A rhabdovirus inactivated vaccine for sparus ocellatus and a preparation method thereof
By preparing the SD strain of iris virus for spotted sea bream and mixing it with adjuvants, a safe and effective inactivated vaccine was prepared, which solved the problem of frequent outbreaks of iris virus in spotted sea bream, reduced the mortality rate of spotted sea bream, and achieved effective control of the virus.
Patent Information
- Application Number
- CN202210750561.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-06-29
- Publication Date
- 2026-01-02
- Estimated Expiration
- 2042-06-29
AI Technical Summary
Currently, there is no effective inactivated vaccine for spotted sea bream iridovirus. Existing inactivated vaccine preparation methods are not applicable to spotted sea bream iridovirus, leading to frequent outbreaks of spotted sea bream iridovirus and causing serious economic losses.
By using the isolated SD strain of spotted sea bream iridovirus in combination with adjuvants such as white oil, aluminum hydroxide gel, or ISA 201VG, an inactivated vaccine with good immunoprotective effect of spotted sea bream iridovirus was prepared. Different types of inactivated vaccines were prepared by inactivating the virus with formaldehyde and mixing it with adjuvants.
It effectively reduces the mortality rate of spotted sea bream iridovirus infection, provides a highly safe and effective inactivated vaccine, fills the gap in inactivated vaccines for spotted sea bream iridovirus, and helps control the disease.
Smart Images

Figure CN115105589B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of inactivated vaccine. More particularly, it relates to a Spotted Knifejaw Iridovirus inactivated vaccine and a preparation method thereof. BACKGROUND
[0002] Spotted Knifejaw (Oplegnathus punctatus), also known as Spotted parrotfish, Flower Drum or Black Drum, is one of the new varieties of valuable marine fish in China, and has very high economic benefits. With the continuous expansion of the scale of aquaculture, the occurrence of Spotted Knifejaw diseases is becoming more and more frequent and serious, which has a serious impact on the development of Spotted Knifejaw aquaculture industry and has caused huge economic losses.
[0003] Iridovirus is a large icosahedral, cytoplasmic DNA virus, mainly infecting invertebrates and lower vertebrates. Iridoviridae is divided into five virus genera, namely Iridovirus, Chloriridovirus, Ranavirus, Lymphocystivirus and Megalocytivirus. Among them, the cell swelling iridovirus disease caused by Megalocytivirus is one of the most important viral diseases that cause fish death, and can infect a variety of marine or freshwater fish. Spotted Knifejaw Iridovirus (SKIV) belongs to Megalocytivirus, which can cause diseases and mass death of marine fish such as Spotted Knifejaw, and has great harm.
[0004] Vaccine is an effective means to prevent and control iridovirus. For example, Chinese patent CN102178945A discloses a Grouper Iridovirus inactivated vaccine, which can effectively improve the survival rate of farmed Grouper after being attacked by Grouper Iridovirus (SGIV). In addition to the Grouper Iridovirus inactivated vaccine, there are also reports on the Largemouth Bass Frog Iridovirus (LMBV) inactivated vaccine and the Turbot Red Body Disease Iridovirus inactivated vaccine in the prior art. However, for the prevention and control of Spotted Knifejaw Iridovirus (SKIV), there is currently no effective inactivated vaccine, and the preparation of inactivated vaccine cannot simply replace the antigen according to the preparation method of existing iridovirus inactivated vaccine. The immune protection effect of inactivated vaccines prepared by using different virus strains, different inactivation methods and different adjuvants is different, and there is no unified preparation scheme. Therefore, it is of great significance to develop a safe and effective Spotted Knifejaw Iridovirus vaccine and a preparation method thereof for the prevention and control of Spotted Knifejaw Iridovirus. SUMMARY
[0005] The technical problem solved by the present application is to overcome the defects and deficiencies of the prior art and provide a Sparus Ocyphelus Iridovirus inactivated vaccine and a preparation method thereof.
[0006] A first object of the present application is to provide a Sparus Ocyphelus Iridovirus inactivated vaccine.
