A miR-Chr8:96 detection kit and detection method thereof

Abstract

This invention provides a miR-Chr8:96 detection kit and its detection method. The miR-Chr8:96 detection kit includes miR-Chr8:96 calibrators, ssDNA, reagent R1, reagent R2, and an RNA extraction kit; wherein the ssDNA is end-labeled with biotin, reagent R1 contains an RNA / DNA antibody—acridinium ester, and reagent R2 contains streptavidin-magnetic particles. The kit provided by this invention employs chemiluminescence immunoassay and can be used with a fully automated chemiluminescence analyzer to quantitatively detect miR-Chr8:96 in plasma, serum, urine, tissue fluid, and breast milk samples. It features high sensitivity, strong specificity, short detection time, simple operation, and low cost, meeting routine testing requirements and has wide applications.

Description

Technical Field

[0001] The present invention relates to the fields of biochemistry and immunology, and in particular to a miR-Chr8:96 detection kit and a detection method thereof. Background Art

[0002] miRNAs are a class of short-chain, endogenous non-coding RNAs with a length of about 21 bases, which are widely present in eukaryotes. miRNAs have multiple functions, participate in the regulation of gene expression, and play an important role in cell proliferation, differentiation, and apoptosis. Studies have shown that the occurrence and development of neurodegenerative diseases, metabolic diseases, cardiovascular diseases, autoimmune diseases, and tumors are closely related to the abnormal expression of miRNAs.

[0003] When myocarditis occurs, the expression level of miR-Chr8:96 in human immune cells increases significantly and is secreted into the peripheral blood circulation. The study further detected the level of miR-Chr8:96 in the plasma of the normal control group, myocardial infarction group, and myocarditis group. The results showed that the level of miR-Chr8:96 in the plasma of the normal control group and myocardial infarction group was significantly lower than that of the myocarditis group; in the statistical analysis, the area under the receiver operating characteristic curve (ROC) of miR-Chr8:96 for distinguishing acute myocarditis from myocardial infarction was 0.927, and the correlation was still valid after adjusting factors such as age, gender, ejection fraction, and troponin level. These results indicate that miR-Chr8:96 is a specific blood marker for acute myocarditis.

[0004] Common methods for detecting miRNAs include Northern blotting, real-time quantitative RT-PCR (qRT-PCR), and microarray. Among them, the Northern blotting method has complicated operation steps, is time-consuming, and has low detection sensitivity; the advantage of the microarray method is high throughput, but the detection sensitivity is low and it is non-quantitative; the advantage of qRT-PCR is high detection sensitivity, but it requires reverse transcription and amplification of miRNA signals, which has poor selectivity, is time-consuming, and has complex result analysis processes. At present, many new miRNAs detection methods have emerged, such as electrochemical detection, optical sensor detection, bioluminescence detection, high-throughput sequencing detection, etc., which can partially achieve sensitive detection of miRNAs; but they all require specific instruments, and the detection process is complicated, resulting in the need to improve the stability and reliability of the detection system, and cannot meet the requirements for detecting miRNAs in blood samples.

[0005] Therefore, it is necessary to develop a simple, direct, rapid, highly sensitive and quantitative method for detecting miRNAs to quantitatively detect the content of miR-Chr8:96, a specific blood marker for acute myocarditis, in the blood. Summary of the invention

[0006] In view of the above-mentioned deficiencies in the prior art, the present invention provides a miR-Chr8:96 detection kit and a detection method thereof, which can perform simple, rapid and quantitative detection of the miR-Chr8:96 content in a blood sample.

[0007] The technical solution of the present invention is as follows:

[0008] A miR-Chr8:96 detection kit, comprising: a miR-Chr8:96 calibrator, ssDNA, a reagent R1, a reagent R2 and an RNA extraction kit; wherein the ssDNA end is labeled with biotin, the reagent R1 contains RNA / DNA antibody-AE, and the reagent R2 contains streptavidin-magnetic particles.

[0009] The miR-Chr8:96 detection kit, wherein the miR-Chr8:96 calibrator is an artificially synthesized miR-Chr8:96 RNA, and the nucleotide sequence is shown in SEQ ID NO.1.

[0010] In the miR-Chr8:96 detection kit, the ssDNA is an artificially synthesized single-stranded DNA, and the nucleotide sequence is complementary to the miR-Chr8:96 nucleotide sequence, and the nucleotide sequence is shown in SEQ ID NO.2.

[0011] In the miR-Chr8:96 detection kit, the 3' or 5' end of the ssDNA is labeled with biotin, and TA nucleotides are added to the biotin-labeled end.

