An electrochemical method for detecting CYP2C19*2 genotypes using a ligase-exonuclease-based "zero-background" method

Through the combination of ligase Ampligase and nuclease λ-Exo, rapid and easy DNA hybridization was achieved on the electrochemical sensing interface, which solved the problem of background signal interference and realized efficient differentiation of CYP2C19*2 genotypes and personalized drug genotyping detection.

CN115109855BActive Publication Date: 2025-09-16THE FIRST AFFILIATED HOSPITAL OF FUJIAN MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210274079.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-03-20
Publication Date
2025-09-16
Estimated Expiration
2042-03-20

AI Technical Summary

Technical Problem

Existing technologies make it difficult to achieve rapid, simple, and efficient DNA hybridization at the electrochemical sensing interface, resulting in insufficient signal-to-noise ratio and detection limit, especially when distinguishing CYP2C19*2 genotypes in human whole blood genomic DNA testing, where background signal interference is severe.

Method used

By combining ligase Ampligase with nuclease λ-Exo, LCR nucleic acid amplification and λ-Exo enzymatic digestion reactions were carried out in the same homogeneous solution. MB-modified long ssDNA was exponentially amplified, and ssDNA was screened through a high-density DNA self-assembled monolayer. Hybridization was carried out in the form of an "inverted" structure, which allowed MB to approach the gold electrode surface for electron transfer, achieving "zero background" detection.

Benefits of technology

The specific differentiation of CYP2C19*2 genotypes in human whole blood genomic DNA detection was achieved, which avoided background signal interference, improved the accuracy and sensitivity of detection, and provided a new idea for personalized drug genotyping detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115109855B_ABST
    Figure CN115109855B_ABST
Patent Text Reader

Abstract

The present invention discloses a ligase combined with exonuclease "zero background" detection method <h2 style=";text-align:left;direction:ltr">CYP2C19*2 The electrochemical method for genotyping is characterized by using methylene blue (MB), a highly stable electroactive indicator in biological sample detection, to modify the signal probe as the source of the electrical signal, combining the specific amplification and shearing properties of the two enzymatic reactions. <h2 style=";text-align:left;direction:ltr"> CYP2C19*2 When MB is present, the long ssDNA modified by MB will be exponentially amplified. Subsequently, this ssDNA is captured and hybridized by the high-density DNA self-assembled monolayer with ssDNA screening properties through the "inverted" structure. MB is close to the surface of the gold electrode, and electron transfer occurs. Finally, the electrical signal is collected using square wave voltammetry (SWV). In the detection of human whole blood clinical samples, the present invention can distinguish <h2 style=";text-align:left;direction:ltr"> CYP2C19*2 The present invention can detect three genotypes and achieve a "zero background" blank test. In addition, the present invention has important design reference value for how to reduce the detection background signal, and can also provide new ideas and new directions for personalized drug genotype detection methods.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a "zero background" detection method combining LCR chain reaction with λ-Exo enzyme digestion reaction. CYP2C19*2 The electrochemical method of genotyping can specifically distinguish the genomic DNA in human whole blood. CYP2C19*2 The present invention has important design reference value for how to reduce the detection background signal of three genotypes, and can also provide new ideas and new directions for individualized drug genotyping detection methods. Background Art

[0002] CYP2C19 is a very important drug metabolizing enzyme in the human body. The therapeutic effects and adverse reactions of drugs metabolized by this enzyme vary significantly with the patient's genotype. This is due to the genetic polymorphism of CYP2C19. CYP2C19*2 It is one of the most common mutation sites in the Han population. Studying its genotype is helpful to ensure the safety of patients' medication and achieve personalized drug administration.

[0003] Surface hybridization of DNA at electrode interfaces or sensor interfaces modified with different materials is the basis of modern applied genomic analysis technology and is widely used in genotyping, gene expression mapping, drug discovery, and biosensing. The main challenge in achieving highly sensitive DNA detection is how to obtain the optimal conditions for rapid, simple, and efficient hybridization at the sensor interface. The surface hybridization of DNA is affected by the surface probe coverage number (Γ max ) and the influence of ionic strength in the hybridization solution, at lower Γ max When the density of surface probes is much lower than 1×10 12 molecules / cm 2 When hybridization is performed on the surface, the amount of dsDNA formed by surface molecular hybridization is very limited, which reduces the signal-to-noise ratio and leads to insufficient detection limits. Improving the signal-to-noise ratio can be achieved by introducing signal amplification strategies or increasing the density of surface molecular probes. It is important to note that as the density of CPs on the sensing interface increases, the electrostatic repulsion and steric hindrance effects at the sensing interface will increase significantly, and the complexity of the hybridization recognition process will also increase.