[0007] A second object of the present application is to provide a preparation method of the Sparus Ocyphelus Iridovirus inactivated vaccine.
[0008] A third object of the present application is to provide an application of the Sparus Ocyphelus Iridovirus inactivated vaccine in preventing and treating diseases caused by Sparus Ocyphelus Iridovirus.
[0009] The above objects of the present application are achieved by the following technical solutions.
[0010] The present application uses the isolated Sparus Ocyphelus Iridovirus SD strain to prepare an inactivated vaccine with good immunoprotective effect by compounding with white oil and other adjuvants, and the inactivated vaccine can effectively reduce the mortality of cultured Sparus Ocyphelus after infection with Sparus Ocyphelus Iridovirus. Therefore, the present application protects a Sparus Ocyphelus Iridovirus inactivated vaccine, which comprises inactivated Sparus Ocyphelus Iridovirus SD strain virus liquid and adjuvants.
[0011] Specifically, the adjuvant is a white oil adjuvant, an aluminum hydroxide gel adjuvant or an ISA 201VG adjuvant.
[0012] The present application also provides a preparation method of the Sparus Ocyphelus Iridovirus inactivated vaccine, comprising the following steps:
[0013] S1. preparing Sparus Ocyphelus Iridovirus SD strain virus liquid;
[0014] S2. inactivating the virus liquid obtained in step S1 and performing inactivation test;
[0015] S3. mixing the inactivated virus liquid that passes the inactivation test with adjuvants to prepare an inactivated vaccine.
[0016] The specific steps of the preparation method of the Sparus Ocyphelus Iridovirus inactivated vaccine are as follows:
[0017] S1. inoculating Sparus Ocyphelus Iridovirus SD strain into Sparus Ocyphelus brain cells, repeatedly freezing and thawing under the condition of-20℃ when the cytopathic rate is higher than 90%, harvesting virus liquid, and storing at 4℃ for standby;
[0018] S2. inactivating the virus liquid obtained in step S1 with formaldehyde and performing inactivation test;
[0019] S3. The inactivated virus liquid that passed the inactivation test is mixed with Tween-80 to prepare the water phase, white oil is mixed with Tween-80 and boiled to prepare the oil phase, the water phase and the oil phase are mixed, and emulsified at 10,000-12,000 rpm for 5-10 minutes to prepare a water-in-oil inactivated vaccine; or the inactivated virus liquid that passed the inactivation test is mixed with aluminum hydroxide gel, stirred at 200-1,000 rpm for 5-10 minutes to prepare an aluminum hydroxide gel inactivated vaccine; or the inactivated virus liquid that passed the inactivation test is mixed with ISA 201 VG, stirred at 200-500 rpm for 5-10 minutes to prepare a water-in-oil-in-water inactivated vaccine.
[0020] Specifically, when the brain cells of O. lactatus grow well into a single layer, step S1 is performed to replace the cells with Leibovitz’s L-15 culture solution containing 2% fetal bovine serum, and then the SD strain of O. lactatus iridovirus is inoculated into the brain cells of O. lactatus at a ratio of 1:1,000 by volume.
[0021] Specifically, the freezing and thawing is repeated at least 3 times under the condition of -20°C.
[0022] Specifically, the formaldehyde inactivation method of step S2 is as follows: formaldehyde solution is added to the virus liquid of the SD strain of O. lactatus iridovirus prepared in step S1, and shaken, and then inactivated at 4°C for more than 96 hours; the volume ratio of the virus liquid to the formaldehyde solution is 1,000:1.
[0023] Specifically, the inactivation test method is as follows: the inactivated virus liquid is diluted by 10 times, inoculated into a single layer of brain cells (SKB cells) (25 cm 2 bottles), 1 mL per bottle, adsorbed in a 26°C incubator for 1 hour, and then discarded, 10 mL of Leibovitz’s L-15 maintenance solution (containing 2% fetal bovine serum) is added to each bottle, and 1 bottle of cells without inoculation is set as a blank control, and then placed in a 26°C incubator for 5 days, and observed daily to see whether cell pathological effect (CPE) is produced; if no CPE is produced, the cell freezing liquid of the previous generation is inoculated into the next generation of cell bottles, the inoculation liquid is not discarded and the culture is continued, and the process is repeated, and the cell culture liquid is blind-transmitted for 2 generations, and whether CPE is produced is observed; if the inactivation is complete, no CPE should be produced during the transmission.
