High-throughput sequencing detection method for hypoxanthine in RNA

Abstract

The present invention provides a high-throughput sequencing detection method for hypoxanthine in RNA, comprising the following steps: Step 1): treating the RNA sample with a sodium periodate solution; Step 2): subjecting the RNA sample treated in Step 1) to an enzymatic digestion reaction with Endonuclease V; Step 3): separately constructing libraries for the RNA sample treated in Step 1) and the RNA sample after the enzymatic digestion reaction in Step 2); Step 4): sequencing the two groups of libraries obtained in Step 3), comparing the sequencing results of the two groups, determining the enriched reads, and tracing the enzymatic digestion sites of the enriched reads to find the mutated sites, i.e., finding the hypoxanthine modification sites. It has high specificity, high sensitivity, and is easy to operate.

Description

Technical Field

[0001] The patent of this invention relates to the field of nucleic acid chemical biology, and in particular to a high-throughput sequencing detection method for hypoxanthine in RNA. Background Art

[0002] Genes are the primary genetic material, and their sequences contain all the information necessary for processes such as growth, aging, and apoptosis. Epigenetics studies how changes in non-genetic sequences, such as nucleic acid methylation, RNA modification, and chromatin conformation, lead to changes in gene expression. The importance of epigenetics is gradually being recognized. Currently, over 170 chemical modifications have been identified in protein-coding regions and non-coding RNAs. These modifications have a significant impact on the normal growth and development of organisms, and these modifications must be correctly targeted. Abnormal RNA modifications can lead to dysregulated gene expression and even tumorigenesis.

[0003] RNA editing is a common RNA modification with multiple functions, including amino acid changes, alternative splicing, RNA interference (RNAi), and microRNA mutation-mediated translation inhibition. Adenosine-to-inosine modification is a common type of RNA editing found in metazoans from worms to humans. It is catalyzed by RNA-acting adenosine deaminases (ADARs), which hydrolyze adenosine to inosine in double-stranded regions of RNA. The activity of ADARs is required for normal development of vertebrates and normal behavior of invertebrates. In addition, RNA editing from A to I may be associated with a variety of neurological diseases. In the coding regions, introns, and untranslated regions of mRNAs in the human transcriptome, many A-to-I editing sites have been identified or predicted from a bioinformatics perspective. Within the untranslated regions, most A-to-I editing sites are located in Alu repeat elements, which are good substrates for ADARs.

[0004] Creating an accurate A-to-I RNA editing map is crucial for understanding the biological function of I and using it as a signal for disease diagnosis. Existing I detection methods include bioinformatics and computational statistics, as well as chemical methods such as ICE-seq, but these methods all have shortcomings.

[0005] Therefore, it is necessary to develop a highly specific and sensitive method for detecting I in RNA. Summary of the Invention

[0006] The present invention aims to solve at least one of the technical problems existing in the prior art to a certain extent. To this end, the present invention provides a high-throughput sequencing method for detecting hypoxanthine in RNA, comprising the following steps:

[0007] Step 1): Treat the RNA sample with sodium periodate solution;

[0008] Step 2): The RNA sample treated in step 1) is subjected to an enzyme digestion reaction using Endonuclease V;

[0009] Step 3): constructing libraries for the RNA sample treated in step 1) and the RNA sample digested in step 2);

[0010] Step 4): Sequence the two sets of libraries obtained in step 3), compare the two sets of sequencing results, determine the enriched fragments, and trace back the enzyme cutting sites of the enriched fragments to find the mutated site, that is, find the hypoxanthine modification site.

[0011] According to the technical solution of the present invention, in step 1), the concentration of the sodium periodate solution is 10 mM.

[0012] According to the technical solution of the present invention, in step 1), the RNA sample is treated with a sodium periodate solution, specifically: the RNA sample is reacted with a 10 mM sodium periodate solution at 0° C. in the dark for 30 to 50 minutes.

[0013] According to the technical solution of the present invention, in step 2), the enzyme digestion reaction temperature is controlled at 37° C., and the time is controlled at 0.5 to 1 h.

[0014] According to the technical solution of the present invention, in step 3), the library construction includes: step ①: connecting the 3' end of the RNA sample to the RNA adapter; step ②: reverse transcription into cDNA; step ③: connecting the 5' end of the cDNA to the DNA adapter; step ④: PCR amplification and purification.

