Direct detection method for carbapenem antibiotic-resistant pathogenic strains

Abstract

The present invention relates to a method for detecting pathogenic strains resistant to carbapenem antibiotics in a biological sample. The present invention directly identifies carbapenem antibiotic-degrading enzymes, particularly KPC, OXA, NDM, IMP, VIM and / or GES proteins, by mass spectrometry, thereby rapidly determining whether a pathogenic strain is resistant to an antibiotic and the type of resistance-related protein. The present invention discovers the physical and chemical properties of each enzyme in vivo, such as the unique N-terminal cleavage length, methionine residue oxidation and disulfide bond formation based on the type of carbapenem-degrading enzyme, and reflects them in reference mass values, and by doing so, the presence of antibiotic-resistant strains can be more thoroughly detected with high reliability. Therefore, this approach can be effectively used to establish an appropriate antibiotic administration strategy at an early stage of infection.

Description

TECHNICAL FIELD

[0001] The present application relates to a method for directly detecting in vivo active forms of carbapenemases KPC, OXA, NDM, IMP, VIM and / or GES without pre-treatment of a sample by top-down mass spectrometry. BACKGROUND

[0002] In the case where the efficiency of commercialized antibiotic treatment is rapidly decreasing due to the increasing number of antibiotic-resistant bacteria, a strategy for improving the efficiency of treatment by simultaneously administering appropriate antibiotics to a pathogen-infected patient and reducing antibiotic-resistant bacteria is being actively studied. The minimum inhibitory concentration (MIC) test is being used to identify the presence or absence of antibiotic resistance, but culturing microorganisms, which is an essential step, takes more than 18 hours and lacks accuracy, and thus cannot quickly identify and select the best antibiotic in the early stage of infection. Gene diagnosis techniques using real-time PCR, etc. have limitations in application to rapid and accurate high-throughput diagnosis because they require complex and expensive sample pre-treatment in the process of gene extraction and amplification, prior information on the nucleotide sequence of the target gene is essential, and since the enzyme gene having lost antibiotic-degrading activity is detected, inaccurate resistance information is included.

[0003] Compared to PCR-based sequencing methods, mass spectrometry methods including MALDI-TOF are low-cost and high-efficiency identification systems, and can provide an important means for rapid identification of microorganisms. In addition, using these methods, sample processing after strain culture and staining identification can be achieved in 10 minutes, and by comparing the mass data of an unknown strain with the mass data in a database established through mass spectrometry data, a strain having the same mass value can be rapidly identified.

[0004] However, conventional mass spectrometry methods cannot accurately determine the type of antibiotic-resistant protein, and are cumbersome because they involve the use of proteases to degrade the target resistant protein into peptide fragments, and then indirectly deduce the type of resistant protein through the mass values of these fragments. In addition, these methods have many problems in terms of reliability.

[0005] Accordingly, the present inventors have endeavored to provide a rapid and accurate diagnosis method for carbapenem-resistant strain infection by selecting proteins directly related to resistance to β-lactam antibiotics, particularly carbapenem antibiotics, and measuring the exact mass values of in vivo active forms of these selected proteins to establish accurate reference data for determining the presence or absence of a carbapenem-resistant strain.

[0006] Throughout this specification, many publications and patents have been referenced and cited. The disclosures of the cited publications and patents in their entireties are hereby incorporated by reference to more fully describe the state of the art to which this application pertains. SUMMARY

[0007] TECHNICAL PROBLEM

[0008] The present inventors have made intensive research efforts and developed an effective diagnostic method that can rapidly determine infection of an antibiotic-resistant strain by detecting antibiotic-degrading enzymes involved in resistance to lactam antibiotics in a sample in a simple and highly reliable manner. As a result, the present inventors newly found that enzymes degrading β-lactam antibiotics carbapenems, particularly KPC, OXA, NDM, IMP, VIM, and GES proteins, exist in an active form in vivo due to truncation of some N-terminal residues, and found that, when the active form of these proteins, which account for a large portion of carbapenem-degrading enzymes secreted by antibiotic-resistant strains, is directly identified by mass spectrometry, it is possible to rapidly and accurately determine whether a pathogenic strain is resistant to an antibiotic, as well as the type of resistance-related protein, thereby establishing an appropriate antibiotic administration strategy at an early stage of infection, on the basis of which the present invention was completed.

[0009] Accordingly, it is an object of the present invention to provide a method for detecting a pathogenic strain resistant to carbapenem antibiotics, particularly a pathogenic strain expressing KPC, OXA, NDM, IMP, VIM, and / or GES, in a biological sample.

[0010] Other objects and advantages of the present invention will be more apparent from the following detailed description of the present invention, claims, and accompanying drawings.

[0011] TECHNICAL SOLUTION

[0012] According to one aspect of the present invention, there is provided a method for detecting a pathogenic strain resistant to carbapenem antibiotics in a biological sample, comprising:

[0013] (a) isolating a protein expressed by a pathogenic strain in a biological sample isolated from a subject; and

[0014] (b) performing top-down mass spectrometry analysis on the isolated protein,

[0015] wherein, when the mass spectrometry result detects a protein having the same mass as Klebsiella pneumoniae carbapenemase (KPC) or OXA carbapenemase from which 21 or 22 amino acid residues at the N-terminus have been removed, or, when the mass spectrometry result detects a protein having the same mass as at least one carbapenemase selected from the group consisting of New Delhi Metallo-beta-lactamase (NDM) from which 18, 19, 20, 21 or 26 amino acid residues at the N-terminus have been removed, imipenemase (IMP), Verona integron-borne metallo-beta-lactamase (VIM) and Guiana extended spectrum beta-lactamase (GES), it is considered that a pathogenic strain resistant to carbapenem antibiotics is present in the biological sample.

[0016] The present inventors have made intensive research efforts to develop an effective diagnostic method that can rapidly determine infection of an antibiotic-resistant strain by detecting an antibiotic-degrading enzyme involved in lactam antibiotic resistance in a sample in a simple and highly reliable manner. As a result, the present inventors newly found that enzymes degrading beta-lactam antibiotics carbapenems (particularly, KPC, OXA, NDM, IMP, VIM and GES proteins) exist in an active form in vivo due to truncation of some N-terminal residues, and found that, when the active form of these proteins, which account for the majority of carbapenem-degrading enzymes secreted by antibiotic-resistant strains, is directly identified by mass spectrometry, it is possible to rapidly and accurately determine whether a pathogenic strain is resistant to antibiotics, as well as the type of resistance-related protein, to establish an appropriate antibiotic administration strategy at an early stage of infection.

[0017] As used herein, the term "pathogenic strain" refers to any bacteria that act as a cause of infection or disease, including, for example, but not limited to, Staphylococcus aureus, Streptococcus, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Pseudomonas otitidis, Micrococcus luteus, Citrobacter koseri, Proteus mirabilis and Mycobacterium ulcerans.

[0018] As used herein, the expression "resistant to an antibiotic" means that a particular pathogenic microorganism can grow even in an environment in which an antibiotic against the microorganism is present in a high concentration or an effective amount. Whether a pathogenic microorganism is resistant to an antibiotic can be determined by detecting the presence or absence of an enzyme protein that is secreted by the pathogenic microorganism and removes or reduces the activity of the antibiotic by degrading the antibiotic. For example, β-lactam antibiotics that inhibit the synthesis of bacterial cell walls, such as penicillins, cephalosporins, monobactams, and carbapenems, are inactivated by β-lactamase, so they cannot inhibit pathogens that express β-lactamase. Thus, the term "resistant" can be used interchangeably with the terms "low therapeutic responsiveness" and "low prophylactic responsiveness".

[0019] As used herein, the term "treatment" means (a) inhibiting the progression of a disease, disorder, or symptom; (b) alleviating a disease, disorder, or symptom; (c) eliminating a disease, disorder, or symptom. Thus, the term "treatment responsiveness" means the degree to which the above effects are exerted in vivo when a β-lactam antibiotic including a carbapenem is administered to a patient infected with a pathogenic strain in a therapeutically effective amount.

[0020] As used herein, the term "prophylaxis" means inhibiting the occurrence of a disease or disorder in a subject who has not been diagnosed with the disease or disorder but can have the disease or disorder. Thus, "prophylactic responsiveness" means the degree to which infection is inhibited in vivo when a β-lactam antibiotic including a carbapenem is administered to a normal person who has not been confirmed to be infected in a prophylactically effective amount.

[0021] As used herein, the term "biological sample" means any sample, including, for example, but not limited to, blood, tissue, organs, cells, or cell cultures, obtained from a mammal including a human, and containing or possibly containing a pathogenic strain that can be inhibited by a β-lactam antibiotic including a carbapenem.

[0022] As used herein, the term "subject" means a subject who provides a sample to check for the presence of a pathogenic strain to be inhibited by a β-lactam antibiotic such as a carbapenem or whether the strain is resistant to the antibiotic, and ultimately means a subject to be analyzed for whether an infection with a pathogenic strain resistant to an antibiotic has occurred. Examples of subjects include, but are not limited to, humans, mice, rats, guinea pigs, dogs, cats, horses, cows, pigs, monkeys, chimpanzees, baboons, or rhesus monkeys, particularly humans. Since the information provided by the composition of the present application can not only predict therapeutic responsiveness but also prophylactic responsiveness to a β-lactam antibiotic such as a carbapenem, the subject in the present application can be a patient infected with the strain or a healthy subject who has not been confirmed to be infected.

[0023] As used herein, the term "top-down mass spectrometry" refers to an analysis that directly measures the mass value of a full-length protein without performing a process of fragmenting the protein into peptide fragments, and in particular, refers to an analysis in which fragmentation of a target protein is not performed before injecting a protein sample into a mass spectrometer. Another feature of the present application is that, by directly mass spectrometrically analyzing a full-length protein, there is no need to use a protease such as trypsin to randomly degrade the protein, simplifying the process, and the presence of a target protein can be determined in a very high reliability in a shorter time compared to conventional methods of indirectly identifying a protein by collecting a large amount of information on fragments and collecting a large amount of information on the fragmentation tendency of various proteins.

[0024] In the present specification, the expression "the mass of the protein is the same" means that the mass value measured by the mass spectrometric analysis method of the present application is substantially the same as the reference mass value, for example, a value corresponding to the mass of a carbapenamase whose N-terminal 18, 19, 20, 21, 22, or 26 amino acid residues have been removed and whose amino acid sequence and molecular weight are known. "Substantially the same" means, for example, that the measured Da value or m / z x z value is within ±10 of the reference mass value, more specifically within ±7 of the reference mass value, more specifically within ±5 of the reference mass value, and particularly within ±3 of the reference mass value. The mass value of the carbapenamase is the standard for determining whether the mass value is substantially the same as the reference mass value, and includes the mass value in a state in which 1 to 3 methionine residues are present in an oxidized state (i.e., an increase of 16, 32, or 48 from the known mass value) or in which a disulfide bond is formed between two cysteine residues (i.e., a decrease of 2 from the known mass value).