[0024] Specifically, the virus content in the inactivated virus liquid in step S3 is 10 6.0 -10 7.0 TCID 50 / mL.
[0025] If the virus content in the inactivated virus liquid that passed the inactivation test is higher than the required concentration, the inactivated virus liquid can be diluted with physiological saline.
[0026] Specifically, when the adjuvant used is white oil, the volume ratio of the inactivated virus liquid to Tween-80 is 96:4, the volume-mass ratio of white oil to Span-80 is 96:4, and the volume ratio of the water phase to the oil phase is 1:2.
[0027] Specifically, when the adjuvant used is aluminum hydroxide gel, the volume-mass ratio of the inactivated virus liquid to aluminum hydroxide gel is 4:1.
[0028] Specifically, when the adjuvant used is ISA 201 VG, the mass ratio of the inactivated virus liquid to ISA 201 VG is 1:1.
[0029] The application also protects the use of the inactivated vaccine in preventing and treating the O. latus iridovirus disease caused by the O. latus iridovirus or in preparing a product for preventing and treating the O. latus iridovirus disease.
[0030] The application has the following beneficial effects:
[0031] The application provides an O. latus iridovirus inactivated vaccine and a preparation method thereof. The O. latus iridovirus inactivated vaccine with high safety and good immunoprotective effect is prepared by using the O. latus iridovirus SD strain virus liquid, and the inactivated vaccine can effectively reduce the mortality of the cultured O. latus after O. latus iridovirus infection, and can be used for preventing and treating the O. latus iridovirus disease, filling the blank of the O. latus iridovirus inactivated vaccine at present, and being helpful for the prevention and control of the O. latus iridovirus. BRIEF DESCRIPTION OF DRAWINGS
[0032] Figure 1 Fig. 1 is the cytopathic effect of the O. latus iridovirus SD strain inoculated on SKB cells, wherein the left graph is the virus-inoculated cells, and the right graph is the normal cell control.
[0033] Figure 2 Fig. 2 is the specificity identification result of the O. latus iridovirus SD strain, wherein M is DL2000 DNAMarker, 1 is the O. latus iridovirus SD strain, and 2 is a negative control. DETAILED DESCRIPTION
[0034] The application will be further described below in combination with the drawings and specific examples, but the examples do not limit the application in any form. Unless otherwise specified, the reagents, methods and devices used in the application are conventional reagents, methods and devices in the technical field.
[0035] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.
[0036] Example 1 Preparation of O. latus iridovirus SD strain virus liquid
[0037] The SD strain of the spotted knifejaw iris virus described in this invention was isolated and identified by the inventors of this invention ("Isolation, identification and genomic analysis of an ISKNV-type megalocytivirus from spotted knifejaw (Oplegnathus punctatus)." Aquaculture 532(2021):736032.). This strain is currently preserved in the Aquatic Animal Medicine Laboratory of the College of Marine Sciences, South China Agricultural University.
[0038] 1. Experimental Methods
[0039] (1) Virus reproduction
[0040] When the brain cells (SKB cells) of the spotted sea bream have grown into a good monolayer, they are replaced with Leibovitz's L-15 culture medium containing 2% fetal bovine serum. Then, the SD strain of spotted sea bream iridovirus is inoculated into the brain cells at a ratio of 1:1000 (v / v). When the cytopathic rate is higher than 90%, the cells are repeatedly frozen and thawed at -20°C at least 3 times. The virus solution is harvested and the virus content in the obtained virus solution is determined. The virus solution name, harvest date, virus passage number and other information are noted. The virus solution is stored at 4°C for later use.