[0004] Based on the above analysis, we considered converting the target product (dsDNA) obtained by LCR amplification into a more flexible and smaller ssDNA form while increasing the density of surface molecular probes, in order to obtain a higher signal probe loading capacity on the sensing interface and improve detection sensitivity. How to convert double strands into single strands without affecting the "inverted" hybridization conformation is a key step. Currently, there are many methods for preparing ssDNA, such as asymmetric PCR, biotin-avidin separation, denaturing polyacrylamide gel electrophoresis separation, high temperature denaturation, and nuclease digestion. Each method has its advantages, but not all methods are suitable for use with electrochemical sensors.

[0005] The present invention uses MB as an electroactive indicator, based on the LCR nucleic acid amplification reaction combined with the λ-Exo enzyme cleavage reaction, combining the efficient LCR target gene amplification and specific differentiation of DNA single base mismatches with the efficient λ-Exo cleavage of dsDNA-PO4, exponentially amplifying MB-modified long ssDNA in the same homogeneous solution, and utilizing the characteristics of high-density DNA self-assembled monolayer to screen ssDNA. This ssDNA is captured and hybridized by the monolayer in the form of an "inverted" structure, allowing MB to approach the gold electrode surface and electron transfer to occur. MB-modified long ssDNA is the only source of electrical signals, and the present invention constructs a "zero background" detection method. CYP2C19*2 The electrochemical method of genotyping has realized the detection of human whole blood genomic DNA clinical samples. CYP2C19*2 Specific differentiation of the three genotypes. Summary of the Invention

[0006] One of the purposes of the present invention is to construct a "zero background" detection method based on ligase (Ampligase) combined with nuclease (λ-Exo) CYP2C19*2 Electrochemical methods for genotyping.

[0007] The second purpose of the present invention is to apply this method to human whole blood genomic DNA samples CYP2C19*2 Genotype detection.

[0008] To achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0009] A ligase combined with an exonuclease for "zero background" detection CYP2C19*2 The electrochemical method for genotyping is characterized by: (1) the ligase is a thermostable ligase (Ampligase), which can specifically recognize single-base mismatches in DNA, and the exonuclease is Lambda exonuclease (λ-Exo), which can cut the 5' blunt end of dsDNA into ssDNA. The enzymatic reaction involving the two tool enzymes can exponentially amplify MB-modified long ssDNA (AP-SP) in the same homogeneous solution. MB(2) Ability to achieve “zero background” blank detection; (3) Ability to distinguish between CYP2C19*2 The three genotypes ( CYP2C19*1*1, CYP2C19*1*2, CYP2C19*2*2 ).

[0010] The electrochemical method is characterized in that the exponential amplification steps of MB-modified long ssDNA are as follows: in the same homogeneous solution, when MT is present, four primers each at a concentration of 90 nM are first exponentially amplified to obtain MB-modified long dsDNA through ligase chain reaction (LCR) under the action of Ampligase, and then, under the action of λ-Exo, the MB-modified long dsDNA is sheared into MB-modified long ssDNA; the LCR reaction system is shown in Table 1, and the LCR reaction process is as follows: 1) pre-denaturation at 94°C for 5 min; 2) hybridization at 45°C for 1 min, ligation at 53°C for 1 min, and denaturation at 94°C for 1 min as one thermal cycle, and a total of 30 cycles are performed to obtain MB-modified long dsDNA; 3) storage at 4°C; then, 1.5 U of λ-Exo is added to the above reaction product, and the enzymatic digestion reaction process is as follows: 1) enzyme digestion at 37°C for 30 min; 2) termination of the reaction at 75°C for 10 min to obtain MB-modified long ssDNA.