[0025] According to one embodiment of the present application, the method of the present application further comprises a step of subjecting the protein isolated in step (a) to ion exchange chromatography.

[0026] As used herein, the term "ion exchange chromatography" refers to a separation and purification method that separates a charged target substance from a heterogeneous mixture using the phenomenon in which an ion or a charged compound binds to an ion exchange resin by electrostatic force. Ion exchange chromatography has ion exchange resins that bind various functional groups, in which an anion exchange resin has a positively charged functional group and thus binds to a negatively charged target substance in a mixture by electrostatic attraction, and a cation exchange resin specifically binds to a positively charged target substance.

[0027] According to one embodiment of the present application, the ion exchange chromatography is any one selected from the group consisting of anion exchange chromatography, cation exchange chromatography, and sequential combinations thereof.

[0028] The anion exchange resin used in the present application can have, for example, diethylaminoethyl (DEAE) or quaternary ammonium functional groups, but is not limited thereto, and any conventional cationic functional group that provides a positive charge to the carrier can be used without limitation. Strong basic anion exchange groups include, for example, Q Sepharose Fast Flow, Q Sepharose High Performance, Resource Q, Source 15Q, Source 30Q, Mono Q, Mini Q, Capto Q, Capto Q ImpRes, Q HyperCel, Q Cermic HyperD F, Nuvia Q, UNOsphere Q, Macro-Prep High Q, Macro-Prep 25Q, Fractogel EMD TMAE(S), Fractogel EMD TMAE Hicap(M), Fractogel EMD TMAE(M), Eshmono Q, Toyopearl QAE-550C, Toyopearl SuperQ-650C, Toyopearl GigaCap Q-650M, Toyopearl Q-600C AR, Toyopearl SuperQ-650M, Toyopearl SuperQ-650S, TSKgel SuperQ-5PW(30), TSKgel SuperQ-5PW(20), and TSKgel SuperQ-5PW, but is not limited thereto, and any anion exchange resin known in the art can be used.

[0029] The cation exchange resin used in the present application can have, for example, a sulfone group or a carboxyl group, but is not limited thereto, and any conventional cationic functional group that provides a negative charge to the carrier can be used without limitation. For example, the cation exchange resin can be selected from the group consisting of Fractogel, CM (carboxymethyl), SE (sulfoethyl), SP (sulfopropyl), P (phosphate), S (sulfonate), PROPAC WCX-10TM (Dionex), Capto S, S-Sepharose FF, Fractogel EMD SO3M, Toyopearl Megacap II SP 550C, Poros 50HS, Poros XS, and SP-sepharose matrix, but is not limited thereto. Specifically, SP (sulfopropyl) resin can be used. As a column buffer, an equilibration buffer, a washing buffer, and an elution buffer known in the art, for example, a sodium phosphate buffer, a citrate buffer, and an acetic acid buffer can be used.

[0030] Such ion exchange chromatography can be appropriately performed depending on the charge of the protein to be separated / purified and the order of the proteins to be separated. For example, in order to sequentially separate positively charged proteins and negatively charged proteins, cation exchange chromatography can be performed, followed by anion exchange chromatography.

[0031] According to one embodiment of the present application, step (a) of the present application is performed by adding a surfactant to the biological sample.

[0032] As described above, in the present application, direct mass spectrometry can be performed on full-length proteins by top-down mass spectrometry without using a fragmentation process using a protease. The present inventors have found that when a surfactant is added to a biological sample to be analyzed, intact full-length proteins present in cell membranes or cytoplasm can be encapsulated, so that target proteins can be quickly and accurately identified without random degradation with an enzyme.

[0033] In the present application, ionic, non-ionic, and zwitterionic surfactants can be used without limitation, as long as they are general surfactants capable of forming micelles sufficient to encapsulate full-length proteins. Specifically, the surfactant used in the present application is an ionic surfactant or a non-ionic surfactant.

[0034] Examples of ionic surfactants that can be used in the present application include, but are not limited to, sodium deoxycholate (DOC), Medialan A, Quaternium-60, cetylpyridinium chloride, cetylpyridinium bromide, cetyltrimethylammonium chloride, cetyltrimethylammonium bromide, and Gardinol.

[0035] Examples of non-ionic surfactants that can be used in the present application include, but are not limited to, n-octyl-β-D-glucopyranoside (OG), n-octyl-β-D-thioglucopyranoside (OTG), octyl glucitol neopentyl glycol (OGNG), n-dodecyl-β-D-maltopyranoside (DDM), and n-dodecyl-β-D-thiomaltopyranoside (DDTM).

[0036] More specifically, step (a) can be performed by additionally adding a lysis buffer to the biological sample. That is, the surfactant of the present application can be used together with a lysis buffer in a step of lysing cells to isolate proteins expressed by a pathogenic strain. Specifically, the lysis buffer can be a volatile buffer.

[0037] Examples of volatile buffers that can be used in the present application include, but are not limited to, ammonium bicarbonate, acetic acid, formic acid, ammonia, ammonium carbonate, and pyridine / triethanolamine. In addition, any buffer that evaporates easily into the atmosphere due to its low boiling point, while maintaining the hydrogen ion concentration in the sample within a certain range, can be used.

[0038] According to a specific embodiment of the present application, the method of the present application further comprises an ultrasonic treatment step between step (a) and step (b).

[0039] According to a specific embodiment of the present application, step (b) is performed using a mass spectrometry method selected from the group consisting of matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) mass spectrometry, surface-enhanced laser desorption / ionization time-of-flight (SELDI-TOF) mass spectrometry, electrospray ionization time-of-flight (ESI-TOF) mass spectrometry, liquid chromatography-mass spectrometry (LC-MS), and liquid chromatography-mass spectrometry / mass spectrometry (LC-MS / MS). More specifically, MALDI-TOF mass spectrometry is used.

[0040] MALDI-TOF mass spectrometry is a method in which a sample supported by a matrix is desorbed and ionized by laser irradiation, and then the molecular weight of the generated ions is analyzed by measuring the time (time of flight) required for the ions to reach the detector. According to this method, since fragmentation of the target substance does not occur, it is possible to rapidly and accurately measure the mass of a biological macromolecule such as a protein. When the ionized molecules are accelerated by an electric field and the time of flight is measured, a mass-to-charge ratio (m / z) is generated, and from this m / z value, the molecular weight of the target material can be determined. For example, when m / z = 30,000 (z = +1) or 15,000 (z = +2), the molecular weight is m / z x z = 30,000.

[0041] According to a specific embodiment of the present application, the carbapenamase is a KPC protein, and when the result of the mass spectrometry analysis is that a protein having the same mass as a KPC protein from which 21 amino acid residues at the N-terminus are removed is detected, it is considered that a pathogenic strain having resistance to a carbapenem antibiotic is present in the biological sample.

[0042] According to a specific embodiment of the present application, the carbapenamase is an OXA protein, and when the result of the mass spectrometry analysis is that a protein having the same mass as an OXA protein from which 22 amino acid residues at the N-terminus are removed is detected, it is considered that a pathogenic strain having resistance to a carbapenem antibiotic is present in the biological sample.

[0043] According to one embodiment of the present application, the carbapenem-degrading enzyme is an NDM protein, and when the result of the mass spectrometric analysis is that a protein having the same mass as the NDM protein from which 19 or 20 amino acid residues at the N-terminus have been removed is detected, it is considered that a pathogenic strain having resistance to a carbapenem antibiotic is present in the biological sample.

[0044] According to one embodiment of the present application, the carbapenem-degrading enzyme is an IMP protein, and when the result of the mass spectrometric analysis is that a protein having the same mass as the IMP protein from which 18 to 21 amino acid residues at the N-terminus have been removed is detected, it is considered that a pathogenic strain having resistance to a carbapenem antibiotic is present in the biological sample.

[0045] According to one embodiment of the present application, the carbapenem-degrading enzyme is a VIM protein, and when the result of the mass spectrometric analysis is that a protein having the same mass as the VIM protein from which 25 or 26 amino acid residues at the N-terminus have been removed is detected, it is considered that a pathogenic strain having resistance to a carbapenem antibiotic is present in the biological sample.

[0046] According to one embodiment of the present application, the carbapenem-degrading enzyme is a GES protein, and when the result of the mass spectrometric analysis is that a protein having the same mass as the GES protein from which 18 amino acid residues at the N-terminus have been removed is detected, it is considered that a pathogenic strain having resistance to a carbapenem antibiotic is present in the biological sample.

[0047] According to the present application, the present inventors have found that, in order for a carbapenemase to have an activity of degrading a carbapenem in vivo, the carbapenemase should exist in a state in which some amino acid residues at the N-terminus have been removed (active form), and the length of the N-terminal residues removed for the maintenance of the activity varies depending on the type of the enzyme. Therefore, in order to accurately determine whether the strain actually infecting a subject has resistance to carbapenems, it should be determined based on whether a protein having the same mass as a KPC protein from which 21 amino acid residues at the N-terminus have been removed and / or an OXA protein from which 22 amino acid residues at the N-terminus have been removed is detected, and, as described below, based on whether a protein having the same mass as an NDM protein from which 19 or 20 amino acid residues at the N-terminus have been removed, an IMP protein from which 18 to 21 amino acid residues at the N-terminus have been removed, a VIM protein from which 25 or 26 amino acid residues at the N-terminus have been removed, and / or a GES protein from which 18 amino acid residues at the N-terminus have been removed is detected. Compared to conventional techniques that mechanically detect the mass values of the full-length amino acids of these known carbapenemases, the present application provides significantly improved accuracy and diagnostic reliability.

[0048] According to a specific embodiment of the present application, when the result of the mass spectrometric analysis is that one or more mass values (m / z x z) selected from the group consisting of 28720, 28746, 28737, 28780, 28678, 28728, 28704, 28806, 28736, 28738, 28688, 28562, 28877, 28676, 28686, 28733, 28690, 28557, 28718, 28963, 28716, 28588, 29105, 28795, 28825, 28769, 29631, 28760, 28656, 28776, 28975, 29086, 28748, 30433, 28730, and values within ±5 of these values are detected, it is considered that a pathogenic strain having resistance to carbapenem antibiotics is present in the biological sample. More specifically, in this case, the pathogenic strain present in the sample is a strain producing a KPC protein.

