation of a drug for treating cartilage acid poisoning. The application in the preparation of a preparation for removing cartilage acid in water or aquatic products is also provided.

[0025] Preferably, the drug for treating cartilage acid poisoning is a pharmaceutical composition containing the aptamer specifically binding with the cartilage acid as the only active ingredient or contains the aptamer specifically binding with the cartilage acid. The pharmaceutical composition is also a drug for neutralizing the cartilage acid, or a cartilage acid antagonist, etc., which can relieve or cure the symptoms of nausea, vomiting, diarrhea, abdominal pain, diarrhea, memory loss, confusion, coma and the like caused by cartilage acid poisoning.

[0026] Preferably, the prepared preparation can completely remove the cartilage acid in water or aquatic products, or reduce the content of the cartilage acid in water or aquatic products to below the standard specified and recommended by the World Health Organization and the Food and Agriculture Organization of the United Nations.

[0027] The fourth aspect of the present application provides a composition of an aptamer specifically binding with cartilage acid, wherein the aptamer specifically binding with the cartilage acid is used as an active ingredient, and a pharmaceutically or diagnostically acceptable carrier is further included. The composition can be used for preparing an anti-cartilage acid drug or a detection reagent.

[0028] The composition of the present application and pharmaceutically or detectably acceptable adjuvants together constitute a pharmaceutical preparation composition, so as to more stably exert the curative effect, which can ensure the conformational integrity of the aptamer core sequence disclosed in the present application, and also protect the multifunctional groups of the protein to prevent its degradation (including but not limited to condensation, deamination or oxidation).

[0029] In a fifth aspect of the present application, the application of aptamer C1-d in the rapid detection of DA in aquatic products or water bodies is particularly provided to prevent people from being poisoned mainly due to drinking contaminated water and eating contaminated aquatic products.

[0030] The beneficial guarantees and effects of the present application are as follows:

[0031] In view of the structural characteristics of small molecular weight and difficulty in fixation of domoic acid, single-stranded DNA aptamers with high affinity and high specificity to domoic acid are screened based on the capture-SELEX (Capture-SELEX) technology. These aptamers, as molecular recognition probes specifically combined with domoic acid, have the advantages of high affinity, strong specificity, good stability, low immunogenicity, easy synthesis, modification and labeling, etc. They can be used for the separation and enrichment of trace domoic acid in samples, the analysis and detection of domoic acid, the preparation of domoic acid neutralizing drugs, the preparation of domoic acid antagonizing drugs, and the removal of domoic acid in water bodies.

[0032] Through experimental verification, the aptamers of the present application can rapidly and specifically combine with domoic acid, wherein the affinity between aptamer C1-d and DA is the highest, reaching 1.09 x 10 -7 M. Therefore, the aptamers screened by the present application can be prepared into aptamer sensors or detection reagents, and applied to the detection of DA in drinking water samples. In addition, these aptamers can lay a foundation for the preparation of drugs for preventing or treating DA poisoning and the removal of DA in water bodies or aquatic products.

[0033] In addition, according to the characteristics of DA molecules, the capture-SELEX (Capture-SELEX) method is adopted to obtain single-stranded DNA aptamers that can specifically combine with domoic acid with high affinity through forward screening and reverse screening, which has the characteristics of simple operation and high repeatability, greatly simplifies the construction technical route, and has low production cost and short purification period. As a new type of molecular recognition probe, the aptamer has the advantages of low cost, stable properties and convenient modification, and is suitable for large-scale application in biological and pharmaceutical industrial production. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 is a schematic diagram of DA aptamer screening based on the capture-SELEX (Capture-SELEX) technology.

[0035] Figure 2 Figure 8 is a result graph of the binding rate of aptamer to target toxin domoic acid in each round of screening.

[0036] Figure 3 Figure 9 is a secondary structure prediction graph of the truncated sequence of aptamer C1 predicted by mfold software.

[0037] Figure 4 Figure 10 is a result graph of the affinity determination of aptamer C1-d to domoic acid.

[0038] Figure 5 Figure 11 is a result graph of the specificity identification of aptamer C1-d to domoic acid. DETAILED DESCRIPTION

[0039] The present application is further described in conjunction with the following examples. It should be understood, however, that these examples are intended to illustrate the present application and are not intended to limit the scope of the application.

[0040] The experimental procedures described below, unless otherwise indicated, were generally performed according to conventional procedures as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's instructions. Percentages and parts are by weight unless otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this application belongs. Furthermore, any method and material similar or equivalent to those described herein can be used in the practice of the present application. The preferred methods and materials are described herein.