[0011] Table 1 LCR reaction system (50 µL)

[0012]

[0013] The electrochemical method is characterized in that the “zero background” blank detection is achieved by the following process: (1) Primer design: as shown in Table 2, four LCR primers, a signal probe (SP MB ) 5' end modified with MB, the other primers (A1, A2, AP) 5' end modified with -PO4 for λ-Exo recognition and cleavage, and the two pairs of primers are complementary (A2 / SP MB , A1 / AP), wherein A1 and A2 are respectively half of the target gene (MT), the 3' end of the capture probe (CP) is modified with -SH, and the 5' end has a 12 nt sequence complementary to the 12 nt sequence at the 3' end of AP; (2) the MB-modified long ssDNA described in claim 2 is used as the only source of electrochemical signal, and after exponential amplification, it hybridizes with CP on the surface of the gold electrode in the form of an "inverted" structure, so that MB is close to the surface of the gold electrode and electron transfer is easy to occur; (3) the high-density DNA self-assembled monolayer constructed by CP has the ability to screen ssDNA. When and only when MT is present, the two enzymatic reactions combine to exponentially amplify the MB-modified long ssDNA, which can be captured by CP, and MB and the gold electrode undergo electron transfer to generate an electrochemical signal.

[0014] Table 2 CYP2C19*2Primer probe sequence

[0015]

[0016] (The underlined bases indicate the mutation sites or partial base (12 nt) complementary sites, and the bold bases are the electroactive indicator modification sites.)

[0017] Specifically, the present invention adopts the following technical solutions:

[0018] 1. Design principle of the present invention:

[0019] Among the four primers in LCR, the signal probe (SP MB ) 5' end is modified with MB, and the other primers (A1, A2, AP) 5' end are modified with -PO4, which can ensure that the connection product obtained by LCR amplification is a long dsDNA with one end modified with -PO4 and the other end modified with MB. More importantly, even if the primer is not completely reacted with -PO4, the remaining primers will hybridize to form a short dsDNA (5' end modified with -PO4), which λ-Exo can recognize and cut, ensuring that after the enzyme digestion reaction is completed, the specificity of the present invention is still consistent with LCR (Ampligase has the ability to specifically distinguish single base mismatches). After LCR combined with λ-Exo enzyme digestion reaction, a large amount of MB-modified long ssDNA (AP-SP MB ) partially hybridizes with the capture probe (CP) on the high-density DNA self-assembled monolayer. The hybridization position is at the end away from the electrode surface. Compared with dsDNA, ssDNA is more flexible and smaller in size, and the electrostatic repulsion and steric hindrance are reduced, which promotes the AP-SP MB It can be hybridized with CP efficiently, using the "inverted" hybridization form to make AP-SP MB The end marked with MB is close to the gold electrode, and the CP and AP-SP MB Except for the top part of the hybridization, most of the sequences are non-complementary, so the end close to the sensing interface is a more flexible single-stranded structure, which will not form a dense ion layer to restrict the free diffusion of ions in the solution. CYP2C19*2 AP-SP exists only when MB The electrochemical signal of this detection method comes only from AP-SP MB , so "zero background" blank detection can be achieved. Finally, the characteristic peak height of MB is quantitatively related to the concentration of the target gene, which can be used to CYP2C19*2 Three genotypes were visually detected.

[0020] 2. Constructing a high-density DNA self-assembled monolayer on the surface of a gold electrode, comprising the following steps:

[0021] (1) Pretreatment of gold electrode (AuE): AuE was ultrasonically treated with Piranha solution (30% H2O2 and concentrated H2SO4, mixed in a volume ratio of 1:3) for 10 min, ultrasonically cleaned with deionized water twice for 5 min each, and polished to a mirror finish with a mixture of 0.3 μm and 0.05 μm Al2O3 and water, followed by ultrasonic cleaning with ethanol and distilled water for 2 min each. The ultrasonicated electrode was placed in 0.5 M H2SO4 and cyclically scanned in the potential range of 0–1.6 V until stable. The electrode was then rinsed with double-distilled water, dried with N2, and set aside.