[0015] According to the technical solution of the present invention, step ① includes: adding the RNA linker, T4 RNALigase Reaction Buffer, 50% PEG 8000, DTT, and T4 RNA ligase 2truncated KQ to the sample, reacting at 25°C for 2 hours, and then reacting at 16°C for 12 hours; wherein the nucleotide sequence of the RNA linker is: 5'-rAPP-AGATCGGAAGAGCGTCGTG-3'SpC3 (shown in SEQ ID NO: 1 in the sequence table), wherein rA represents adenine ribose, pp represents two phosphate groups, and SpC3 represents a spacer arm.

[0016] According to the technical solution of the present invention, step ② includes: adding RT primer to the sample, placing it in a PCR instrument and heating it at 75°C for 2 minutes, then transferring it to ice and placing it for 2 minutes, adding RNase inhibitor, First Strand Buffer, DTT, dNTPmix, and SuperScript III, and reacting at 25°C for 3 minutes, at 42°C for 10 minutes, and at 52°C for 40 minutes, respectively. The nucleotide sequence of the RT primer is: ACACGACGCTCTTCCGATCT (shown in SEQ ID NO: 2 in the sequence listing).

[0017] According to the technical solution of the present invention, step ③ includes: adding the DNA adapter and DMSO to the cDNA and mixing them by pipetting, heating at 75°C for 2 minutes, and then immediately transferring to ice for 2 minutes, then adding 50% PEG8000, RNA ligation buffer, ATP and T4 RNA Ligase 1 to the system, and placing it in a PCR instrument at 25°C for 12 hours; wherein the nucleotide sequence of the DNA adapter is:

[0018] 5'-Phos-NNNNNNNNNNAGATCGGAAGAGCACACGTCTG-3'SpC3 (shown in SEQ ID NO: 3 in the sequence listing), wherein Phos represents a phosphate group and SpC3 represents a spacer.

[0019] According to the technical solution of the present invention, in step ④, the forward primer and reverse primer used in PCR amplification are purchased from NEB. The forward primer used in PCR amplification is called NEB universal primer; the reverse primer used in PCR amplification is called NEB index primer.

[0020] The forward primer sequences used in PCR amplification are:

[0021] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T;

[0022] The reverse primer sequences used in PCR amplification are:

[0023] CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-sT.

[0024] Compared with the prior art, the present invention has the following advantages and beneficial effects: The present invention provides a high-throughput sequencing detection method for hypoxanthine in RNA, which has high specificity, high sensitivity and is easy to operate. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Schematic diagram of the process of the high-throughput sequencing detection method of hypoxanthine in RNA in the present invention;

[0026] Figure 2 It is the preliminary statistics of sequencing results;

[0027] Figure 3 It is to select a region to observe the characteristics of the sites in the statistical results. DETAILED DESCRIPTION

[0028] The scheme of the present invention will be explained below in conjunction with Examples and Comparative Examples. Those skilled in the art will understand that the following Examples and Comparative Examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. Where specific techniques or conditions are not specified in the examples, they are carried out according to the techniques or conditions described in the literature in this area or according to the product instructions. The methods used are conventional methods well known in the art unless otherwise specified, and the consumables and reagents used are commercially available unless otherwise specified. Unless otherwise indicated, the professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any method or material similar or equivalent to the described content may also be applied to the present invention.

[0029] Example 1

[0030] The RNA used for sequencing in the following examples was fragmented mouse brain tissue mRNA, the sodium periodate used was commercially purchased, and the Endonuclease V used was purchased from NEB.

[0031] Figure 1 This is a flow chart of the high-throughput sequencing detection method for hypoxanthine in RNA of the present invention. First, after the RNA sample is treated with sodium periodate, the RNA end will be blocked, and then Endonuclease V is used for digestion. The RNA samples that have undergone the digestion reaction and the RNA samples that have not undergone the digestion reaction are divided into two groups. The RNA samples that have not undergone the digestion reaction will not be connected to the linker because the blocked RNA fragments will not be connected to the linker. The RNA samples that have undergone the digestion reaction can be connected to the linker because the hydroxyl groups generated by the digestion treatment can be connected to the linker, thereby achieving an enrichment effect and accurately finding the modification site through the digestion site.

[0032] A high-throughput sequencing method for detecting hypoxanthine in RNA specifically comprises the following steps:

[0033] (1) End blocking: Add 1 μg of RNA sample to 10 mM sodium periodate and incubate on ice in the dark for 40 min. After the reaction, precipitate with ice-cold ethanol or purify using the RCC (Zymo Research) purification kit.

[0034] (2) Enzyme digestion: Take half of the RNA sample treated with sodium periodate in step (1) for enzyme digestion reaction, add reaction buffer and Endonuclease V to the sample, react at 37°C for 1 hour, and purify using an OCC purification kit after the reaction to obtain 7uL of the sample after enzyme digestion reaction.