[0049] According to the present application, the mass values listed above are mass values of KPC subtype proteins from which the N-terminal 21 amino acid residues have been removed. As described above, the present inventors have found that all of the subtype proteins of KPC, which is a carbapenemase, maintain carbapenem-degrading activity only when the N-terminal 21 amino acid residues have been removed in vivo. Therefore, when the result of the mass spectrometry detects any one or more of the mass values corresponding thereto, it is considered that the subject has been infected with a strain expressing one or more KPC subtype proteins, i.e., a pathogenic strain having resistance to carbapenem antibiotics.

[0050] According to a specific embodiment of the present application, the mass values (m / z x z) further include mass values increased by 16 or 32 from each mass value.

[0051] More specifically, the mass values (m / z x z) further include mass values decreased by 2 from each mass value.

[0052] As shown in the following examples, the present inventors have found that one of the three methionine residues (49th methionine, 116th methionine, and 151st methionine) in the KPC protein can exist in an oxidized state. Therefore, even when a molecular weight increased by one oxygen atom (+16) from the mass values listed above is measured, it can be determined that a strain expressing a KPC protein is present in the sample. Furthermore, the present inventors have also found that the KPC protein can exist in a state in which a disulfide bond exists between the 68th cysteine and the 237th cysteine. Therefore, even when a molecular weight decreased by two hydrogen atoms (-2) due to the disulfide bond is measured from the mass values listed above, it can be determined that a strain expressing a KPC protein is present in the sample, and thus the presence of an antibiotic-resistant strain can be more accurately detected.

[0053] According to a specific embodiment of the present application, when the result of the mass spectrometric analysis is that one or more mass values (m / z x z) selected from the group consisting of 28147, 28098, 28117, 27679, 28172, 28158, 28282, 28032, 28048, 28252, 27673, 28190, 28260, 27718, 28126, 27900, 27653, 28002, 28175, 28149, 27877, 28161, 27955, 28151, 28131, 28215, 28191, 27978, and values within ±5 of these values are detected, it is considered that a pathogenic strain having resistance to carbapenem antibiotics is present in the biological sample. More specifically, in this case, the pathogenic strain present in the sample is a strain producing an OXA protein.

[0054] According to the present application, the above mass values are mass values of the OXA subtype protein from which the N-terminal 22 amino acid residues have been removed. The present inventors have found that the OXA subtype protein maintains carbapenem-degrading activity only when the N-terminal 22 amino acid residues have been removed in vivo. Therefore, when any one or more of the mass values corresponding thereto are detected as a result of mass spectrometry, it is considered that the subject has been infected with a strain expressing one or more OXA subtype proteins, i.e., a pathogenic strain having resistance to carbapenem antibiotics.

[0055] According to a specific embodiment of the present application, the mass values (m / z x z) further include mass values increased by 16, 32, or 48 from each mass value.

[0056] As shown in the following examples, the present inventors have found that 1-3 of the 6 methionine residues (methionine at position 115, methionine at position 138, methionine at position 195, methionine at position 237, methionine at position 239, and methionine at position 241) in the OXA protein can exist in an oxidized state. Therefore, even when a molecular weight increased by one oxygen atom (+16), two oxygen atoms (+32), or three oxygen atoms (+48) is measured, it is possible to determine that a strain expressing an OXA protein is present in the sample, and thus it is possible to more accurately diagnose infection with an antibiotic-resistant strain.

[0057] According to one embodiment of the present application, when the result of the mass spectrometric analysis is that one or more mass values (m / z x z) selected from the group consisting of 26439, 26413, 26438, 26421, 26435, 26467, 26420, 26363, 26587, 26407, 26479, 26381, 26449, 26434, 27043, 26448, 26416, 26465, 26453, 26455, 26466, 26510, 26484, 26509, 26492, 26506, 26538, 26491, 26434, 26658, 26478, 26550, 26452, 26520, 26505, 27114, 26519, 26487, 26536, 26524, 26526, 26537, and values within ±5 of these values are detected, it is considered that a pathogenic strain having resistance to carbapenem antibiotics is present in the biological sample. More specifically, in this case, the pathogenic strain present in the sample is a strain producing an NDM protein.

[0058] According to the present application, the above mass values are mass values of NDM subtype proteins from which 19 N-terminal amino acid residues are removed. When any one or more of these mass values are detected as a result of mass spectrometry, it can be considered that the subject has been infected with a strain expressing one or more NDM subtype proteins, i.e., a pathogenic strain having resistance to carbapenem antibiotics.

[0059] As used herein, the term "mass value (m / z x z)" means the average molecular weight of the protein to be detected or the Daltons value representing the average molecular weight. However, when the same protein is detected using other reference mass values (e.g., a single isotope mass value) that can be inferred from this mass value (m / z x z), the detection is considered to be the same as the detection made in the present application. For example, when identifying the presence or absence of infection with an NDM-expressing strain based on the single isotope mass of NDM-1 (26493.16), the identification is the same as identifying the presence or absence of infection with an NDM-expressing strain using 26510 m / z x z, which can be easily inferred from the single isotope mass value as a reference value by those skilled in the art.

[0060] According to one embodiment of the present application, the mass values (m / z x z) further include mass values increased by 16 or 32 from each mass value.

[0061] As shown in the following examples, the present inventors found that one or two of the seven methionine residues (positions 39, 67, 126, 129, 245, 248, and 265) in the NDM protein exist in an oxidized state. Therefore, even when the measured molecular weight increases from the above mass value by one oxygen atom (+16) or two oxygen atoms (+32), it can be determined that the strain expressing the NDM protein still exists in the sample, and thus the presence of an antibiotic-resistant strain can be more accurately detected.

[0062] More specifically, the mass values (m / z x z) further include mass values that increase by 14, 28, or 42 from each mass value.

[0063] As described below, the present inventors found that the NDM protein can exist in a state in which 1, 2, or 3 methylation has occurred. Therefore, even when a molecular weight that increases from the above mass value by 1 methylation (+14), 2 methylation (+28), or 3 methylation (+42) is measured, it can be determined that the strain expressing the NDM protein still exists in the sample.

[0064] More specifically, the mass values (m / z x z) further include mass values that increase by 238 from each mass value.

[0065] As shown in the following examples, peaks corresponding to the palmitoylated protein type were observed in the NDM protein. Therefore, even when a molecular weight that increases in mass value due to palmitoylation (+238) is measured, it can be determined that the strain expressing the NDM protein also exists in the sample, and thus the infection of an antibiotic-resistant strain can be more accurately diagnosed.

[0066] According to a specific embodiment of the present application, when the result of the mass spectrometric analysis is that one or more mass values (m / z x z) selected from the group consisting of 25113, 25151, 25011, 25080, 25020, 25083, 25025, 24952, 25192, 25161, 24973, 24988, 25078, 25365, 25268, 25006, 25186, 24994, 25043, 24945, 25208, 25000, 24980, 25128, 25216, 24983, 25115, 25112, 25116, 25414, 25205, 25041, 25139, 25254, 25050, 24910, 25101, 25021, 25212, 25073, 24961, 25105, 24831, 25353, 25234, 24995, 25071, 25094, 25351, 25174, 25156, 25199, 25129, 24981, 25018, 25335, 25232, 24872, 24982, 25204, 24796, 25259, 25214, 25085, 25135, 25131, 25141, 25145, 25172, 25126, 24990, and values within ±5 of these values are detected, it is considered that a pathogenic strain having resistance to carbapenem antibiotics is present in the biological sample. More specifically, in this case, the pathogenic strain present in the sample is a strain producing an IMP protein.

[0067] According to the present application, the above mass values are mass values of IMP subtype proteins from which 18, 19, 20, or 21 amino acid residues are removed from the N terminus. When one or more of these mass values are detected as a result of mass spectrometry, it can be considered that the subject has been infected with a strain expressing one or more IMP subtype proteins.

[0068] According to a specific embodiment of the present application, when the result of the mass spectrometry analysis is that one or more mass values (m / z x z) selected from the group consisting of: 25322, 25515, 25488, 25391, 25339, 25516, 25464, 25485, 25527, 25531, 25414, 25455, 25421, 25499, 25542, 25129, 25405, 25534, 25446, 25472, 25444, 25298, 25338, 25367, 25355, 25508, 25264, 25306, 25336, 25352, 25543, 25407, 25268, 25419, 25514, 25501, 25487, 25445, 25341, 25364, 25424, 25458, 25491, 25513, 25348, 25518, 25350, and values within ±5 of these values are detected, it is considered that a pathogenic strain resistant to carbapenem antibiotics is present in the biological sample. More specifically, in this case, the pathogenic strain present in the sample is a strain producing VIM protein.

[0069] According to the present application, the above mass values are the mass values of the VIM subtype protein from which the N-terminal 25 or 26 amino acid residues are removed. When one or more of these mass values are detected as a result of the mass spectrometry, it can be considered that the subject has been infected with a strain expressing one or more VIM subtype proteins.

[0070] According to a specific embodiment of the present application, when the result of the mass spectrometry analysis is that one or more mass values (m / z x z) selected from the group consisting of: 29217, 29274, 29186, 29216, 29247, 29246, 29259, 29203, 29231, 29201, 29273, 29261, 29237, 29248, 29230, 29213, 29275, 29278, 29221, 29194, 29338, 29232, 29227, 29251, 29202, 29175, 29369, 29661, and values within ±5 of these values are detected, it is considered that a pathogenic strain resistant to carbapenem antibiotics is present in the biological sample. More specifically, in this case, the pathogenic strain present in the sample is a strain producing GES protein.

[0071] According to the present application, the above mass values are the mass values of the GES subtype protein from which the N-terminal 18 amino acid residues are removed. When one or more of these mass values are detected as a result of the mass spectrometry, it can be considered that the subject has been infected with a strain expressing one or more GES subtype proteins.

[0072] According to a specific embodiment of the present application, the mass values (m / z x z) further include mass values increased by 16 or 32 from each mass value. More specifically, the mass values (m / z x z) further include mass values decreased by 2 from each mass value.

[0073] As described below, the present inventors found that one or two of the six methionine residues (positions 62, 95, 112, 143, 164, and 181) in the GES protein can exist in an oxidized state. Therefore, even when measuring the molecular weight increased by one oxygen atom (+16) or two oxygen atoms (+32) from the mass values listed above, it is possible to determine the presence of a strain expressing the GES protein in the sample. In addition, the present inventors also found that the GES protein can exist in a state in which a disulfide bond exists between the 63rd cysteine and the 233rd cysteine. Therefore, even when measuring the molecular weight decreased (-2) by two hydrogen atoms from the mass values described above due to the disulfide bond, it is possible to determine the presence of a strain expressing the GES protein in the sample, and thus it is possible to more accurately diagnose the infection of an antibiotic-resistant strain.