[0022] (2) Self-assembly of CP on AuE: The pretreated AuE was fixed on a horizontal surface. The CP was reduced with TE+TCEP at room temperature in the dark (to remove disulfide bonds). 3 μL of CP solution of each concentration was drop-coated on the AuE surface and incubated in the dark for 16 h. The assembled AuE-SH-ssDNA was rinsed with 10 mM PB to remove unbound CP and dried with N2. Then, it was immersed in 100 μL of 2 mM MCH solution and sealed in the dark for 2 h (to remove nonspecific adsorption). After the blocking was completed, it was rinsed with 10 mM PB, dried with N2, and set aside.

[0023] 3. The LCR chain reaction and the λ-Exo enzymatic digestion reaction are performed in the same homogeneous solution, mainly involving buffer compatibility:

[0024] (1) Linear LCR directly amplifies AP-SP MB This method was used to investigate the effect of λ-Exo buffer on Ampligase, using Ampligase buffer as the control group, which is more direct and convenient. Comparison revealed that the electrical signal in the λ-Exo buffer reaction system was zero regardless of the presence of the target gene, and remained zero even when the Ampligase enzyme dosage was increased. In contrast, the control group exhibited a distinct MB characteristic peak, which increased with increasing Ampligase enzyme dosage. This suggests that λ-Exo buffer is not suitable for LCR.

[0025] (2) LCR was used to investigate the effect of Ampligase buffer on λ-Exo. When the target gene was present, as the amount of λ-Exo enzyme increased, MB characteristic peaks of varying heights appeared. According to the design principle of the present invention, it is difficult for dsDNA to pass through a high-density DNA monolayer. The MB characteristic peak is the product of the LCR combined with λ-Exo enzyme digestion reaction (AP-SP MB ) hybridizes with CP, generating an electrical signal through electron transfer on the gold electrode surface. Therefore, Ampligase buffer can be used as the reaction system buffer, allowing the LCR chain reaction and λ-Exo enzymatic digestion reaction to be performed in the same homogeneous solution.

[0026] 4. CYP2C19*2 Genotyping of clinical samples involves the following steps:

[0027] (1) Collection and extraction of clinical samples: Department of Pharmacy, The First Affiliated Hospital of Fujian Medical University CYP2C19*2 Human whole blood samples for the test project (approved by the hospital's medical ethics committee,

[2019] 071) were used, using a fully automatic nucleic acid extraction instrument and a matching total nucleic acid extraction kit (human whole blood) to extract whole-genomic DNA, which was then stored in a -20°C freezer.

[0028] (2) PCR amplification of human whole blood genomic DNA: Search the NCBI gene database Genbank for CYP2C19*2 For the full gene sequence, a gene fragment containing the mutation site, totaling 1170 nt, was selected. The PCR primers are shown in Table 3, and the PCR reaction system and reaction steps are shown in Tables 4 and 5.

[0029] Primer name sequence rs4244285-728-F AAGCAGGTATAAGTCTAGGAAATGA rs4244285-1202R ACTCCTTGACCTGTTAAACATCCGT

[0030] Ingredients Volume (µL) template 1 rs4244285-728-F 1 rs4244285-1202R 1 dNTP 10 mM 1 Taq Buffer 5 <![CDATA[25 mM MgCl2]]> 5 Taq enzyme 5 U / μL 0.5 water 15.5

[0031] Table 5 PCR reaction steps

[0032]

[0033] (3) Electrochemical Detection: Square wave voltammetry (SWV) was used to collect MB electrical signals using a three-electrode system and a CHI 760E bipotentiostat. The hybridized AuE was gently rinsed along the edge with electrolyte and then placed in the electrolyte for detection. SWV: Amplitude: 0.025 V–0.05 V, frequency: 10–100 Hz, sweep potential: -0.45 V–0 V.

[0034] Advantages of the detection method of the present invention:

[0035] 1. Achieve “zero background” blank detection: It can avoid unnecessary interference of impurity signals in clinical samples and improve the precision and accuracy of the detection method. At present, most CYP2C19*2 The genotype detection method has not been able to truly achieve "zero background" blank detection. The present invention adopts a "signal-on" electrochemical detection principle. The source of the electrical signal is clear and unique. When and only when the target gene exists, the signal probe will be specifically connected and exponentially amplified, and directly converted into more flexible and curly ssDNA in the homogeneous solution, which is easy to hybridize in a high-density DNA monolayer. The multiple control of the signal source ensures "zero background" blank detection, which will promote the true application of electrochemical detection methods in the detection of clinical samples and is of great significance.