[0012] The miR-Chr8:96 detection kit, wherein the preparation method of the RNA / DNA antibody-AE is:

[0013] Providing RNA / DNA antibodies and adjusting them to a predetermined concentration;

[0014] Dissolve Acridinium NHS ester in dimethylformamide to a predetermined concentration;

[0015] reacting the RNA / DNA antibody with Acridinium NHS ester;

[0016] After the reaction is terminated, free Acridinium NHS ester is removed to obtain purified RNA / DNA antibody-AE.

[0017] A method for detecting miR-Chr8:96, wherein the detection method is based on any of the miR-Chr8:96 detection kits described above, comprising the steps of:

[0018] 1.1 Isolate RNA from the sample to be tested;

[0019] 1.2 mixing the RNA with ss DNA to form an RNA / DNA hybrid chain;

[0020] 1.3 Add the RNA / DNA hybrid chain and reagents R1 and R2 into a reaction cup and react for a predetermined time to form an AE-RNA / DNA antibody-RNA / DNA-Biotin-SMP complex;

[0021] 1.4 adsorbing the complex to the bottom of the reaction cup, adding a washing solution for washing, and then removing the washing solution;

[0022] 1.5 Add pre-stimulation solution to dissociate the complex and release RNA / DNA antibody-AE;

[0023] 1.6 Add excitation solution to activate the luminescence reaction process of the system;

[0024] 1.7 Determine the luminescence intensity value and analyze the content of miR-Chr8:96 in the sample to be tested.

[0025] The miR-Chr8:96 detection method further includes establishing a miR-Chr8:96 concentration standard curve, and the specific steps are as follows:

[0026] Prepare miR-Chr8:96 calibrator and set the concentration gradient of miR-Chr8:96 calibrator;

[0027] The miR-Chr8:96 calibrator was mixed with ss DNA and reacted at 55° C. for 2-10 min to obtain a calibrator RNA / DNA hybrid chain;

[0028] The calibrator RNA / DNA hybrid chain and reagents R1 and R2 are added to a reaction cup and reacted for 5-20 minutes to obtain a calibrator AE-RNA / DNA antibody-RNA / DNA-Biotin-SMP complex;

[0029] After washing the calibrator SMP complex, activating the luminescence program, and detecting the luminescence intensity of the system to obtain the relative luminescence value unit of the miR-Chr8:96 calibrator;

[0030] A miR-Chr8:96 concentration standard curve was established with the concentration of the miR-Chr8:96 calibrator as the ordinate and the relative luminescence value unit of the miR-Chr8:96 calibrator as the abscissa.

[0031] The miR-Chr8:96 detection method, wherein the concentration gradient of the miR-Chr8:96 calibrator is 0, 250, 500, 1000, 2000, and 4000 fmol / L.

[0032] The miR-Chr8:96 detection method, wherein a CLIA analyzer miR-Chr8:96 concentration detection system is established based on the miR-Chr8:96 concentration standard curve, which is used to detect the miR-Chr8:96 content in the sample to be tested.

[0033] An application of a miR-Chr8:96 detection kit, characterized in that the miR-Chr8:96 detection kit as described above is applied to the detection of miR-Chr8:96 content in plasma, serum, urine, tissue fluid, and milk samples.

[0034] Beneficial effects: The present invention provides a miR-Chr8:96 detection kit and a detection method thereof. The miR-Chr8:96 detection kit comprises a miR-Chr8:96 calibrator, ssDNA, reagent R1, reagent R2 and an RNA extraction kit; wherein the ssDNA end is labeled with biotin, the reagent R1 contains RNA / DNA antibody-AE, and the reagent R2 contains streptavidin-magnetic particles. Based on the miR-Chr8:96 detection kit, the present invention establishes an operating procedure for detecting the content of miR-Chr8:96 by chemiluminescence immunoassay (CLIA), which is used to detect the content of miR-Chr8:96 in plasma, serum, urine, tissue fluid, and milk samples. The miR-Chr8:96 detection kit provided by the present invention can use a fully automatic chemiluminescence analyzer to perform quantitative automatic detection of miR-Chr8:96 in a sample, and the operation process is mature and simple, the detection time is short, the sensitivity is high, the specificity is strong, the economic cost is low, and it is widely used. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The miR-Chr8:96 concentration standard curve obtained by measuring the miR-Chr8:96 calibrator with the CLIA detection kit provided in the embodiment of the present invention. The horizontal axis is RLU×10 4 The vertical axis is the miR-Chr8:96 RNA concentration value in the miR-Chr8:96 calibrator, the unit is fmol / L. DETAILED DESCRIPTION

[0036] The present invention provides a miR-Chr8:96 detection kit and a detection method thereof. To make the purpose, technical solution and effect of the present invention clearer and more specific, the present invention is further described in detail below. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0037] An embodiment of the present invention provides a miR-Chr8:96 detection kit, comprising: a miR-Chr8:96 calibrator, ssDNA, a reagent R1, a reagent R2, and an RNA extraction kit; wherein the ssDNA end is labeled with biotin, the reagent R1 contains RNA / DNA antibody-AE (Acridinium ester), and the reagent R2 contains streptavidin-magnetic particles (SMP).