[0074] Advantageous Effects

[0075] The features and advantages of the present application are summarized as follows:

[0076] (a) The present application provides a method of detecting a pathogenic strain having resistance to carbapenem antibiotics in a biological sample.

[0077] (b) According to the present application, carbapenemases, particularly KPC, OXA, NDM, IMP, VIM, and / or GES proteins, can be directly identified by mass spectrometry, and thus it is possible not only to rapidly identify whether a pathogenic strain has resistance to antibiotics, but also to rapidly identify the type of protein related to the resistance.

[0078] (c) According to the present application, the physical and chemical properties of each carbapenemase in vivo, such as the unique N-terminal truncation length in each carbapenemase, methionine residue oxidation, and disulfide bond formation, are identified and reflected on the reference mass values. Therefore, it is possible to more accurately detect the presence of an antibiotic-resistant strain with high reliability, and thus the present application can be advantageously used to rapidly establish an appropriate antibiotic administration strategy at an early stage of infection. BRIEF DESCRIPTION OF DRAWINGS

[0080] FIG. 1 shows the results of SDS-PAGE analysis of the expression and size of KPC and OXA proteins from antibiotic-resistant strains Figure 1a ), and shows the results of SDS-PAGE analysis of the expression and size of three proteins (NDM, IMP, and VIM) of the metallo-β-lactamase (hereinafter, MBL) family and the class A carbapenemase GES protein Figure 1b ).Figures 1c to 1h SDS-PAGE analysis results showing the expression and size of KPC, OXA, NDM, IMP, VIM, and GES subtype proteins, respectively.

[0081] Figure 2 shows SDS-PAGE analysis results of the expression and size of KPC and OXA proteins Figure 2a ), MBL protein NDM Figure 2b ), IMP Figure 2c ), and VIM Figure 2d ), GES-5 protein Figure 2e ) from clinical strains.

[0082] Figure 3 SDS-PAGE analysis results showing the expression and size of MBL protein depending on the concentration of zinc sulfate (ZnSO4).

[0083] Figure 4 shows the results of a protein difference comparison of crude extracts and crude enzyme solutions after sample pretreatment. For KPC and OXA proteins, cells were disrupted using a non-ionic surfactant Figure 4a ), an ionic surfactant Figure 4b ), and a volatile buffer Figure 4c ), respectively, and the expression and solubility of each protein were analyzed by SDS-PAGE gel analysis. In addition, the expression and solubility of MBL protein in cells disrupted using a non-ionic surfactant Figure 4d ) and the expression and solubility of GES protein in cells disrupted using a volatile buffer Figure 4e ) were analyzed by SDS-PAGE gel analysis.

[0084] Figure 5 shows the results of separating and purifying target proteins using ion chromatography. KPC Figure 5a ), OXA Figure 5b ), NDM Figure 5c ), IMP Figure 5d ), VIM Figure 5e ), and GES-5 Figure 5f ) were separated and purified using a column of anion exchange resin.

[0085] Figure 6 shows the alignment results comparing the representative coverage (gray) of KPC protein, OXA protein, three MBL proteins, and GES protein, and oxidized methionine residues (bold and underlined) Figures 6a to 6f ).

[0086] Figure 7 shows the tandem mass spectrometry results of peptides identified as N-terminal peptides in each protein. Figure 7a is a separation chromatogram of KPC peptides, Figure 7b is the identification results of KPC N-terminal peptides.Figure 7c isolation chromatogram of OXA peptide, Figure 7d is identification result of OXA N-terminal peptide. Figure 7e is an example of isolation chromatogram of NDM peptide, Figure 7f is identification result of NDM N-terminal peptide. Figure 7g is an example of isolation chromatogram of IMP peptide, Figure 7h is identification result of IMP N-terminal peptide. Figure 7i is an example of isolation chromatogram of VIM peptide, Figure 7j is identification result of VIM N-terminal peptide. Figure 7k is an example of isolation chromatogram of GES peptide, Figure 7l is identification result of GES N-terminal peptide. Figures 7m to 7t shows exemplary N-terminal identification results of representative subtypes of each peptide, and shows N-terminal identification results of KPC-3 Figure 7m ), KPC-17 Figure 7n ), OXA-181 Figure 7o ), IMP-1 Figure 7p ), IMP-4 Figure 7q ), VIM-1 Figure 7r ), VIM-4 Figure 7s ), and GES-1 Figure 7t ).

[0087] Figure 8 shows an example of results of multiple alignment analysis of amino acid sequences of KPC Figure 8a ), OXA Figure 8b ), MBL Figures 8c to 8e ), and GES proteins Figure 8f using the ClustalW program, identification results of conserved amino acid sequences. Black boxes indicate N-terminal sequence regions.

[0088] Figure 9 shows results of phylogenetic analysis of KPC Figure 9a ), OXA Figure 9b ), NDM Figure 9c ), IMP Figure 9d ), VIM Figure 9e ), and GES Figure 9f proteins.

[0089] Figure 10 shows identification results of KPC, OXA, NDM, IMP, VIM, and GES proteins using a high-resolution mass spectrometer. Figure 10a shows mass spectrum of a multiple-charge KPC protein (single-isotope mass: 28,700.69 m / z x z, average molecular weight: 28,718.13 m / z x z), Figure 10bThe tandem mass spectra of the KPC protein ion in the +17 charge state are shown, along with the sequence identification results of amino acids from position 22 to 293 (E = 1.8E-9). Figure 10c The mass spectrum of the multiply charged OXA protein is shown (single isotopic mass: 28,129.28 m / z × 28, average molecular weight: 28,146.69 m / z × 28). Figure 10d The tandem spectrum of the OXA protein ion in the +24 charge state is shown, along with the sequence identification results of amino acids from position 23 to 265 (E = 3.47E-42). Figure 10e This is the mass spectrum of a multicharged NDM protein. Figure 10f The image shows the tandem spectrum of the NDM protein ion with a +25 charge state, and the sequence identification results of amino acids from position 20 to 270. Figure 10g This is the mass spectrum of a multicharged IMP protein. Figure 10h The image shows the tandem spectrum of the IMP protein ion with a charge state of +30, and the identification results of the amino acid sequence from position 19 to 246 (E = 2.99E-76). Figure 10i The mass spectrum of the multicharged VIM protein is shown. Figure 10j The tandem mass spectrum of the VIM protein ion with a charge state of +20 is shown, along with the sequence identification results of amino acids from position 27 to 266 (E = 4.76E-49). Figure 10k This is the mass spectrum of a multicharged IMP protein. Figure 10l The image shows the tandem mass spectrum of the GES protein ion with a charge state of +20, and the sequence identification results of amino acids from position 19 to 287 (E = 7.12E-8).

[0090] Figure 11 shows the modification quality values ​​of the NDM protein, obtained by top-down high-resolution mass spectrometry. Figure 11a The quality values ​​for palmitoylated protein types are displayed. Figure 11b The results of methylation of NDM protein and the resulting elution time difference are shown.

[0091] Figure 12 shows the KPC obtained by top-down mass spectrometry using a high-resolution mass spectrometer. Figure 12a ), OXA Figure 12b ), NDM ( Figure 12c ), IMP Figure 12d ), VIM ( Figure 12e ) and GES Figure 12f Protein sequence coverage.

[0092] Figure 13 shows the KPC protein obtained using low-resolution mass spectrometry (MALDI-TOF). Figure 13a ), OXA protein ( Figure 13b ), MBL protein NDM (Figure 13c ), IMP ( Figure 13d ), and VIM ( Figure 13e ), and GES protein ( Figure 13f ).

[0093] Embodiments of the Invention

[0094] Hereinafter, the present application will be described in more detail with reference to examples. These examples are for a more detailed illustration of the present application and it is obvious to a person skilled in the art that the scope of the present application according to the present inventive subject matter is not limited by these examples. Examples

[0095] Experimental Methods

[0096] Example 1. Cloning of β-lactam antibiotic resistance genes and construction of resistant strains

[0097] Based on the genetic sequence information obtained from the genes of carbapenamases (European Molecular Biology Laboratory (EMBL) nucleotide sequence database accession number: KPC = CP026395.1, 882 nt, OXA = AY236073.2, 798 nt, NDM = CAZ39946.1, 813 nt, VIM = AY884050.1, 801 nt, IMP = AB616660.2, 741 nt, GES = DQ236171.1, 864 nt), the desired genetic sequence was prepared by synthesis (Table 1). The following primers were prepared using the synthetic genes.

[0098] 1) KPC

[0099] Primer 1: 5'-AACTGCAGGATGTCACTGTATCGCCGTCTA-3' (30 mer)

[0100] Primer 2: 5'-GGAATTCTTACTGCCCGTTGACGCC-3' (25 mer)

[0101] 2) OXA

[0102] Primer 1: 5'-AACTGCAGGATGCGTGTATTAGCCTTATCGG-3' (31 mer)

[0103] Primer 2: 5'-GGAATTCCTAGGGAATAATTTTTTCCTGTTTGA-3' (33 mer)

[0104] 3) NDM

[0105] Primer 1 : 5'-AAC TGC AGG ATG GAA TTG CCC AAT ATT ATG CA-3' (32 mer)

[0106] Primer 2: 5'-GGA ATT CTC AGC GCA GCT TGT CGG-3' (24 mer)

[0107] 4) IMP

[0108] Primer 1 : 5'-AAC TGC AGG ATG AGC AAG TTA TCT GTA TTC TTT ATA T-3' (37 mer)

[0109] Primer 2: 5'-GGA ATT CTT AGT TGC TTG GTT TTG ATG GTT TTT-3' (33 mer)

[0110] 5) VIM

[0111] Primer 1 : 5'-AAC TGC AGG ATG TTC AAA CTT TTG AGT AAG TTA TTG-3' (36 mer)

[0112] Primer 2: 5'-GGA ATT CCT ACT CAA CGA CTG AGC GAT T-3' (28 mer)

[0113] 6) GES

[0114] Primer 1 : 5'-AAC TGC AGG ATG CGC TTC ATT CAC GCA CTA T-3' (31 mer)

[0115] Primer 2: 5'-CGG AAT TCC TAT TTG TCC GTG CTC AGG AT-3' (29 mer)

[0116] Restriction enzyme sites for cloning were added to the primers and open reading frames (ORFs) were created to induce expression directly in the cloning vectors.