[0035] (3) Ligating the 3' end of the RNA sample with the RNA linker: The remaining half of the RNA sample after sodium periodate treatment in step (1) and the 7uL sample after enzyme digestion reaction obtained in step (2) were subjected to parallel ligation reactions. RNA linkers, T4 RNA Ligase Reaction Buffer, 50% PEG 8000, DTT, and T4 RNA ligase2truncated KQ were added to the two groups of samples respectively. The reaction was carried out at 25°C for 2 hours, and then at 16°C for 12 hours. After the reaction was completed, 5'Deadenylase was added, and the reaction was carried out at 30°C for 1 hour. RecJf was then added and the reaction was carried out at 37°C for 1 hour to remove excess linker. After the reaction was completed, OCC purification was used.

[0036] The nucleotide sequence of the RNA linker is: 5'-rAPP-AGATCGGAAGAGCGTCGTG-3'SpC3 (shown in SEQ ID NO: 1 in the sequence table), wherein rA represents adenine ribose, pp represents two phosphate groups, and SpC3 represents a spacer.

[0037] (4) Reverse transcription of RNA samples: RT primer was added to each of the two groups of samples obtained after the ligation reaction in step (3), and the samples were placed in a PCR instrument, heated at 75°C for 2 minutes, and then immediately transferred to ice for 2 minutes; RNase inhibitor, First Strand Buffer, DTT, dNTP mix, and SuperScript III were added, and the reaction was carried out at 25°C for 3 minutes, 42°C for 10 minutes, and 52°C for 40 minutes, respectively; after the reaction, Exonuclease I was added and the reaction was continued at 37°C for 30 minutes; after the reaction, EDTA and NaOH were added, and the samples were heated at 65°C for 15 minutes to remove RNA and then purified with OCC.

[0038] The nucleotide sequence of the RT primer is: ACACGACGCTCTTCCGATCT (shown in SEQ ID NO: 2 in the sequence table).

[0039] (5) Connecting the 5' end of the cDNA to the DNA linker: Add DNA linkers and DMSO to the two groups of cDNA obtained after reverse transcription in step (4) and mix them by pipetting. Heat them at 75°C for 2 minutes and then immediately transfer them to ice for 2 minutes. Then, add 50% PEG8000, RNA ligation buffer, ATP and T4 RNA Ligase 1 (high concentration) to the system, place it in a PCR instrument and react at 25°C for 12 hours. After the reaction is completed, use DCC purification.

[0040] Among them, the nucleotide sequence of the DNA linker is:

[0041] 5'-Phos-NNNNNNNNNNAGATCGGAAGAGCACACGTCTG-3'SpC3 (shown in SEQ ID NO: 3 in the sequence listing), wherein Phos represents a phosphate group and SpC3 represents a spacer.

[0042] (6) Library amplification: The library was amplified using the NEB adapter kit and Ultra II Q5 premix (2×). The PCR amplification program was as follows: initial denaturation at 98°C for 30 seconds, followed by a three-step cycle of denaturation at 98°C for 10 seconds, annealing at 65°C for 30 seconds, and extension at 72°C for 30 seconds. The cycle was then extended at 72°C for 5 minutes.

[0043] The forward primer and reverse primer used in PCR amplification were purchased from NEB. The product name of the forward primer used in PCR amplification is NEB universal primer; the product name of the reverse primer used in PCR amplification is NEB index primer.

[0044] The forward primer sequences used in PCR amplification are:

[0045] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T;

[0046] The reverse primer sequences used in PCR amplification are:

[0047] CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-sT.

[0048] (7) Purification of library amplification products: The amplified library is purified using VAHTS DNA Clean Beads. Alternatively, the library can be recovered by agarose gel electrophoresis.

[0049] (8) Library sequencing: The library was sequenced using Illumina Hiseq X10.

[0050] (9) Bioinformatics analysis: Compare the enrichment characteristics, enzyme cleavage site characteristics, and mutation characteristics of the experimental group (enzyme cleavage group) and the control group (unenzyme cleavage group) to determine the modification site.