[0041] Example 1. Construction of random ssDNA library and primers thereof

[0042] (1) Construction of random ssDNA library with length of 80 nucleotides

[0043] The DA aptamer library consists of 80 bases, both ends of which are fixed regions containing 20 bases, and the middle is a random region containing 40 bases 5'-ATTGGCACTCCACGCATAGG-N 40 -CCTATGCGTGCTACCGTGAA-3'; wherein, N represents any one of bases A, T, C, G, and N 40 represents a random sequence with length of 40 nt.

[0044] (2) Construction of primers

[0045] Upstream primer: 5'-ATTGGCACTCCACGCATAGG-3' (SEQ ID NO. 15),

[0046] Downstream primer 1: 5'-TTCACGGTAGCACGCATAGG-3' (SEQ ID NO. 16),

[0047] Downstream primer 2: 5'-poly(dA20)-Spacer18-TTCACGGTAGCACGCATAGG-3' (SEQ ID NO. 17).

[0048] Example 2. Screening of aptamer against domoic acid

[0049] To obtain aptamer with high affinity and specificity to domoic acid (DA), a 12-round screening was performed using the Capture-SELEX technology to immobilize the ssDNA library. The screening process is described in Figure 1 Capture-SELEX covalently links a single-stranded oligonucleotide sequence, i.e., the capture sequence, to a solid-phase carrier such as a magnetic bead containing a special group, and a base sequence that can be complementary to the capture sequence, i.e., the docking sequence, is designed in the screening library. Through the base complementary pairing of the docking sequence and the capture sequence, the screening library is immobilized on the solid-phase carrier.

[0050] In this study, a 3' end biotin-labeled Capture oligo complementary to the terminal sequence of the library immobilization sequence was designed. The biotinylated Capture oligo and the library were paired by annealing in buffer. After the library was fully incubated with SA magnetic beads, the library was immobilized on the SA magnetic beads due to the interaction between biotin and SA protein. According to Figure 1 and Figure 2 In the screening process, reverse screening was introduced from the 6th round, i.e., the ssDNA library was first incubated with the reverse target, kainic acid (KA), and then incubated with free target toxin, domoic acid (DA), after washing. The aptamer specifically binding to DA was finally recovered. The retention rate of the aptamer binding to the target DA is shown in Figure 2 After 12 rounds of screening, the retention rate of ssDNA no longer increased, which was considered as the end point of the screening.

[0051] The specific operation steps of the screening process are as follows:

[0052] (1) Incubation: In each round of screening, ssDNA library and capture sequence were dissolved and mixed in screening buffer at a molar ratio of 1:2. First, 95°C for 10 min, slowly cool to 60°C for 1 min, then slowly cool to 25°C, the cooling rate is 0.1°C / s, 25°C for 5 min for standby; then the denatured mixture was incubated with streptavidin magnetic beads, which were washed at least five times in screening buffer before use. The concentration of DNA after denaturation was quantified by a fluorometer and labeled as C1. The denatured mixture was mixed with magnetic beads and incubated on a four-dimensional rotary instrument for 1 h, then all the magnetic beads were adsorbed by a magnet, and the DNA concentration in the supernatant was determined and labeled as C2. The C2 / C1 value can be used to judge the immobilization efficiency of the ssDNA library. If C2 / C1 is less than 0.5, it means that the library is not sufficiently immobilized. 2.0 fluorometer. The denatured mixture was mixed with magnetic beads and incubated on a four-dimensional rotary instrument for 1 h, then all the magnetic beads were adsorbed by a magnet, and the DNA concentration in the supernatant was determined and labeled as C2. The C2 / C1 value can be used to judge the immobilization efficiency of the ssDNA library. If C2 / C1 is less than 0.5, it means that the library is not sufficiently immobilized.

[0053] (2) Screening: After incubation, the magnetic beads were adsorbed by a strong magnet, and the magnetic beads were washed with screening buffer to remove unbound DNA sequences; then the magnetic beads were incubated with 100 pmol target toxin DA at room temperature on a four-dimensional rotary instrument, and after incubation, ssDNA eluate was obtained by magnetic separation, and the concentration of ssDNA in the eluate was determined by a fluorometer and the retention rate was calculated.

[0054] (3) Amplification: The eluted ssDNA was used as a template, and the 50 μL PCR reaction system was as follows:

[0055]

[0056] Amplification conditions: 95°C, pre-denaturation for 5 min; 95°C, denaturation for 30 s, 60°C, annealing for 45 s, 72°C, extension for 30 s, 20 cycles; 72°C, extension for 5 min.