[0117] Each target gene was amplified by PCR from three template DNAs. For PCR, 3 μl of template DNA, 1.25 μl of 5' primer, 1.25 μl of 3' primer, 1 μl of dNTPs, 10 μl of 5X buffer, and 5X GC enhancer buffer were used to prepare a total of 50 μl of PCR reaction solution, and then PCR was performed under the following conditions: 1) denaturation - 98°C for 10 seconds; 2) annealing - 57°C for 30 seconds; 3) extension - 72°C for 30 seconds. Cloning for constructing recombinant plasmids containing each target gene was performed as follows: 1) for insertion of genes and vectors, both ends of DNA were cut into sticky ends using a restriction enzyme, and 2) the inserted genes were ligated into the vectors using a DNA ligase. 3) Thereafter, the vectors were transformed into E. coli Top 10, 4) recombinant E. coli was screened by white / blue selection method. 5) The recombinant plasmids were extracted from the screened strains, 6) the extracted plasmids were treated with a restriction enzyme, and the DNA size was measured. 7) Finally, the inserted genes were confirmed by DNA sequencing.

[0118] [Table 1]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124] Example 2. Expression and size analysis of each target protein

[0125] (1) Target protein production and identification

[0126] E. coli transformed with plasmids containing each target gene was inoculated into Luria-bertani liquid medium containing 50 mg / L of ampicillin antibiotic, and cultured at 37°C for 16 hours or more. In order to analyze the expression and size of each target protein, the culture was centrifuged at 4,000 rpm for 15 minutes, and the cells were harvested by removing the supernatant. The harvested cells were added to SDS sample buffer, heated at 95°C for 5 minutes, and centrifuged at 15,000 rpm for 5 minutes. Using the prepared samples, the expression and size of each target protein were analyzed by SDS-PAGE gel analysis (FIG. 1).

[0127] (2) Confirmation of KPC and OXA genotypes from clinical strains and confirmation of proteins

[0128] To confirm KPC and OXA from clinical strains, strains confirmed as positive for extended spectrum beta-lactamase (ESBL) were collected. The collected strains were subjected to colony PCR using primer pairs for amplification of KPC and OXA genes. The resulting amplified PCR products were subjected to agar gel electrophoresis to confirm the size of the target genes. The PCR products whose sizes were confirmed were subjected to DNA sequencing to confirm the exact genotypes of KPC and OXA genes.

[0129] Strains whose genotypes were confirmed were cultured in LB liquid medium, and SDS-PAGE gel analysis was performed to check whether KPC and OXA proteins would be expressed. In addition, recombinant strains containing KPC and OXA genes from clinical strains were constructed by the same method as the existing recombinant strains containing vectors containing KPC and OXA genes, and the recombinant strains were also subjected to SDS-PAGE gel analysis in the same manner as the clinical strains to confirm the size of the KPC and OXA proteins actually expressed (FIG. 2).

[0130] KPC and OXA proteins from clinical strains were both identified by the Q-TOF MS method. For KPC, it was confirmed that the sequence coverage of the identified peptides was 62.46% (183 / 293) in the full-length protein sequence and 67.28% (183 / 272) in the active form not containing the N-terminus. In addition, for OXA, it was confirmed that the sequence coverage of the identified peptides was 16.98% (45 / 265) in the full-length protein amino acid sequence and 18.52% (45 / 243) in the active form sequence.

[0131] (3) MBL protein production and identification

[0132] The E. coli transformed with the plasmid containing the target MBL gene was inoculated into Luria-bertani liquid medium containing 50 mg / L of ampicillin antibiotic and zinc sulfate (0.01 mM to 1 mM ZnSO4) and cultured at 37°C for 16 hours or more. To analyze the expression and size of the target protein, the culture was centrifuged at 4,000 rpm for 15 minutes, and the cells were harvested by removing the supernatant. The harvested cells were added to SDS sample buffer, heated at 95°C for 5 minutes, and centrifuged at 15,000 rpm for 5 minutes. Using the prepared sample, the expression and size of the target protein were analyzed by SDS-PAGE gel analysis Figure 3 ).

[0133] Example 3. Sample pretreatment method and identification of target protein in crude enzyme solution

[0134] (1) Pre-treatment of samples with non-ionic surfactant

[0135] For sample pretreatment, the culture was centrifuged at 4,000 rpm for 15 minutes, and the cells were harvested by removing the supernatant. To obtain a crude extract, the cells were treated with a buffer solution (0.25 mM Tris-HCl, 2% OG) and incubated at room temperature for 10 minutes. The prepared crude extract was separated into a supernatant (hereinafter referred to as a crude enzyme solution) and a precipitate by centrifugation at 15,000 rpm for 10 minutes at 4°C. From the crude enzyme solution, the expression and size of the target protein were analyzed by SDS-PAGE analysis (FIG. 4).

[0136] (2) Pre-treatment of samples with ionic surfactant

[0137] Sample pretreatment was performed by the following steps: 1) centrifuging 100 ml of the expressed cell culture to recover the cells, 2) removing the supernatant, and then adding a buffer solution (0.25 mM Tris-HCl, pH 8.0 and 2% DOC) containing 2% sodium deoxycholate (DOC) as a non-ionic surfactant to the cells. 3) incubating the suspension at room temperature for 10 minutes, 4) centrifuging at 15,000 rpm for 10 minutes at 4°C to obtain a crude enzyme solution.

[0138] From the crude extract and the crude enzyme solution obtained by treatment with the ionic surfactant (DOC), the expression and size of the protein were analyzed by SDS-PAGE gel analysis. Figure 4b ).

[0139] (3) Pre-treatment of samples with volatile buffer

[0140] Sample pretreatment was performed by the following steps: 1) centrifuging 100 ml of the expressed cell culture to recover the cells, 2) removing the supernatant, and then adding a buffer solution (0.25 mM Tris-HCl, pH 8.0 and 2% DOC) containing 2% sodium deoxycholate (DOC) as a non-ionic surfactant to the cells. 3) incubating the suspension at room temperature for 10 minutes, 4) centrifuging at 15,000 rpm for 10 minutes at 4°C to obtain a crude enzyme solution. Figure 4c and 4e ).

[0141] (4) Pre-treatment of samples by sonication

[0142] The cells in the suspension treated by the above methods (1) to (3) were disrupted by treating with a sonicating bath (JAC 2010, Hansol Tech, Korea) at 40 Hz and 200 W for 5 to 10 minutes, and 15,000 rpm for 10 minutes to recover the supernatant.

[0143] Example 4. Isolation / Purification of Target Protein

[0144] Ion exchange chromatography was used to isolate / purify each target protein. For anion exchange chromatography, a column containing Q-resin was used, and for cation exchange chromatography, a column containing SP-resin was used.

[0145] (1) Anion exchange resin chromatography

[0146] The crude enzyme solution was loaded into a column containing Q-resin, and then elution solution was collected. The column was washed with 1 ml of 20 mM Tris-HCl (pH 8.0) buffer, and elution solution containing 100 mM NaCl, 200 mM NaCl, 300 mM NaCl, 400 mM NaCl, and 500 mM NaCl 1M, respectively, was sequentially applied to the column at 250 μl, and elution was collected in each zone.

[0147] (2) Cation exchange resin chromatography

[0148] Each target protein was isolated / purified in the same manner as (1) anion exchange resin chromatography using a column containing SP-resin.

[0149] Finally, six desired target proteins were isolated / purified by the above ion exchange chromatography method (Fig. 4). Finally, each high-purity protein was isolated / purified from the cell lysate using the same method as described above.

[0150] Example 5. Expression and size analysis of each target protein

[0151] The proteins expressed and size-confirmed on the SDS-PAGE gel were identified using the in-gel digestion method and nanoLC-MS / MS method, thereby determining the type of antibiotic resistance protein actually expressed in the strain (Fig. 7).

[0152] (1) In-gel digestion

[0153] Only the band portion corresponding to the size of each target protein on the SDS-PAGE gel was obtained, and the gel after staining was destained. The destained gel was subjected to reduction / alkylation treatment, and then the proteins were selectively digested using trypsin. The digested peptides were recovered using a DK-Tip (C18 Tip) and desalted.

[0154] (2) Nano LC-MS / MS

[0155] To confirm the sequence and coverage of the active protein expressed in the strain, nano liquid chromatography and high resolution mass spectrometry (Q-Exactive HF-X mass spectrometry system) were performed. The desalted peptide sample was dissolved with 0.1% formic acid solution and then loaded into a column. The peptide sample was separated using a C18 column (75 μm x 70 cm) and nano flow liquid chromatography. In this case, the gradient conditions for sample loading and separation are exemplified as follows:

[0156] - Buffer A: 0.1% formic acid aqueous solution / Buffer B: 0.1% formic acid acetonitrile solution

[0157] - Sample loading: 5% (B) from 0 to 5 minutes, 5 μL / min flow rate

[0158] - Separation concentration gradient:

[0159] From 5 to 7 minutes, from 5% to 10% (B), 300 nL / min flow rate

[0160] From 7 to 38 minutes, from 10% to 40% (B), 300 nL / min flow rate

[0161] From 38 to 38.5 minutes, from 40% to 80% (B), 300 nL / min flow rate

[0162] From 38.5 to 39.5 minutes, 80% (B), 300 nL / min flow rate

[0163] From 39.5 to 40 minutes, from 80% to 5% (B), 300 nL / min flow rate

[0164] From 40 to 60 minutes, 5% (B), 300 nL / min flow rate

[0165] In this case, examples of the mass spectrometer parameters used are as follows:

[0166] - Resolution: Full MS 60,000, MS2 30,000

[0167] - Full MS: 350 to 2,000 m / z, 100 msec

[0168] - MS2: 50 msec, NCE 28,1, ionization materials with a charged state > 6 were excluded from MS2 analysis

[0169] The "Proteome Discoverer (v2.4)" software (Thermo Scientific) was used for data- driven identification of peptides and proteins from bottom-up, with protein / peptide identification based on 1% FDR (false discovery rate). Out of the proteins from E. coli, KPC, OXA, MBL proteins or GES proteins, 200 peptides were identified for KPC proteins (Table 2), 177 peptides for OXA (Table 3), 109 peptides for NDM proteins (Table 4), 146 peptides for IMP (Table 5), 159 peptides for VIM proteins (Table 6) and 111 peptides for GES (Table 7).