[0051] High-throughput sequencing results analysis:

[0052] By analyzing the sequencing results, it can be observed that the experimental group has a large amount of enrichment compared with the control group. More than two biological experiments are repeated in parallel and overlapped. The results are as follows: Figure 2 As mentioned above, one biological experiment found 11,723 modification sites, and the other found 17,518 modification sites. As shown in the figure, the intersection can find 4,944 highly reliable modification sites, with a repetition rate of about 50%. Select a region to observe the characteristics of the sites in the statistical results, and the results are as follows Figure 3 As shown, Figure 3 The upper part is the control group, and the lower part is the experimental group. By selecting statistical sites and comparing the experimental group with the control group, it can be found that the experimental group has a high enrichment, and the detected fragments have obvious truncation signals. At the same time, there is an A-to-G mutation at the adjacent bases of the truncation. These characteristics ensure the accuracy of the modification sites found.

[0053] The experimental group has a large amount of enrichment compared to the control group, and there are obvious enzyme cleavage sites on the enriched peaks. By observing the bases adjacent to the enzyme cleavage sites, a large number of A to I mutations can be found, so that the modification sites can be found with high accuracy.

[0054] Although the embodiments and comparative examples of the present invention have been shown and described above, it will be understood that the above embodiments and comparative examples are exemplary and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention. Sequence Listing <110> Wuhan University <120> High-throughput sequencing method for detecting hypoxanthine in RNA <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <400> 1 agatcggaag agcgtcgtg <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 20. acacgacgct cttccgatct <210> 3 <211> 32 <212> DNA <213> Artificial Sequence <400> 3 nnnnnnnnnn slowly slowly tg

Claims

1. A high-throughput sequencing method for detecting hypoxanthine in RNA, characterized in that: The steps include: Step 1): Treat the RNA sample with sodium periodate solution; Step 2): The RNA sample treated in step 1) is subjected to an enzyme digestion reaction using Endonuclease V; Step 3): constructing libraries for the RNA sample treated in step 1) and the RNA sample digested in step 2); Step 4): Sequencing the two sets of libraries obtained in step 3), comparing the two sets of sequencing results, determining the enriched fragments, and back-tracing the enzyme cleavage sites of the enriched fragments to find the mutation site, that is, to find the hypoxanthine modification site; In the step 1), the concentration of the sodium periodate solution is 10 mM.

2. The high-throughput sequencing detection method for hypoxanthine in RNA according to claim 1, wherein In the step 1), the RNA sample is treated with a sodium periodate solution, specifically, the RNA sample is reacted with a 10 mM sodium periodate solution at 0° C. in the dark for 30 to 50 minutes.

3. The high-throughput sequencing detection method for hypoxanthine in RNA according to claim 1, wherein In the step 2), the enzyme digestion reaction temperature is controlled at 37° C., and the time is controlled at 0.5 to 1 h.

4. The high-throughput sequencing detection method for hypoxanthine in RNA according to claim 1, wherein In step 3), the library construction includes: step ①: connecting the 3' end of the RNA sample to the RNA adapter; step ②: reverse transcription into cDNA; step ③: connecting the 5' end of the cDNA to the DNA adapter; step ④: PCR amplification and purification.

5. The high-throughput sequencing detection method for hypoxanthine in RNA according to claim 4, characterized in that The step ① includes: adding the RNA linker to the sample, T4 RNALigase Reaction Buffer, 50% PEG 8000, DTT, T4 RNAligase 2truncated KQ, react at 25°C for 2 hours, then at 16°C for 12 hours; wherein the nucleotide sequence of the RNA linker is: 5'-rAPP-AGATCGGAAGAGCGTCGTG-3'SpC3.

6. The high-throughput sequencing detection method for hypoxanthine in RNA according to claim 4, characterized in that Step ② comprises: adding RT primer to the sample, heating the sample in a PCR instrument at 75°C for 2 minutes, then transferring the sample to ice for 2 minutes, adding RNase inhibitor, First Strand Buffer, DTT, dNTPmix, and SuperScript III, and reacting the sample at 25°C for 3 minutes, 42°C for 10 minutes, and 52°C for 40 minutes, respectively. The nucleotide sequence of the RT primer is: ACACGACGCTCTTCCGATCT.

7. The high-throughput sequencing detection method for hypoxanthine in RNA according to claim 4, characterized in that: The step ③ includes: The DNA adapter and DMSO were added to the cDNA and mixed by pipetting. The mixture was heated at 75°C for 2 minutes and immediately transferred to ice for 2 minutes. 50% PEG 8000, RNA ligation buffer, ATP, and T4 RNA Ligase 1 were then added to the system and the reaction was carried out in a PCR instrument at 25°C for 12 hours. The nucleotide sequence of the DNA adapter was: 5'-Phos-NNNNNNNNNNGATCGGAAGAGCACACGTCTG-3'SpC3.

Images