[0057] (4) Single-stranded secondary library preparation: After adding loading buffer to the PCR amplification product dsDNA and mixing well, denaturation treatment was performed, i.e. 95°C heat denaturation for 10 min, ice bath quenching for 5 min, and room temperature standing for 5 min; the treated sample was added to a 12% urea-denatured polyacrylamide gel loading well; the electrophoresis instrument was connected, and electrophoresis was performed at a constant voltage of 300 V; when the bromophenol blue migrated to the lower end of 1 / 3 of the gel, the power was turned off; 15 ml of ddH2O and 5 μL of DNA dye were added to a clean dish, mixed well, and the gel was placed in it, and gently shaken on a horizontal shaker for 20 min; the polyacrylamide gel was placed in a gel imaging system for imaging, and the short-chain ssDNA was used as the target fragment for gel extraction and purification, and quantification, as the secondary library for the next round.

[0058] (5) Repeat the above screening method, perform the next round of screening, to the 12th round, the enriched library is cloned and sequenced, the obtained sequence is summarized in Table 1, and the affinity constant Kd value of the sequence in Table 1 and the target toxin DA is analyzed by the biofilm interference technology.

[0059] Table 1 aptamer sequence and its affinity constant K d value

[0060]

[0061]

[0062] Example 3. Truncation optimization of aptamer C1

[0063] In order to remove the non-essential nucleotides in the aptamer, obtain its core sequence, and further study the mechanism of the aptamer binding to DA, it is necessary to truncate and optimize the aptamer. The library used for screening the aptamer is a closed-loop structure, and the self-complementarity of the primer sequence facilitates the full exposure of the random sequence to the target. Since the primer itself does not participate in folding, the primer part of the aptamer C1 is directly removed to obtain C1-s, and the affinity for DA is not reduced, thereby proving that the primer part is not the key sequence for the binding of the aptamer to the toxin. Subsequently, the secondary structure of C1-s is analyzed by mfold web server software Figure 3 ), and each stem loop structure is removed to obtain the aptamer sequences shown in Table 2. The biofilm interference technology determines the affinity results, which show that the affinity of C1-d, a 19-nucleotide length obtained by truncating the aptamer C1, for DA is significantly improved, indicating that the corresponding stem loop forms the necessary structure for binding to the target DA.

[0064] Table 2 Truncated sequence of aptamer C1 and its affinity constant K d value

[0065]

[0066] Example 4. Biofilm interference technology for determining the interaction between aptamer and target

[0067] Biofilm layer interference technology is a non-labeled technology based on the principle of light interference, that is, a technology for detecting the reaction on the surface of the sensor by detecting the displacement change of the interference spectrum; when a beam of visible light is emitted from the spectrometer, two reflected spectra will be formed at the two interfaces of the optical film layer at the end of the sensor, and an interference spectrum will be formed. Any change in film thickness and density due to molecular binding or dissociation can be reflected by the displacement value of the interference spectrum, and a real-time reaction monitoring map can be made through this displacement value.

[0068] The method is used for detecting the affinity and specificity of C1-d and DA, and the specific detection steps are as follows:

[0069] (1) Preparation of aptamer: the aptamer C1-d with a biotin tag is synthesized, a 2 μM solution is prepared with a screening buffer, and denaturation treatment is carried out (95°C for 10 min, ice bath for 5 min, and room temperature for 5 min), and is ready for use. Meanwhile, a random sequence with a biotin tag is prepared as a negative control.

[0070] (2) Preparation of target toxin: different concentrations (10 μM, 5 μM, 2.5 μM and 1.25 μM) of DA are used for interaction with the aptamer, and the affinity between DA and the aptamer is determined, and the results are shown in Figure 4 In addition, in order to verify the specificity of the aptamer, 5 μM of DA analog KA and non-specific toxins (GTX, STX, TTX, NOD-R, PLTX, DTX, OA) and a mixed solution of the above toxins (final concentration 5 μM) are prepared, and the interaction between the candidate aptamer and these toxins is detected, and the results are shown in Figure 5 C1-d can only specifically bind to DA, and is a typical fast-binding and slow-dissociation ligand of DA, and has great practical application value.

[0071] (3) Super streptavidin (SSA) probe is used. The corresponding concentration of the aptamer, DA solution and buffer is added in two 96-well plates, 100-200 μL / well. The program is set as follows: ① Sensor balance (1 min); ② Aptamer coupling (2 min); ③ Sensor rebalance (1 min); ④ Binding (3 min); ⑤ Dissociation (3 min). The collected real-time binding and dissociation data are imported into Octet data analysis software, and 1:1 binding mode is used for fitting analysis to obtain fitting curve and affinity constant K d value and other kinetic parameters.