[0170] [Table 2] Position and sequence information of each peptide identified as KPC proteins

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179]

[0180] [Table 3] Position and sequence information of each peptide identified as OXA proteins

[0181]

[0182]

[0183]

[0184]

[0185]

[0186]

[0187]

[0188]

[0189] [Table 4] Position and sequence information of each peptide identified as NDM protein

[0190]

[0191]

[0192]

[0193]

[0194]

[0195]

[0196]

[0197] [Table 5] Peptide information of each peptide identified as IPM protein peptide segment, position and sequence

[0198]

[0199]

[0200]

[0201]

[0202]

[0203]

[0204]

[0205]

[0206]

[0207]

[0208] [Table 6] Position and sequence information of each peptide identified as VIM protein

[0209]

[0210]

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218] [Table 7] Position and sequence information of each peptide identified as GES protein

[0219]

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

[0226] For the KPC protein, a peptide in which one of the three methionine residues (49, 116, and 151) is in an oxidized form was identified ( Figure 6a ). For OXA, a peptide in which one of the six methionine residues (115, 138, 195, 237, 239, and 241) or two or three methionine residues are in an oxidized form was identified ( Figure 6b ).

[0227] Specifically, for the KPC protein, an N-terminal sequence peptide consisting of residues 1-21 was not detected, and for the OXA protein, an N-terminal sequence peptide consisting of residues 1-22 was not detected. For this KPC, when considering the sequence other than residues 1-21, a peptide segment covering the entire sequence was identified, and the sequence coverage increased from 92.8% (272 / 293) to 100% (272 / 272). For OXA, when considering the sequence other than residues 1-22, the sequence coverage increased from 91.7% (243 / 265) to 100% (243 / 243).

[0228] For the NDM protein, a peptide in which one of the seven methionine residues (39, 67, 126, 129, 245, 248, and 265) is in an oxidized form was identified ( Figure 6e). For GES, peptides in which one or two of the six methionine residues (62, 95, 112, 143, 164 and 181) were in the oxidized form were identified ( Figure 6f ). For IMP and VIM, no peptides in which the methionine was in the oxidized form were identified ( Figure 6d and 6e ).

[0229] For IMP and VIM proteins, the N-terminal sequence peptides consisting of residues 1-18 and residues 1-26, respectively, were not detected, while for GES, the N-terminal sequence peptide consisting of residues 1-18 was not detected. When considering the sequence of the target protein excluding the N-terminus, the sequence coverage was NDM 97.2 (243 / 250), IMP 97.8% (223 / 228), VIM 100% (240 / 240) and GES 98.5% (265 / 269).

[0230] (3) Identification of N-terminal sequence (Figure 7)

[0231] KPC

[0232] N-terminal sequence: (S) / ATALTNLVAEPFAK(L) (semi-tryptic)

[0233] KPC-3

[0234] N-terminal sequence: (S) / ATALTNLVAEPFAK(L) (semi-tryptic)

[0235] KPC-17

[0236] N-terminal sequence: (S) / ATALTNLVAEPFAK(L) (semi-tryptic)

[0237] OXA

[0238] N-terminal sequence: (A) / KEWQENK(S) (semi-tryptic)

[0239] OXA-181

[0240] N-terminal sequence: (A) / KEWQENKSWNAHFTEHK(S) (semi-tryptic)

[0241] NDM

[0242] N-terminal sequence: (M)PGEIRPTIGQQMETGDQR(F) (semi-tryptic)

[0243] IMP

[0244] N-terminal sequence: (A) AESLPDLK (I) (Chymotrypsin)

[0245] IMP-1

[0246] N-terminal sequence: (A) / AESLPDLK (I) (Chymotrypsin)

[0247] IMP-4

[0248] N-terminal sequence: (A) / AESLPDLK (I) (Chymotrypsin)

[0249] VIM

[0250] N-terminal sequence: (S) / VDSSGEYPTVSEIPVGEVR (L) (Chymotrypsin)

[0251] VIM-1

[0252] N-terminal sequence: (S) / GEPSGEYPTVNEIPVGEVR (L) (Chymotrypsin)

[0253] VIM-4

[0254] N-terminal sequence: (S) / GEPSGEYPTVNEIPVGEVR (L) (Chymotrypsin)

[0255] GES

[0256] N-terminal sequence: (A) SEKLTFK (T) (Chymotrypsin)

[0257] GES-1

[0258] N-terminal sequence: (A) / SEKLTFK (T) (Chymotrypsin)

[0259] Example 6. Amino acid sequencing and characterization of each protein

[0260] Based on the MS2 results obtained in Example 5, a total of 43 KPC subtype proteins (NCBI database) (Example 6.1), Figure 8a 660 OXA subtype proteins (NCBI database) (Example 6.2), Figure 8b 27 NDM subtype proteins (NCBI database) (Example 6.3), Figure 8c 79 IMP subtype proteins (NCBI database) (Example 6.4), and Figure 8d), 66 VIM subtype proteins ( Figure 8e ), and 43 GES subtype proteins ( Figure 8f ) were subjected to multiple alignment analysis.

[0261] KPC and OXA proteins

[0262] It was confirmed that 97.3% or more of the full-length amino acid sequences of 42 proteins including KPC-2 were conserved, and 91.3% or more of the full-length amino acid sequences of 30 proteins including OXA-48, which is resistant to carbapenem antibiotics, were conserved. In order to identify the characteristics of each protein, phylogenetic tree analysis of KPC and OXA was performed by the MEGA X program ( Figure 9a and 9b ). Specifically, 43 KPC subtype proteins all contained the same N-terminal peptide (1st to 21st amino acids), and 35 subtype proteins including KPC-2 consisted of a sequence consisting of 293 amino acids. For OXA, 30 OXA proteins containing the same N-terminal peptide (1st to 22nd amino acids) were identified, and 23 OXA proteins were characterized by the same sequence as OXA-48 consisting of a sequence consisting of 265 amino acids.

[0263] MBL proteins and GES proteins

[0264] The sequence similarity was confirmed to be 90.9% (NDM), 44.8% (IMP), 63.5% (VIM), and 86.5% (GES). As subtype proteins having the same N-terminal, 27 NDM subtype proteins, 23 IMP subtype proteins (89.4%), 26 VIM subtype proteins (92.1%), and 35 GES subtype proteins (87.9%) were identified. As subtype proteins having the same number of N-terminal sequences and the same full-length amino acid sequence, 26 NDM subtype proteins (92.6%), 23 IMP subtype proteins (89.4%), 25 VIM subtype proteins (93.6%), and 34 GES subtype proteins (88.9%) were identified. In order to identify the characteristics of each protein, phylogenetic tree analysis of MBL proteins and GES proteins was performed by the MEGA X program ( Figures 9c to 9f ). As a result, it could be confirmed that each of the subgroups containing NDM-1, IMP-6, VIM-2, and GES-5 was grouped in the phylogenetic tree analysis, as in the results confirmed in the multiple alignment analysis.

[0265] Example 7. Identification of target proteins using mass spectrometry (top-down method)

[0266] To determine the mass value of the active protein expressed in the strain, a top-down mass spectrometry was performed. To confirm the accurate mass value of the protein, a sample obtained from a partially purified crude protein extract from the strain source was used, and an LC-MS / MS system (Nano-LC and Q-Exactive HF-X mass spectrometer) capable of top-down analysis was used.

[0267] (1) Mass spectrometry of purified proteins

[0268] About 0.5 μg of the partially purified protein sample was injected. Analysis was performed using a direct injection method without a column and using a nanoflow pump. The sample analysis conditions used in this case are as follows.

[0269] - Buffer A: 0.1% formic acid aqueous solution

[0270] - Sample analysis: 100% of the fixed buffer (A) 100% for 0 to 10 minutes, 4 μL / min of the fixed flow rate

[0271] (2) Mass spectrometry analysis of target proteins using high resolution mass spectrometry

[0272] The mass value of the intact protein and the tandem mass spectrum of the protein were obtained and identified using the protein mode analysis method of the Q-Exactive HF-X mass spectrometer. The parameters used in this case are as follows.

[0273] - Resolution: 120,000 using full MS 120,000, MS2 60,000 or 120,000

[0274] - Full MS: 620 to 2,400 m / z, 100 msec

[0275] - MS2: 1 or 2 microscans were used, 1,000 msec, NCE 50; ionization materials with a charged state of 1 to 8 were excluded in the MS2 analysis.

[0276] The software "Informed Proteomics" developed by the United States PNNL (Pacific Northwest National Laboratory) based on top-down data to identify proteins was used.

[0277] KPC and OXA proteins

[0278] Several multi-charge KPC protein (z = +13 to +20) or OXA protein (z = +22 to +37) peaks appeared Figure 10a and 10b), and confirmed that the representative mass value obtained by peak deconvolution was an average molecular mass of 28,718.13 m / z x z, corresponding to a monoisotopic mass of 28,700.69 m / z x z. The determined representative mass value represents the mass value of the KPC protein in the presence of a disulfide bond between the 68th cysteine and the 237th cysteine. In addition, other peaks caused by methionine oxidation were observed (e.g., the polypeptide having one oxidized methionine showed an average molecular mass of 28,718 + 16 m / z x z). They partially coincide with the positions of the oxidized methionine residues in the KPC or OXA protein sequence obtained by in-gel digestion (top-down approach) (49th, 116th and 151st positions of KPC, 115th, 138th, 195th, 237th, 239th and 241st positions of OXA). Even in the analysis based on the top-down approach, no polypeptide including the N-terminal sequence consisting of the 1st to 21st residues of KPC or the 1st to 22nd residues of OXA was observed. When the respective N-terminal sequences were excluded, both KPC (22nd to 293rd amino acids) and OXA (23rd to 265th amino acids) showed 100% sequence coverage. Figure 12a and 12b ).

[0279] MBL proteins and GES proteins

[0280] Peaks of multiple charged MBL proteins or GES proteins appeared Figure 10c , 10e , 10g and 10i), and it was confirmed that, for NDM, the representative mass value obtained by peak deconvolution was an average molecular mass of 26,724 m / z x z, corresponding to a monoisotopic mass of 26,707 m / z x z. It was confirmed that the average molecular mass of IMP was 25,082.68 m / z x z, the corresponding monoisotopic mass was 25,067.19 m / z x z, the average molecular mass of VIM was 25,515.42 m / z x z, the corresponding monoisotopic mass was 25,499.92 m / z x z, and the average molecular mass of GES was 29,245.15 m / z x z, the corresponding monoisotopic mass was 29,226.92 m / z x z. It was confirmed that the identified representative mass value of NDM corresponds to the palmitoylated protein type Figure 11a ). In addition, other peaks caused by methionine oxidation and methylation were also observed (e.g., the average molecular mass of the polypeptide having one oxidized methionine was 26,724 + 16 m / z x z, and the average molecular mass of the polypeptide having one methylated was 26,724 + 14 m / z x z) Figure 11b). On the other hand, for IMP and VIM, no specific protein modification was found. For GES, a disulfide bond was found between the cysteine at position 63 and the cysteine at position 233, and other peaks caused by methionine oxidation were also observed. They were partially consistent with the positions of oxidized methionine residues in the protein sequence of NDM or GES obtained by in-gel digestion (bottom-up approach) (positions 39, 67, 126, 129, 245, 248, and 265 for NDM, positions 62, 95, 112, 143, 164, 181 for GES). Even in the analysis based on the top-down approach, no polypeptide including the N-terminal sequence consisting of residues 1-19 or 1-20 for NDM, residues 1-18 for IMP, residues 1-26 for VIM, or residues 1-18 for GES was observed. When the respective N-terminal sequence was excluded, 100% sequence coverage proteins were identified in residues 21-270 for NDM proteins ( Figure 12c ), residues 19-246 for IMP proteins ( Figure 12d ), and residues 27-266 for VIM ( Figure 12e ). In addition, for GES proteins, 100% sequence coverage was identified in residues 19-287 ( Figure 12f ).