[0036] 2. Achieve clinical sample CYP2C19*2 Three genotype differentiation tests: Based on the current signal and MB characteristic peak height, CYP2C19*2 The three genotypes can provide new ideas and directions for personalized drug gene typing detection methods.

[0037] 3. A high-density DNA self-assembled monolayer on the gold electrode surface combined with an "inverted" structure was proposed, which has important design reference value and scientific guiding significance for studying the influence of the density of the DNA self-assembled layer on the electrochemical sensing interface and how to improve the hybridization efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 Schematic diagram of the design of the detection method of the present invention;

[0039] Figure 2 Optimize the conditions of the detection method of the present invention;

[0040] Figure 3 The current intensity of the detection method of the present invention is CYP2C19*2 Linear relationship graph of concentration;

[0041] Figure 4 The detection method of the present invention is applied to CYP2C19*2 Clinical sample test results and sequencing images. DETAILED DESCRIPTION

[0042] In order to make the technical problems, technical solutions and effects to be solved by the present invention clearer, the present invention is further described in detail below in conjunction with embodiments and accompanying drawings.

[0043] like Figure 1 As shown, the present invention describes an LCR chain reaction combined with λ-Exo enzyme digestion reaction "zero background" detection CYP2C19*2 Schematic diagram of the design of the electrochemical method for genotyping: First, genomic DNA is extracted from human whole blood. CYP2C19*2 When present, based on the ability of Ampligase to distinguish single-base mismatches in DNA combined with the ability of λ-Exo to recognize dsDNA 5' blunt-end -PO4, MB-modified long ssDNA is exponentially amplified. The screening ability of the high-density DNA monolayer on the gold electrode surface for ssDNA is utilized. An "inverted" hybridization structure is adopted to allow MB-modified long ssDNA to complementarily hybridize with the capture probe (CP, Capture Probe, specific sequence see Table 2) at one end away from the electrode. MB approaches the gold electrode surface, electron transfer occurs, and square wave voltammetry (SWV) is used to collect MB electrical signals. MB is specifically distinguished based on the current signal value and MB characteristic peak height. CYP2C19*2 Three genotypes.

[0044] Example 1:

[0045] Primer design: Search for submitted drug metabolism genes from the NCBI gene database Genbank CYP2C19*2 Based on the complete sequence of rs4244285, 681G>A, the wild-type gene (Wild target, WT), mutant gene (Mutant target, MT), LCR primer probe (A1, A2, AP, SP) were designed according to the point mutation site, the optimal activity range of Ampligase, and the DNA half-melting temperature. MB Then, based on the cleavage recognition site of λ-Exo, the 5' end of the primer probe was modified with -PO4, and the 3' end of the signal probe (SP) was modified with methylene blue (SP MB ), as the sole source of electrical signals. Finally, to analyze the feasibility of this detection method, long signal probes (L-SP, L-SP1) and a target strand with -PO4 (MT-PO4) were designed. The specific sequences are shown in Table 2 (underlined bases indicate mutation sites or partial base (12 nt) complementary sites; bold bases indicate electroactive indicator modification sites).

[0046] Table 2 CYP2C19*2 Primer probe sequence

[0047]

[0048] (The underlined bases indicate the mutation sites or partial base (12 nt) complementary sites, and the bold bases are the electroactive indicator modification sites).

[0049] Example 2:

[0050] Preparation of primer solution and reagents:

[0051] 1) Phosphate inhibitor solution (0.2 M PB): Mix 1.4822 g NaH2PO4·2H2O and 14.5046 g Na2HPO4·10H2O in a 500 mL blue-capped bottle and dilute to 250 mL with double-distilled water to prepare 0.2 M PB with a pH of 7.4.

[0052] 2) Phosphate rinse solution (10 mM PB): Add 20 mL of the prepared 0.2 M PB to a 500 mL blue-cap bottle and dilute to 400 mL with double-distilled water to prepare a 10.0 mM phosphate rinse solution with a pH of 7.4.

[0053] 3) Tris-HCl buffer: Place 0.302825 g of Tris powder in a 500 mL blue-capped bottle and dilute to 250 mL with double-distilled water to prepare a 10.0 mM Tris solution. Adjust the pH to 8.0 with a small amount of concentrated hydrochloric acid.