[0038] In some embodiments, the miR-Chr8:96 calibrator is an artificially synthesized miR-Chr8:96 RNA, and the nucleotide sequence is shown in SEQ ID NO.1:

[0039] SEQ ID NO.1

[0040] UCUUGCAAUUAAAAGGGGGAA

[0041] In some embodiments, the ssDNA is an artificially synthesized single-stranded DNA, and the nucleotide sequence is complementary to the miR-Chr8:96 nucleotide sequence, and the nucleotide sequence is shown in SEQ ID NO.2:

[0042] SEQ ID NO.2

[0043] TTCCCCCTTTTAATTGCAAGATA

[0044] In some embodiments, the 3' or 5' end of the ssDNA is labeled with biotin.

[0045] In some embodiments, the biotin-labeled end of the ssDNA is supplemented with TA nucleotides, which can highlight the biotin labeled at the 3' or 5' end of the ssDNA after hybridization with the corresponding RNA, which is conducive to binding streptavidin, and a stronger signal can be obtained during the final detection.

[0046] Specifically, the 3' end of the ssDNA is labeled with biotin, and a TA nucleotide is added to the end. Its sequence is as follows: TTCCCCCTTTTAATTGCAAGATA-biotin

[0047] Specifically, the ssDNA is dissolved in a hybridization solution to prepare an ssDNA hybridization solution, wherein the hybridization solution has a formula of: 20 mM Tris (pH=7.5), 150 mM NaCl, 1.0 mM EDTA, and 5.0 mM MgCl2.

[0048] In some embodiments, the ssDNA concentration in the ssDNA hybridization solution is 2-10 pmol / L. A strong signal can be finally obtained within the above concentration range. The embodiment of the present invention has been verified and the final preferred concentration is 5 pmol / L.

[0049] In other embodiments, the miR-Chr8:96 detection kit further comprises artificially synthesized miR-133a-5p RNA, and the miR-133a-5p RNA is used as a control substance, and its nucleotide sequence is shown in SEQ ID NO.3:

[0050] SEQ ID NO.3

[0051] AGCUGGUAAAAUGGAACCAAAT

[0052] In some embodiments, the miR-Chr8:96 calibrator provided in the miR-Chr8:96 detection kit has a concentration of 0-4000 fmol / L.

[0053] In some embodiments, the reagent R1 contains RNA / DNA antibody-AE.

[0054] In some specific embodiments, the reagent R1 contains 10-50 ng / mL RNA / DNA antibody-AE. The above concentration range can meet the detection requirements of low or high concentration miR-Chr8:96. The embodiment of the present invention has been verified and the final preferred concentration is 25 ng / mL.

[0055] In some embodiments, the preparation method of the RNA / DNA antibody-AE is:

[0056] S10, providing RNA / DNA antibodies and adjusting them to a predetermined concentration;

[0057] S20, dissolving Acridinium NHS ester to a predetermined concentration using dimethylformamide;

[0058] S30, reacting the RNA / DNA antibody with Acridinium NHS ester;

[0059] S40. After the reaction is terminated, free Acridinium NHS ester is removed to obtain purified RNA / DNA antibody-AE.

[0060] Specifically, in step S10, the RNA / DNA antibody is adjusted to a concentration of 100-5000 ng / mL using PBS at pH=7.0, preferably 1.0 mg / ml.

[0061] Specifically, in step S20, dimethylformamide (DMF) is used to adjust the concentration of Acridinium NHS ester to 1-10 mg / mL, preferably 4.0 mg / ml.

[0062] Specifically, after step S40, the purified RNA / DNA antibody-AE can be placed at 2-8° C. for storage.

[0063] In some embodiments, the reagent R2 contains streptavidin-magnetic particles.

[0064] In some specific embodiments, the reagent R2 contains 0.1-0.5% streptavidin-magnetic particles. The embodiment of the present invention has been verified and found that when 0.1% SMP detects 5000fmol / L miR-Chr8:96, a lower RLU is obtained, while when 0.2% SMP detects 1000 and 5000fmol / L miR-Chr8:96, satisfactory results can be obtained. Therefore, 0.2% is preferably the SMP concentration in the reagent R2.

[0065] In some specific embodiments, the streptavidin-magnetic particles (SMP) have a diameter of 3.0 μm.

[0066] In some specific embodiments, the RNA extraction kit is a conventional RNA extraction kit, which can be used to extract RNA from serum, plasma, urine, tissue fluid, and milk samples.