[0041] (2) Virus content (TCID) 50 ) Measurement
[0042] Add 100 μL of spotted sea bream brain cell suspension to 96-well microculture plates (cell density approximately 4 × 10⁶ cells / well). 5.0 (cells / mL), incubated at 26℃ for 24 hours to allow cells to form a monolayer; take the SD strain of spotted sea bream iris virus obtained in (1), and perform a 10-fold serial dilution with serum-free Leibovitz's L-15 medium, and take 10 -3 ~10 -9 Seven dilutions of the SD virus strain were inoculated into 96-well microplates of monolayer cells at 100 μL / well, with six wells for each dilution. Six wells of normal cells were also included as controls. Leibovitz's L-15 medium containing 4% fetal bovine serum was added to each well at 100 μL / well, and the plates were cultured for 7 days. Cytopathic effects were observed, and TCID was calculated using the Reed-Muench method. 50 .
[0043] (3) Specificity identification
[0044] Specific PCR identification of the SD strain of spotted sea bream iridovirus was performed using specific primers for the main capsid protein (MCP) gene of spotted sea bream iridovirus. The nucleotide sequences of the primers are shown below:
[0045] Upstream primer: ATGTCTGCAATCTCAGGTGCGAACG
[0046] Downstream primer: TTACAGGATAGGGAAGCCTGCAGCG
[0047] The specific method is as follows: DNA is extracted from cell culture medium samples. Commercially available DNA extraction kits can be used for DNA extraction; the specific extraction steps are as per the kit's instructions. The PCR reaction system consists of 12.5 μL of PCR premix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and double-distilled water to a final volume of 25 μL. The reaction program is as follows: 94℃ pre-denaturation for 3 minutes; 94℃ denaturation for 30 seconds, 50℃ annealing for 30 seconds, 72℃ extension for 90 seconds, for a total of 30 cycles; 72℃ extension for 7 minutes; the amplified products are observed under UV light after 1% agarose gel electrophoresis; the amplified products are recovered and sent for sequencing.
[0048] 2. Experimental Results
[0049] After inoculating spotted sea bream iridovirus SD strain into spotted sea bream brain cells (SKB cells), the cytopathic effects were as follows: Figure 1 As shown, the left image represents cells inoculated with the virus, and the right image represents normal cells as a control. Figure 1 The results show that after SKB cells were infected with the spotted sea bream iridovirus SD strain, they became shrunken and detached, exhibiting typical cytopathic effects. Furthermore, the viral load of the spotted sea bream iridovirus SD strain F3 obtained in this embodiment was determined to be 10. 7.0 TCID 50 / mL.
[0050] Specific PCR identification results of the spotted sea bream iridovirus SD strain are as follows: Figure 2 As shown in the figure, M is the DL2000 DNA Marker, 1 is the SD strain of spotted rock seabream iris virus, and 2 is the negative control. Figure 2 It can be seen that the specific PCR detection result of the primary capsid protein (MCP) gene of the SD strain of spotted sea bream iris virus prepared by the present invention is positive, and a specific band is amplified; the recovery and sequencing results of the amplified fragment show that the amplified sequence is the full-length CDs region of the spotted sea bream iris virus MCP gene, which is 1362 bp in length, and is consistent with the GenBank sequence AF371960.1 after comparison; the above results indicate that the present invention has successfully obtained spotted sea bream iris virus.
[0051] Example 2 Inactivation of virus liquid of O. latus iridovirus SD strain
[0052] The present application has previously tried different virus inactivation methods, and found that the effect of inactivation by formaldehyde is better. On this basis, the formaldehyde inactivation concentration and inactivation time are further optimized.
[0053] 1. Formaldehyde inactivation
[0054] The virus liquid of O. latus iridovirus SD strain prepared in Example 1 was divided into 4 equal parts, 2 parts were added with 0.1% (v / v) formaldehyde, and the other 2 parts were added with 0.2% (v / v) formaldehyde, and shaken, and then placed at 4°C and 26°C for inactivation; at 24 hours after inactivation, samples were taken every 24 hours for inactivation test; the sample of 4°C inactivation was taken to 168 hours, and the sample of 26°C inactivation was taken to 96 hours.