[0054] 4) TE buffer: Weigh 2.922 g NaCl and 0.0186 g EDTA and dilute to 50 mL with 10 mM Tris-HCl to prepare TE buffer (pH 8.0) (containing 1.0 mM EDTA and 0.1 M NaCl).

[0055] 5) TE+TCEP reducing solution: Weigh 0.0286 g TCEP and dilute to 10 mL with prepared TE buffer to prepare a TE+TCEP reducing solution containing 1 μM TCEP.

[0056] 6) DNA stock solution: Synthesized DNA is attached to the wall of the container tube as a very light dry film, which is very easy to lose when opened. Therefore, before dissolving, centrifuge the tube containing DNA at 3000 rpm for 10 minutes, slowly open the lid, and add a certain volume of TE according to the instructions to prepare a 100 µM stock solution. To avoid repeated freezing and thawing, the stock solution can be aliquoted into 1 µL per tube and stored frozen at -20°C.

[0057] 7) Mercaptohexanol blocking agent (MCH): Add 4 μL of MCH stock solution to 15 mL of double-distilled water to make 2 mM MCH blocking agent. Store at 4°C in the dark.

[0058] 8) Electrolyte: Weigh 23.376 g of NaCl into a 500 mL blue-capped bottle. Add 20 mL of the prepared 0.2 M PB and 380 mL of double-distilled water to a volume of 400 mL to prepare an electrolyte solution containing 10 mM PB and 1 mM NaCl.

[0059] 9) Target probe (MT, WT), primer probe (A1, A2, AP, SP MB ): Take 1 μL of the corresponding target probe and primer probe stock solution, add 99 μL Tris-HCl buffer, mix evenly in a mixer, first prepare a 1 μM solution, and then use Tris-HCl buffer to prepare different concentrations according to experimental requirements and store at 4°C.

[0060] 10) Capture Probe (CP): Take 1 μL of the corresponding capture probe stock solution (see Table 2 for specific sequences) and add 99 μL of TE+TCEP reducing solution. Mix thoroughly in a mixer to prepare a 1 μM solution. Allow to reduce at room temperature in the dark. Then, prepare different concentrations of the solution using TE+TCEP reducing solution according to experimental requirements and store at 4°C.

[0061] 10×λ-Exo buffer: 67 mM glycine potassium hydroxide, 2.5 mM potassium chloride, 50 µg / ml bovine serum albumin, pH 9.0.

[0062] 10× Ampligase buffer: 200 mM Tris-HCl, 250 mM KCl, 100 mM MgCl2, 5 mM NAD, 0.1% Triton X-100, pH 8.3.

[0063] Example 3:

[0064] The LCR chain reaction and λ-Exo digestion reaction were performed in the same homogeneous solution. In the presence of MT, four primers (each at a concentration of 90 nM) were first amplified exponentially by ligase chain reaction (LCR) with Ampligase to produce MB-modified long dsDNA. Then, under the action of λ-Exo, the MB-modified long dsDNA was cleaved into MB-modified long ssDNA. The LCR reaction system is shown in Table 1. The LCR reaction process includes: 1) pre-denaturation at 94°C for 5 min; 2) hybridization at 45°C for 1 min, ligation at 53°C for 1 min, and denaturation at 94°C for 1 min, for a total of 30 cycles to obtain MB-modified long dsDNA; 3) storage at 4°C; 1.5 U of λ-Exo was then added to the reaction product, and the digestion process included: 1) digestion at 37°C for 30 min; 2) termination at 75°C for 10 min to obtain MB-modified long ssDNA.

[0065] Element Volume (µL) Tris-HCl buffer 21.8 Reaction buffer (10×) 5 AP 4.5 <![CDATA[SP MB ]]> 4.5 A1 4.5 A2 4.5 MT or WT 5 Ampligase® thermal stable ligase 0.2

[0066] Example 4:

[0067] Collection and pretreatment of clinical samples: collected from the Department of Pharmacy, First Affiliated Hospital of Fujian Medical University CYP2C19*2 Human whole blood samples for genotyping testing (approved by the hospital's Medical Ethics Committee

[2019] 071) were used to extract whole genomic DNA using a fully automatic nucleic acid extraction instrument and a matching total nucleic acid extraction kit (human whole blood) and stored in a -20°C refrigerator. CYP2C19*2For the full gene sequence, a gene fragment containing the mutation site (1170 nt) was selected. PCR primers were designed and provided by Sangon Biotech (Shanghai) Co., Ltd. (see Table 3 ). The PCR reaction system is shown in Table 4 , and the PCR reaction conditions are shown in Table 5 .