[0072] The examples of the present application have been specifically described above, but the present application is not limited to the described embodiments, and those skilled in the art can make various equivalent modifications or replacements without departing from the spirit of the present application, and these equivalent modifications or replacements are all included in the scope defined by the claims of the present application.

[0073]

[0074]

[0075] SEQUENCE LISTING <110> Chinese People's Liberation Army Navy Military Medical University <120> Aptamers that specifically bind to domoic acid and uses thereof <130> CLAIM DESCRIPTION <160> 17 <170> SIPOSequenceListing 1.0 <210> 1 <211> 80 <212> DNA <213> Artificial Sequence <400> 1 attggcactc cacgcatagg ccaacatgat gttccgtcat tttgaggtgt gtacaccgtg 60 cctatgcgtg ctaccgtgaa 80 <210> 2 <211> 80 <212> DNA <213> Artificial Sequence <400> 2 attggcactc cacgcatagg ggataacggg ttgatggtac ttctatctat cgcgttgtgc 60 cctatgcgtg ctaccgtgaa 80 <210> 3 <211> 80 <212> DNA <213> Artificial Sequence <400> 3 attggcactc cacgcatagg gacatcgaga agaatcctga tacgacttgg ctttgctggc 60 cctatgcgtg ctaccgtgaa 80 <210> 4 <211> 80 <212> DNA <213> Artificial Sequence <400> 4 GAGGTGGAGGAGGAGGAAGAAGAAGGAGAAGAAGGAGAAGGAG 60 CCTATGCATG CTACCCTGAA 80 <210> 5 <211> 80 <212> DNA <213> Artificial Sequence <400> 5 GAGGTGGAGGAGGAGGAAGAAGAAGGAGAAGAAGGAGAAGGAG 60 CCTATGCATG CTACCCTGAA 80 <210> 6 <211> 80 <212> DNA <213> Artificial Sequence <400> 6 GAGGTGGAGGAGGAGGAAGAAGAAGGAGAAGAAGGAGAAGGAG 60 CCTATGCATG CTACCCTGAA 80 <210> 7 <211> 80 <212> DNA <213> Artificial Sequence <400> 7 GAGGTGGAGGAGGAGGAAGAAGAAGGAGAAGAAGGAGAAGGAG 60 CCTATGCATG CTACCCTGAA 80 <210> 8 <211> 80 <212> DNA <213> Artificial Sequence <400> 8 attggcactc cacgcatagg gaatggaccc ggtataattc cctcaagagt gccaatttca 60 cctatgcgtg ctaccgtgaa 80 <210> 9 <211> 80 <212> DNA <213> Artificial Sequence <400> 9 attggcactc cacgcatagg gatctcataa ccagtctctt tgactgatgt tagtaaggtc 60 cctatgcgtg ctaccgtgaa 80 <210> 10 <211> 40 <212> DNA <213> Artificial Sequence <400> 10 ccaacatgat gttccgtcat tttgaggtgt gtacaccgtg 40 <210> 11 <211> twenty three <212> DNA <213> Artificial Sequence <400> 11 caacatgatg ttccgtcatt ttg 23 <210> 12 <211> 12 <212> DNA <213> Artificial Sequence <400> 12 ggtgtgtaca cc 12 <210> 13 <211> 28 <212> DNA <213> Artificial Sequence <400> 13 CCAACATGAT GTTCCTATTT TGAGTG 28 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <400> 14 CCGAGGTGTG TACACCCTG 19 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <400> 15 ATTGGCCTC CACGCTATGG 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <400> 16 TTCACGGTAG CACGCTATGG 20 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <400> 17 AAAAAAAAAA AAAAAAAAAA TTCACGGTAG CACGCTATGG 40

Claims

1. An aptamer that specifically binds to domoic acid, characterized in that, The sequence of the aptamer is shown in SEQ ID NO.

14.

2. The use of the aptamer that specifically binds to domoic acid as described in claim 1 in the preparation of domoic acid separation and enrichment reagents, purification reagents, antagonists or neutralizing agents.

3. The use of the aptamer that specifically binds to domoic acid as described in claim 1 in the preparation of domoic acid detection reagents, kits, or sensors.

4. The use of the aptamer that specifically binds to domoic acid as described in claim 1 in the preparation of a reagent for removing domoic acid from seafood or water.

5. The application of the aptamer that specifically binds to domoic acid as described in claim 1 in the rapid detection of domoic acid in aquatic products or water bodies.

6. A composition, characterized in that: Using the aptamer as described in claim 1 as the active ingredient, it also includes a pharmaceutically or detectionally acceptable carrier.

7. A domoic acid detection reagent, characterized in that, Contains the composition of claim 6.

Images