[0055] 2. Inactivation test
[0056] After the inactivated virus liquid was diluted by 10 times, SKB monolayer cells (25 cm 2 bottle) were inoculated with 1 mL per bottle, and then placed in a 26°C incubator for adsorption for 1 hour, and then discarded, 10 mL of Leibovitz's L-15 culture solution (containing 2% fetal bovine serum) was added to each bottle, and 1 bottle of cells without inoculation was set as a blank control, and then placed in a 26°C incubator for culture for 5 days, and then observed daily whether CPE was produced; if no CPE was produced, the cell freeze-thaw liquid of the previous generation was inoculated into the next generation of cell bottles, and the inoculation liquid was not discarded for continuous culture, and this was repeated, and the cell culture liquid was blind passed for 2 generations, and whether CPE was produced was observed; if no CPE was produced during the passage of the inactivated virus liquid, the inactivation was complete.
[0057] The inactivation test results show that the use of 0.1% (v / v) formaldehyde solution for inactivation at 4°C for more than 96 hours can completely inactivate the virus liquid.
[0058] 3. Safety test
[0059] The inactivated vaccine was prepared by mixing the virus liquid that passed the formaldehyde inactivation test with white oil adjuvant, and the safety of the inactivated vaccine was tested by one-time super-dose inoculation immunization of 8-15 g O. latus.
[0060] (1) Experimental method: 100 healthy O. latus with a weight of 8-15 g were divided into 2 groups, 50 in each group, one group was an immunization group, and one group was a control group, and injection was performed after stopping feeding for 24 hours; the immunization group was injected intraperitoneally with the prepared inactivated vaccine, 0.2 mL per fish; the control group was injected intraperitoneally with normal saline, 0.2 mL per fish; the water temperature was 28-30°C, and the fish were bred in a circulating water tank, and observed continuously for 14 days, and the clinical manifestations of the fish were recorded.
[0061] (2) Experimental results
[0062] The inactivated vaccine of the application was inoculated to 8-15 g of O. mossambicus once with an overdose, and no adverse reaction was observed, indicating that the vaccine has good safety.
[0063] Example 3 Preparation of inactivated vaccine of O. mossambicus iridovirus
[0064] Based on the virus liquid of O. mossambicus iridovirus SD strain and the inactivation method of the virus liquid described in Example 2, different inactivated vaccines of O. mossambicus iridovirus were prepared using different adjuvants. The preparation method of the vaccine comprises the following steps:
[0065] S1. Preparation of virus liquid of O. mossambicus iridovirus SD strain
[0066] This step is the same as Example 1; when the brain cells of O. mossambicus grow well into a monolayer, they are replaced with Leibovitz's L-15 culture solution containing 2% fetal bovine serum, and then the O. mossambicus iridovirus SD strain is inoculated into the brain cells of O. mossambicus at a ratio of 1:1000 by volume. When the cytopathic rate is higher than 90%, the virus liquid is harvested by repeated freezing and thawing 3 times at -20℃, and stored at 4℃ for standby;
[0067] S2. Formaldehyde inactivation of the virus liquid obtained in step S1 and inactivation test
[0068] Formaldehyde solution with a final concentration of 0.1% (v / v) is added to the prepared virus liquid of O. mossambicus iridovirus SD strain, shaken and inactivated at 4℃ for more than 96 hours;
[0069] Inactivation test: take the inactivated virus liquid, dilute it 10 times, inoculate SKB monolayer cells (25 cm 2 bottle), inoculate 3 bottles, 1 mL / bottle, shake and absorb for 1 hour in a 26℃ incubator, then discard, add 10 mL of Leibovitz's L-15 maintenance solution (containing 2% fetal bovine serum) to each bottle, set up one bottle of un-inoculated cells as a blank control, and place them in a 26℃ incubator for 5 days, and observe daily whether there is cytopathic effect (CPE). If no CPE is produced, the cell freeze-thaw liquid of the previous generation is inoculated into the next generation of cell bottles, the inoculation liquid is not discarded and is continued to be cultured, and this process is repeated, and the cell culture liquid is observed for 2 generations of blind passage to observe whether there is CPE. The virus liquid that is inactivated completely should have no CPE during the passage.