[0068] Primer name sequence rs4244285-728-F AAGCAGGTATAAGTCTAGGAAATGA rs4244285-1202R ACTCCTTGACCTGTTAAACATCCGT

[0069] Ingredients Volume (µL) template 1 rs4244285-728-F 1 rs4244285-1202R 1 dNTP 10 mM 1 Taq Buffer 5 <![CDATA[25 mM MgCl2]]> 5 Taq enzyme 5 U / μL 0.5 water 15.5

[0070] Table 5 PCR reaction steps

[0071]

[0072] Example 5:

[0073] Construction of high-density DNA self-assembled monolayer on the gold electrode surface:

[0074] 1) Gold Electrode (AuE) Pretreatment: The AuE was ultrasonically treated with a Piranha solution (30 wt% H₂O₂ and 98 wt% concentrated H₂SO₄, mixed in a volume ratio of 1:3) for 10 min. The AuE was then ultrasonically cleaned with deionized water twice, each for 5 min. The AuE was then polished to a mirror finish using a mixture of 0.3 μm and 0.05 μm Al₂O₃ and water, followed by ultrasonic cleaning with anhydrous ethanol and distilled water for 2 min each. The ultrasonicated AuE was placed in 0.5 M H₂SO₄ and scanned cyclically over the potential range of 0–1.6 V until stable. The AuE was then rinsed with double-distilled water, dried under nitrogen, and set aside.

[0075] 2) Self-assembly of the capture probe CP on AuE: Pretreated AuE was fixed on a horizontal surface. The CP was reduced with TE+TCEP at room temperature in the dark (to remove disulfide bonds). 3 μL of CP solution of various concentrations was dropwise applied to the AuE surface and incubated in the dark for 16 h at room temperature. The assembled AuE-SH-ssDNA was rinsed with 10 mM PB to remove unbound CP and dried with N2. The AuE-SH-ssDNA was then immersed in 100 μL of 2 mM MCH solution and sealed in the dark for 2 h (to remove nonspecifically adsorbed probes). After blocking, the AuE was rinsed with 10 mM PB, dried with N2, and set aside.

[0076] Example 6:

[0077] A "zero background" detection method based on LCR chain reaction combined with λ-Exo enzyme digestion reaction CYP2C19*2 The steps for optimizing the electrochemical method and detecting the linear relationship of genotypes are as follows:

[0078] (1) Figure 2Figure A shows the optimization of capture probe concentration. When the CP concentration is 1.0 μM, the MB peak reaches the highest (~104 nA). After that, as the CP concentration gradually increases, the distance between DNA molecules gradually decreases, and AP-SP MB It is also difficult to enter.

[0079] (2) Figure 2 B in the figure shows the optimization of LCR primer concentration. The increase of primer concentration can increase the enzyme digestion product (AP-SP MB ) quantity to improve the hybridization efficiency with CP. However, if the LCR primer concentration is too high, nonspecific amplification products will increase sharply, seriously interfering with the specificity and sensitivity of this method. Based on the maximum signal-to-noise ratio of WT and MT, the optimized primer concentration is 90 nM.

[0080] (3) Figure 2 C in Figure 2 Figure D shows the optimization of the amount of λ-Exo enzyme and incubation time for the λ-Exo digestion reaction. A sufficient amount of λ-Exo enzyme can ensure that all dsDNA of the LCR amplification and ligation products are sheared into ssDNA. However, if the amount of λ-Exo enzyme is too high, since λ-Exo also has a weak shearing effect on ssDNA (<1 / 100), AP-SP-MB will be secondary sheared into dNTPs. The digestion incubation time also has an important influence on the shearing effect of λ-Exo. If the time is too short, the digestion reaction is not complete and there will be residual amplification product dsDNA. If the digestion reaction time is too long, λ-Exo may perform secondary shearing on the sheared ssDNA, resulting in a decrease in the concentration of AP-SP-MB and an increase in time cost. The optimized λ-Exo enzyme amount is 1.5 U and the incubation time is 30 min.