[0281] (3) Mass spectrometry analysis of target proteins using low resolution mass spectrometry

[0282] Mass spectrometric profiles of each protein were obtained using a low-resolution mass spectrometer (1, SciEX 4800; 2, Bruker Biotyper MALDI-TOF MS system). First, 1 μL of sinapinic acid (SA) matrix (present at 10 mg / mL in 0.1% TFA / 50% acetonitrile) and about 100 ng of each protein were placed on a plate spot, completely dried, and subjected to mass spectrometric analysis. Protein samples can use colonies cultured in all solid cultures, cells harvested in liquid culture, crude extracts after cell lysis, and crude enzyme solutions, and purified proteins obtained after purification. In this case, the maximum energy used was 30%, random position acquisition was performed, a total of 2000 laser irradiations (40 times each) were performed, and each spectrum data was cumulatively obtained. Mass spectrometric profiles in the range of 10,000 to 40,000 m / z (KPC and OXA) or 35,000 m / z (MBL and GES) were obtained, while detecting each target protein in the charge state of +1 and each target protein in the charge state of +2 (FIG. 13). As a result of low-resolution mass spectrometric analysis, for all three MBL proteins and GES proteins, both +1 and +2 charge states were detected. In particular, for NDM proteins, which are proteins anchored to the cell membrane, the molecular weight corresponding to palmitoylation (average mass = 238.4136, monoisotopic mass = 238.22966) and the molecular weight corresponding to non-palmitoylation were identified.

[0283] (4) Comparison of protein subtype mass values

[0284] The accurate mass values of KPC, OXA, MBL, and GES proteins were confirmed by the above method, and the mass values of active proteins from which N-terminal peptides were removed can be confirmed according to the confirmed mass values. Therefore, for all KPC, OXA, MBL, and GES proteins found in NCBI, the exact mass values of active proteins can be confirmed by high-resolution or low-resolution mass spectrometry, and various types of subtype proteins can be rapidly and accurately identified by mass spectrometry (Tables 8 to 13).

[0285] [Table 8] Mass data of KPC proteins

[0286]

[0287]

[0288]

[0289]

[0290]

[0291] [Table 9] Mass data of OXA proteins

[0292]

[0293]

[0294] [Table 10] Mass data of NDM proteins

[0295]

[0296]

[0297] [Table 11] Mass data of IMP proteins

[0298]

[0299]

[0300]

[0301] [Table 12] Mass data of VIM proteins

[0302]

[0303]

[0304]

[0305] [Table 13] Mass data of GES proteins

[0306]

[0307]

[0308]

[0309]

[0310]

[0311] Example 8. Genotyping and protein identification of MBL proteins and GES derived from clinical strains

[0312] In order to identify NDM, IMP and VIM (MBL proteins) and GES (class A carbapenem protein) from clinical strains, strains confirmed as CRE (carbapenem-resistant Enterobacteriaceae) positive were collected. The collected strains were subjected to genotyping for each gene using a PCR method.

[0313] The strains of confirmed genotypes were cultured using LB liquid medium, and whether MBL proteins (NDM, IMP, and VIM) and GES proteins were expressed was analyzed by SDS-PAGE gel analysis (FIG. 2).

[0314] The MBL proteins and GES proteins derived from clinical strains were digested by in-gel digestion, and identified by bottom-up method using Q-Exactive HF-X plus system. It was confirmed that for NDM, the sequence coverage of the identified peptides was 61.11% (165 / 270) in the full-length protein sequence, and 65.74% (165 / 251) in the active form excluding the N-terminus. It was confirmed that for IMP and VIM, the sequence coverage of the identified peptides was 22.76% (56 / 246) and 44.74% (119 / 266), respectively, in the full-length protein sequence, and 24.56% (56 / 228) and 49.58% (119 / 240), respectively, in the active form excluding the N-terminus. In addition, it was confirmed that for GES, the full-length amino acid sequence coverage of the identified peptides was 67.25% (193 / 287), and the active protein sequence coverage was 71.75% (193 / 269).