[0070] S3. Mixing the inactivated virus liquid that passes the inactivation test with an adjuvant to prepare an inactivated vaccine
[0071] The inactivated virus liquid of the O. marmoratus iridovirus SD strain that passed the inactivation test was adjusted to a certain concentration with sterile normal saline, mixed with different adjuvants to prepare inactivated vaccines, so that the content of inactivated virus before inactivation in each milliliter of inactivated vaccine was 0.32 x 10 7.0 TCID 50 .
[0072] White oil adjuvant vaccine:
[0073] a. Preparation of the water phase: the inactivated virus liquid and Tween-80 were mixed at 96:4 (v / v) to prepare the water phase;
[0074] b. Preparation of the oil phase (white oil adjuvant): the white oil and Span-80 were mixed at 96:4 (v / w) and boiled to prepare the oil phase;
[0075] c. One volume of the water phase was slowly poured into two volumes of the oil phase, and emulsified at 10,000 rpm for 5 minutes to prepare the water-in-oil type inactivated vaccine.
[0076] Aluminum hydroxide gel vaccine:
[0077] The inactivated virus liquid and aluminum hydroxide gel were mixed at 80:20 (v / w) and stirred at 1,000 rpm for 5 min to prepare the aluminum hydroxide gel vaccine.
[0078] Montanide GEL 02 vaccine:
[0079] The inactivated virus liquid and GEL 02 were mixed at 50:50 (w / w) and stirred at 1,000 rpm for 5 min to prepare the water-soluble vaccine.
[0080] Montanide IMS 1313 VG vaccine:
[0081] The inactivated virus liquid and IMS 1313 VG were mixed at 50:50 (w / w) and stirred at 1,000 rpm for 5 min to prepare the microemulsion type vaccine.
[0082] Montanide ISA 201 VG vaccine:
[0083] The inactivated virus liquid and ISA 201 VG were mixed at 50:50 (w / w) and stirred at 300 rpm for 5 min to prepare the water-in-oil-in-water type vaccine.
[0084] 2. Detection of immune protection effect
[0085] (1) Experimental method: 360 healthy O. striata fry of 8-15 g per tail were divided into 6 groups, 60 tails per group, 5 groups as immunization groups and 1 group as control group. After stopping feeding for 24 hours, injection was performed; the immunization groups were injected with inactivated vaccines prepared with different adjuvants through abdominal cavity, 0.1 mL per tail; the control group was injected with normal saline through abdominal cavity, 0.1 mL per tail; the water temperature was 28-30℃, and the water was circulated and divided into groups for feeding;
[0086] After 21 days of immunization, 50 tails of the aluminum hydroxide gel vaccine immunization group were subjected to challenge, and the remaining four groups were subjected to challenge after 28 days of immunization; 0.1 mL of virus liquid of O. striata iridovirus SD strain with a virus content of 10 4.0 TCID 50 / mL was injected through abdominal cavity, that is, the challenge dose was 10 3.0 TCID 50 / tail, and the control group was treated in the same way; after challenge, 14 days of continuous observation was performed, the death of each group was recorded, the mortality was calculated by specific death number, and finally the immune protection rate was calculated.
[0087]
[0088] (2) Experimental results
[0089] During the immunization feeding process, except that 2 tails died in the micellar emulsion vaccine group on the second day after immunization, the others had no death, and there was no adverse reaction, indicating that the safety test of the 5 vaccines was good. The immune protection effect detection results are shown in Table 1. As shown in Table 1, the protection rate of the white oil vaccine was the highest, which was 91.84%, the aluminum hydroxide gel vaccine, the ISA 201 water-in-oil-in-water vaccine and the GEL 02 water-soluble vaccine also had good immune protection effect, and the IMS 1313 micellar emulsion vaccine had no immune protection effect.