[0081] (4) Figure 3 The current intensity and CYP2C19*2 The linear relationship diagram of concentration, CYP2C19*2 The oxidation peak current value varies with CYP2C19*2 The concentration increases, and the current response value is CYP2C19*2 The concentration range was 100 fM-10 pM, and the linear equation was: I=9.04634+9.60343×10 -12 C MT (R 2 =0.98635), with a detection limit of 100 fM.

[0082] Example 7:

[0083] A "zero background" detection method based on LCR chain reaction combined with λ-Exo enzyme digestion reaction CYP2C19*2 Electrochemical methods for genotyping CYP2C19*2Testing of clinical samples: 15 clinical samples were randomly selected and their PCR products were tested by SWV. The control group consisted of PCR products without any target chain. Figure 4 As shown in A and B in the figure, the regional division is carried out based on the current signal value (A) and the peak height of the MB characteristic peak (B) of 15 clinical samples. CYP2C19*2 The three genotypes can be clearly distinguished, and the test results are consistent with those of our hospital. CYP2C19*2 The genotyping results were consistent with those of the gold standard for genotyping (sequencing). Figure 4 C in the present invention) CYP2C19*2 The electrochemical genotyping method is stable and reliable.

Claims

1. A ligase-exonuclease "zero background" assay CYP2C19*2 An electrochemical method of genotyping, characterized by: (1) The thermostable ligase is Ampligase, which can specifically recognize single-base mismatches in DNA, and the exonuclease is Lambda exonuclease, which can cut the 5' blunt end of dsDNA into ssDNA. The enzymatic reaction involving the two tool enzymes can exponentially amplify MB-modified long ssDNA in the same homogeneous solution; (2) It can achieve "zero background" blank detection; (3) In the detection of human whole blood genomic DNA, it can distinguish CYP2C19*2 Three genotypes CYP2C19*1*1, CYP2C19*1*2, CYP2C19*2*2 ; The MB-modified long ssDNA exponential amplification steps are as follows: in the same homogeneous solution, when the target gene MT is present, four primers are first amplified exponentially to produce MB-modified long dsDNA by ligase chain reaction (LCR) under the action of Ampligase, and then the MB-modified long dsDNA is sheared into MB-modified long ssDNA under the action of Lambda exonuclease; the LCR reaction system is shown in Table 1; Table 1 LCR reaction system 50 μL ; The LCR reaction process is as follows: 1) pre-denaturation; 2) hybridization, ligation, and denaturation as one thermal cycle, for a total of 30 cycles to obtain MB-modified long dsDNA; 3) storage at 4°C; then, Lambda exonuclease is added to the above reaction product for enzyme digestion reaction to obtain MB-modified long ssDNA; The "zero background" blank detection is achieved by the following process: 1) Primer design: As shown in Table 2, four LCR primers, signal probe SP MB The 5' end of the remaining primers A1, A2, and AP were modified with -PO4. 3- , for Lambda exonuclease to recognize and cut, and the two pairs of primers are complementary to A2 / SP MB and A1 / AP, wherein A1 and A2 are respectively half of a MT, the capture probe CP is modified with -SH at its 3' end, and has a 12 nt sequence at its 5' end that is complementary to the 12 nt sequence at the 3' end of the AP; 2) the MB-modified long ssDNA, serving as the sole source of electrochemical signal, hybridizes with the CP on the surface of the gold electrode in an "inverted" structure after exponential amplification, bringing the MB close to the gold electrode surface and facilitating electron transfer; 3) the high-density DNA self-assembled monolayer constructed by the CP has ssDNA screening properties. When and only when the MT is present, the MB-modified long ssDNA exponentially amplified by the two enzymatic reactions can be captured by the CP, and electron transfer occurs between the MB and the gold electrode, generating an electrochemical signal; Table 2 CYP2C19*2 Primer probe sequence ; The underlined bases indicate the mutation sites or partial base 12 nt complementary sites, and the bold bases are the electroactive indicator modification sites.