[0315] Although the present application has been described in detail with reference to specific features, it is apparent that the description is only a preferred embodiment and does not limit the scope of the present application. Therefore, the substantial scope of the present application will be defined by the appended claims and their equivalents. <110> HIRAIN MEDICAL FOUNDATION <120> Direct detection method of carbapenem antibiotic-resistant pathogenic strain <130> POPB214217PCTUS <150> KR 10-2019-0177683 <151> 2019-12-30 <160> 18 <170> KoPatentIn 3.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> KPC F primer <400> 1 aactgcagga tgtcactgta tcgccgtcta 30 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> KPC R primer <400> 2 ggaattctta ctgcccgttg acgcc 25 <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> OXA F primer <400> 3 aactgcagga tgcgtgtatt agccttatcg g 31 <210> 4 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> OXA R primer <400> 4 ggaattccta gggaataatt ttttcctgtt tga 33 <210> 5 <211> 882 <212> DNA <213> Artificial Sequence <220> <223> Synthetic KPC <400> 5 atgtcactgt atcgccgtct agttctgctg tcttgtctct catggccgct ggctggcttt 60 tctgccaccg cgctgaccaa cctcgtcgcg gaaccattcg ctaaactcga acaggacttt 120 ggcggctcca tcggtgtgta cgcgatggat accggctcag gcgcaactgt aagttaccgc 180 gctgaggagc gcttcccact gtgcagctca ttcaagggct ttcttgctgc cgctgtgctg 240 gctcgcagcc agcagcaggc cggcttgctg gacacaccca tccgttacgg caaaaatgcg 300 ctggttccgt ggtcacccat ctcggaaaaa tatctgacaa caggcatgac ggtggcggag 360 ctgtccgcgg ccgccgtgca atacagtgat aacgccgccg ccaatttgtt gctgaaggag 420 ttgggcggcc cggccgggct gacggccttc atgcgctcta tcggcgatac cacgttccgt 480 ctggaccgct gggagctgga gctgaactcc gccatcccag gcgatgcgcg cgatacctca 540 tcgccgcgcg ccgtgacgga aagcttacaa aaactgacac tgggctctgc actggctgcg 600 ccgcagcggc agcagtttgt tgattggcta aagggaaaca cgaccggcaa ccaccgcatc 660 cgcgcggcgg tgccggcaga ctgggcagtc ggagacaaaa ccggaacctg cggagtgtat 720 ggcacggcaa atgactatgc cgtcgtctgg cccactgggc gcgcacctat tgtgttggcc 780 gtctacaccc gggcgcctaa caaggatgac aagcacagcg aggccgtcat cgccgctgcg 840 GCTAGACTCG CGCTCGAGGG ATTGGGC GTC AACGGGCAGT AA 882 <210> 6 <211> 798 <212> DNA <213> Artificial Sequence <220> <223> Synthetic OXA <400> 6 ATGCGTGTAT TAGCCTTATC GGCTGTGTTT TTGGTGGCAT CGATTATCGG AATGCCTGCG 60 GTTTATGTTT ATGTTTATGT TTATGTTTAT GTTTATGTTT ATGTTTATGT TTATGTTTA 120 CAGGGCGTAG TTGTGCTCTG GAATGAGAAT AAGCAGCAAG GATTTACCAA TAATCTTAA 180 CAGGGCGTAG TTGTGCTCTG GAATGAGAAT AAGCAGCAAG GATTTACCAA TAATCTTAA 180 CCTGTTTATC AAGAATTTGC CCGCCAAATT GGC GAGGCACGTATGAGCAAGATGCTACAT 420 CCTGTTTATC AAGAATTTGC CCGCCAAATT GGC GAGGCACGTATGAGCAAGATGCTACAT 420 CCTGTTTATC AAGAATTTGC CCGCCAAATT GGC GAGGCACGTATGAGCAAGATGCTACAT 420 CCTGTTTATC AAGAATTTGC CCGCCAAATT GGC GAGGCACGTATGAGCAAGATGCTACAT 420 CCTGTTTATC AAGAATTTGC CCGCCAAATT GGC GAGGCACGTATGAGCAAGATGCTACAT 420 ttacacgtat cggagcgcag ccagcgtatt gtcaaacaag ccatgctgac cgaagccaat 600 ggtgactata ttattcgggc taaaactgga tactcgacta gaatcgaacc taagattggc 660 tggtgggtcg gttgggttga acttgatgat aatgtgtggt tttttgcgat gaatatggat 720 atgcccacat cggatggttt agggctgcgc caagccatca caaaagaagt gctcaaacag 780 gaaaaaatta ttccctag 798 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> NDM primer 1 <400> 7 aactgcagga tggaattgcc caatattatg ca 32 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NDM primer 2 <400> 8 ggaattctca gcgcagcttg tcgg 24 <210> 9 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> IMP primer 1 <400> 9 aactgcagga tgagcaagtt atctgtattc tttatat 37 <210> 10 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> IMP primer 2 <400> 10 ggaattctta gttgcttggt tttgatggtt ttt 33 <210> 11 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> VIM primer 1 <400> 11 aactgcagga tgttcaaact tttgagtaag ttattg 36 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> VIM primer 2 <400> 12 ggaattccta ctcaacgact gagcgatt 28 <210> 13 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> GES primer 1 <400> 13 aactgcagga tgcgcttcat tcacgcacta t 31 <210> 14 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> GES primer 2 <400> 14 cggaattcct atttgtccgt gctcaggat 29 <210> 15 <211> 813 <212> DNA <213> Artificial Sequence <220> <223> Synthetic NDM <400> 15 atggaattgc ccaatattat gcacccggtc gcgaagctga gcaccgcatt agccgctgca 60 ttgatgctga gcgggtgcat gcccggtgaa atccgcccga cgattggcca gcaaatggaa 120 actggcgacc aacggtttgg cgatctggtt ttccgccagc tcgcaccgaa tgtctggcag 180 cacacttcct atctcgacat gccgggtttc ggggcagtcg cttccaacgg tttgatcgtc 240 agggatggcg gccgcgtgct ggtggtcgat accgcctgga ccgatgacca gaccgcccag 300 atcctcaact ggatcaagca ggagatcaac ctgccggtcg cgctggcggt ggtgactcac 360 gcgcatcagg acaagatggg cggtatggac gcgctgcatg cggcggggat tgcgacttat 420 gccaatgcgt tgtcgaacca gcttgccccg caagagggga tggttgcggc gcaacacagc 480 CTGACTTTCG CCACAATGGC TGGGTCAAAC CAGCAACCGC GCCCAACTTT GGCCTGCTC 540 AAGGTATTTT ACCCCGGCCC GGCCACACCC AGTGACAATA TCACCGTTGG GATCGACGGC 600 ACCACATCGC TTTTGCTGGC TGCCTGATCA AGGACAGCAA GGCCAAGTC GCTCGGCAAT 660 CTCGGTGATG CCACACTGAG CACTACGCCG CTCAGCGCGC GCCTTTGGTG CCGCCTTCG 720 CCCAAGGCCA GATGATCGTG ATGAGCCATT CCACCCCCGA TAGCCGCGCC CAATCACC 780 CATAACGGCC CGATGGCCGA CAAGCTGCGC TGA 813 <210> 16 <211> 741 <212> DNA <213> Artificial Sequence <220> <223> Synthetic IMP <400> 16 ATGAGCAAGT TATCTGTATT CTTTATATTT TTGTTTTGCA GCATTGCTAC Cgcagcagag 60 TCTTTGCCAG ATTAAAAAAT TGAAAAGCTT GATGAAGGCG TTTATGTTCA ACTTCGTTC 120 GAAGAAGTT A ACgggtgggg Cgttgttcct AAACATGGTT TGgtggttct TGtaaatgct 180 GAGGCTTACC TAATTGACAC TCCATTTACG GCTAAAGATA CTGAAAAGTT AGTCACCTGG 240 tttgtggagc gtggctataa aataaaaggc agcatttcct ctcattttca tagcgacagc 300 acgggcggaa tagagtggct taattctcga tctatcccca cgtatgcatc tgaattaaca 360 aatgaactgc ttaaaaaaga cggtaaggtt caagccacaa attcatttag cggagttaac 420 tattggctag ttaaaaataa aattgaagtt ttttatccag gcccgggaca cactccagat 480 aacgtagtgg tttggttgcc tgaaaggaaa atattattcg gtggttgttt tattaaaccg 540 tacggtttag gcaatttggg tgacgcaaat atagaagctt ggccaaagtc cgccaaatta 600 ttaaagtcca aatatggtaa ggcaaaactg gttgttccag gtcacagtga agttggagac 660 gcatcactct tgaaacttac attagagcag gcggttaaag ggttaaacga aagtaaaaaa 720 ccatcaaaac caagcaacta a 741 <210> 17 <211> 801 <212> DNA <213> Artificial Sequence <220> <223> Synthetic VIM <400> 17 atgttcaaac ttttgagtaa gttattggtc tatttgaccg cgtctatcat ggctattgcg 60 AGTCCGCTCG CTTTTTCCGT AGATTCTAGC GGTGAGTATC CGACAGTCAG CGAAATTCCG 120 GTCGGGGAGG TCCGGCTTT A CCAGATTGCC GATGGTGT TT GGT CGCATATC GCAACGCAG 180 TCGT TTGATGGC GCAGTCTAC CC GTCC AATGGTCTCATT GTCCGTGATG GTGATGAGTTG 240 CTTTTGATGA TACAGCGTGG GGTGCGAAAA ACACAGCGGC ACTTCTCGCG GAGATTGAG 300 AAGCAAATTG GACTTCCTGT AACGC GTGCAGTCTCCACGC ACTTTCATGA CGACC GC GT C 360 GGCGGCGTTG ATGTCCTTCG GGC GGCTGGGGT GGCAACGTAC G CATC ACCGT CGACACGC 420 C GGCTAGCCG AGG TAGAGGGGA ACGAGATTC C CACGC ACTCTCTAGAAGG ACTCTCATCG 480 AGCGGGGACG CAGTGC GCTTC GGTCCAGTAG ACTCTTCTAT CCTGGTGCTGC GCATTCG 540 ACC GACAAC TTAGTTGTGT AC GTCCC GTCT GCGAGTGTGC TCTATGGTGG TTGTGCGATT 600 TATGAGTTGT CACGCACGTC TGC GGGGAACGT GGC CGATGCCG ATCTGGCTGAA TGGCCC 660 ACCTCCATTG AGCGGATTC AAC AACACTACC CGGAAGCAC AGTTC GTCAT TCCGGGGCAC 720 GGCCTGCCGG GCGGTCTAGAC TTGCTCAAGC ACACAACGAA TGTGTA AAAGCGCACACA 780 aatcgctcag tcgttgagta g 801 <210> 18 <211> 864 <212> DNA <213> Artificial Sequence <220> <223> Synthetic GES <400> 18 atgcgcttca ttcacgcact attactggca gggatcgctc actctgcata tgcgtcggaa 60 aaattaacct tcaagaccga tcttgagaag ctagagcgcg aaaaagcagc tcagatcggt 120 gttgcgatcg tcgatcccca aggagagatc gtcgcgggcc accgaatggc gcagcgtttt 180 gcaatgtgct caacgttcaa gtttccgcta gccgcgctgg tctttgaaag aattgactca 240 ggcaccgagc ggggggatcg aaaactttca tatgggccgg acatgatcgt cgaatggtct 300 cctgccacgg agcggtttct agcatcggga cacatgacgg ttctcgaggc agcgcaagct 360 gcggtgcagc ttagcgacaa tggggctact aacctcttac tgagagaaat tggcggacct 420 gctgcaatga cgcagtattt tcgtaaaatt ggcgactctg tgagtcggct agaccggaaa 480 gagccggaga tgagcgacaa cacacctggc gacctcagag atacaactac gcctattgct 540 atggcacgta ctgtggctaa agtcctctat ggcggcgcac tgacgtccac ctcgacccac 600 accattgaga ggtggctgat cggaaaccaa acgggagacg cgacactacg agcgggtttt 660 cctaaagatt gggttgttgg agagaaaact ggtacctgcg ccaacggggg ccggaacgac 720 attggttttt ttaaagccca ggagagagat tacgctgtag cggtgtatac aacggccccg 780 aaactatcgg ccgtagaacg tgacgaatta gttgcctctg tcggtcaagt tattacacaa 840 ctcatcctga gcacggacaa atag 864

Claims

1. A method for detecting carbapenem-resistant pathogenic strains in biological samples, comprising the following steps: (a) Isolating proteins expressed by pathogenic strains from biological samples isolated from subjects; and (b) Perform top-down mass spectrometry analysis on the isolated proteins; Among them, when mass spectrometry analysis detects a protein with the same mass as a Klebsiella pneumoniae carbapenemase (KPC) with 21 amino acid residues removed from its N-terminus, a New Delhi metallo-β-lactamase (NDM) with 19 amino acid residues removed from its N-terminus, or a metallo-β-lactamase (VIM) encoded by a Verona integrin with 26 amino acid residues removed from its N-terminus, it is considered that there is a carbapenem-resistant pathogenic strain in the biological sample. Wherein, the KPC is selected from the group consisting of KPC-2, KPC-3, KPC-5, KPC-6, KPC-7, KPC-8, KPC-10, KPC-11, KPC-12, KPC-13, KPC-14, KPC-15, KPC-16 and KPC-17; The NDM is selected from the following group: NDM-1, NDM-2 and NDM-3; The VIM is selected from the following group: VIM-1, VIM-2, VIM-4, VIM-5, VIM-6, VIM-8, VIM-9, VIM-10, VIM-11, VIM-12, VIM-13, VIM-14, VIM-15, VIM-16, VIM-17, VIM-18, VIM-1 9. VIM-20, VIM-23, VIM-24, VIM-25, VIM-26, VIM-27, VIM-28, VIM-29, VIM-30, VIM-31, VIM-32, VIM-33, VIM-34, VIM-35, VIM-36, VIM-37 and VIM-38.

2. The method according to claim 1, wherein, The method further includes ion exchange chromatography of the proteins isolated in step (a).

3. The method according to claim 2, wherein, The ion exchange chromatography is selected from any one of the following groups: anion exchange chromatography, cation exchange chromatography, and combinations thereof.

4. The method of claim 1, wherein step (a) is performed by adding a surfactant to the biological sample.

5. The method of claim 4, wherein step (a) is performed by additionally adding lysis buffer to the biological sample.

6. The method according to claim 4, further comprising an ultrasonic treatment step between steps (a) and (b).

7. The method according to claim 1, characterized in that, in, Step (b) is performed using mass spectrometry selected from the group consisting of: matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) mass spectrometry, surface-enhanced laser desorption / ionization time-of-flight (SELDI-TOF) mass spectrometry, electrospray ionization time-of-flight (ESI-TOF) mass spectrometry, liquid chromatography-mass spectrometry (LC-MS), and liquid chromatography-mass spectrometry / mass spectrometry (LC-MS / MS).

8. The method according to claim 7, wherein, Step (b) is performed using matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) mass spectrometry.

9. The method according to claim 1, wherein, If the mass spectrometry analysis results in the detection of one or more mass values ​​(m / z×z) selected from the following group: 28720, 28746, 28780, 28678, 28728, 28704, 28806, 28736, 28738, 28688, 28562, 28877, 28676, and 28686, then the biological sample is considered to contain a carbapenem-resistant pathogenic strain, and the carbapenem-resistant pathogenic strain is a strain that produces KPC protein.

10. The method according to claim 1, wherein, If the mass spectrometry analysis results in the detection of one or more mass values ​​(m / z×z) selected from the following group: 26510, 26484 and 26509, then the biological sample is considered to contain a pathogenic strain resistant to carbapenem antibiotics, and the pathogenic strain resistant to carbapenem antibiotics is a strain that produces NDM protein.

11. The method according to claim 1, wherein, When the mass spectrometry analysis results in the detection of one or more mass values ​​(m / z×z) selected from the following group: 25322, 25515, 25488, 25391, 25339, 25516, 25485, 25527, 25531, 25414, 25455, 25421, 25499, 25542, 25129, 25405, 25534, 25446 If the following are identified in the biological samples: 25472, 25444, 25298, 25338, 25367, 25355, 25508, 25264, 25306, 25336, 25352, 25543, and 25407, then it is considered that there are carbapenem-resistant pathogenic strains in the biological samples, and the carbapenem-resistant pathogenic strains are strains that produce VIM protein.

Images