[0090] Table 1
[0091] Group Number of challenge after immunization Mortality rate Immune protection rate White oil vaccine 50 tails 8% 91.84% Aluminum hydroxide gel vaccine 50 tails 30% 69.39% ISA 201 water-in-oil-in-water vaccine 50 tails 36% 63.27% GEL 02 water-soluble vaccine 50 tails 52% 46.94% IMS 1313 micron emulsion vaccine 50 tails 94% 4.08% Control group 50 tails 98% -
[0092] Example 4 Optimization of antigen content of O. striata iridovirus inactivated vaccine
[0093] 1. Experimental method
[0094] The inactivated virus liquid that passed the inactivation test was diluted with normal saline to contain inactivated virus content of 10 7.0 TCID 50 / mL, 10 6.0 TCID 50 / mL, 10 5.0 TCID 50 / mL and 10 4.0 TCID 50 / mL, and the four groups of diluted inactivated virus liquid were prepared into four groups of vaccines according to the vaccine preparation method in Example 3.
[0095] Take 8-15 g / tail healthy O. niloticus 300 tails, divide them into 5 groups, 60 tails in each group, 4 groups are immune groups, and 1 group is a control group, stop feeding for 24 hours, and then inject; the immune groups are injected with the above-mentioned four groups of vaccines, 0.1 mL / tail; the control group is injected with physiological saline, 0.1 mL / tail; and the water temperature is 28-30℃, and the water is fed in a circulating water tank.
[0096] After 28 days of immunization, 50 O. niloticus tails are taken from the immune group and the control group respectively for challenge, and 0.1 mL of virus liquid of O. niloticus iridovirus SD strain with a virus content of 10 4.0 TCID 50 / mL is injected through the abdominal cavity. Continuous observation is carried out for 14 days, the death of each group is recorded, the mortality is calculated by specific death number, and the immune protection rate formula is as follows:
[0097]
[0098] 2, Experimental results
[0099] The results are shown in Table 2. In order to ensure the stability of the vaccine efficacy and obtain stronger protection, it is determined that the lowest antigen content is 1×10 6.0 TCID 50 / mL, and the four groups of diluted inactivated virus liquid were prepared into four groups of vaccines according to the vaccine preparation method in Example 3. 6.0 TCID 50 .
[0100] Table 2
[0101]
[0102] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the above examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application should be equivalent replacement methods, and are all included in the protection scope of the present application.
Claims
1. An inactivated vaccine of a gynogenetic strain of a gynochromis osphromenus iridovirus, characterized in that, The preparation method of the vaccine comprises the following steps: S1. The Oplegnathus fasciatus iridovirus SD strain is inoculated into Oplegnathus fasciatus brain cells, and when the cytopathic rate is higher than 90%, the virus liquid is harvested by repeated freezing and thawing under the condition of-20 DEG C and is stored at 4 DEG C for standby; S2. The virus liquid obtained in step S1 is inactivated by formaldehyde, and inactivation test is performed; S3. The inactivated virus liquid which passes the inactivation test is mixed with Tween-80 to prepare an aqueous phase, white oil is mixed with Span-80 and boiled to prepare an oil phase, the aqueous phase and the oil phase are mixed, and emulsified at 10000-12000 rpm for 5-10 minutes to prepare a water-in-oil type inactivated vaccine; the virus content in the inactivated virus liquid is 10 6.0 -10 7.0 TCID 50 / mL; the volume ratio of the inactivated virus liquid to Tween-80 is 96:4, the volume-mass ratio of white oil to Span-80 is 96:4, and the volume ratio of the aqueous phase to the oil phase is 1:
2.
2. The inactivated vaccine according to claim 1, characterized in that, The formaldehyde inactivation method in S2 is that formaldehyde solution is added into the virus liquid of the Oplegnathus fasciatus iridovirus SD strain prepared in step S1, and is shaken, inactivated at 4 DEG C for more than 96 hours; the volume ratio of the virus liquid to the formaldehyde solution is 1000:
1.
3. The application of the inactivated vaccine in claim 1 or 2 in the preparation of a product for preventing and treating Oplegnathus fasciatus iridovirus disease.
Citation Information
Patent Citations
Preparation method of inactivated vaccine for iridovirus of grouper
CN102178945A
Vaccine formulation and method for preventing ylide virus infection of fish
JP2019119732A