[0067] The embodiment of the present invention also provides a method for detecting miR-Chr8:96, comprising the steps of:

[0068] S100, separating RNA from the sample to be tested;

[0069] S200, mixing the RNA with ss DNA to form an RNA / DNA hybrid chain;

[0070] S300, adding the RNA / DNA hybrid chain and reagents R1 and R2 into a reaction cup and reacting for a predetermined time to form an AE-RNA / DNA antibody-RNA / DNA-Biotin-SMP complex;

[0071] S400, adsorbing the complex to the bottom of the reaction cup, adding a washing solution for washing, and then removing the washing solution;

[0072] S500, adding a pre-stimulation solution to dissociate the complex and release the RNA / DNA antibody-AE;

[0073] S600, adding an excitation solution to activate the luminescence reaction process of the system;

[0074] S700, determine the luminescence intensity value and analyze the content of miR-Chr8:96 in the sample to be tested.

[0075] In some embodiments, the above detection method is based on the miR-Chr8:96 detection kit described above.

[0076] Chemiluminescence Immunoassay (CLIA) combines highly sensitive chemiluminescence technology with highly specific immune reactions, and has the advantages of high sensitivity, strong specificity, wide linear range, and simple operation. It is widely used in the detection of marker content in blood, urine, tissue fluid, and milk samples. The embodiment of the present invention combines CLIA with a miR-Chr8:96 detection kit, and establishes an operating procedure for a CLIA detection kit for miR-Chr8:96, which is used to detect the level of miR-Chr8:96 in blood, urine, tissue fluid, and milk samples.

[0077] In some specific embodiments, in step S200, the RNA and ss DNA are mixed and reacted at 50-65° C. for 2-10 minutes to form an RNA / DNA hybrid chain. Preferably, the reaction time is 5 minutes.

[0078] Specifically, the volume of the RNA is 5-50 μl; the ss DNA is dissolved in the hybridization solution to form an ss DNA hybridization solution with a concentration of 2000-10000 fmol / L and a volume of 10-100 μl. It should be noted that the above volume is a reasonable setting based on the volume of the reaction cup in the embodiment of the present invention and should not be considered as a limitation of the present invention. Those skilled in the art can make appropriate adjustments according to actual conditions.

[0079] In some specific embodiments, in step S300, the predetermined time is 5-20 minutes. The embodiment of the present invention has been verified and found that when the RNA / DNA / reagent R1 / R2 reaction time is 5 minutes, a lower RLU signal is obtained, and when the RNA / DNA / reagent R1 / R2 reaction time is 20 minutes, there is no obvious increase in RLU. When the RNA / DNA / reagent R1 / R2 reaction time is 10 minutes, a higher RLU is obtained. Therefore, the preferred RNA / DNA / reagent R1 / R2 reaction time is 10 minutes.

[0080] Specifically, the volume of the reagent R1 is 10-100 μl, and the volume of the reagent R2 is 10-100 μl.

[0081] In some specific embodiments, in step S400, the obtained SMP complex can be adsorbed to the bottom of the reaction cup by a magnet, and free RNA / DNA antibody-AE or impurities can be removed. The SMP complex contains streptavidin-magnetic particles (Streptavidin-Magnetic Particles, SMP), which can be adsorbed by a magnet; while free antibodies or impurities are not adsorbed and can be easily removed.

[0082] In some specific embodiments, in step S400, the washing solution formula is: 50mM NaPO4 (pH=7.4), 500mM NaCl, 0.1% TritonX100, 0.02% ProClin300.

[0083] In some specific embodiments, in step S500, the pre-excitation liquid is H2O2 or Nitric acid.

[0084] In some specific embodiments, in step S600, the excitation solution is NaOH. After the NaOH excitation solution is added, the luminescence reaction process of the Acridinium-H2O2-NaOH system is started.

[0085] In some specific implementations, in step S700, a wavelength of 430 nm is selected to measure the luminous intensity value.

[0086] In some embodiments, the miR-Chr8:96 detection method further includes the step of establishing a miR-Chr8:96 concentration standard curve.

[0087] In some specific embodiments, the step of establishing a miR-Chr8:96 concentration standard curve is:

[0088] S1000, preparing miR-Chr8:96 calibrators and setting a concentration gradient of the miR-Chr8:96 calibrators;

[0089] S2000, mixing the miR-Chr8:96 calibrator with ss DNA, reacting at 55° C. for 2-10 min to obtain a calibrator RNA / DNA hybrid chain;

[0090] S3000, adding the calibrator RNA / DNA hybrid chain and reagents R1 and R2 into a reaction cup and reacting for 5-20 minutes to obtain a calibrator AE-RNA / DNA antibody-RNA / DNA-Biotin-SMP complex;

[0091] S4000, after washing the calibrator SMP complex, activating the luminescence program, and detecting the luminescence intensity of the system to obtain the relative luminescence value unit of the miR-Chr8:96 calibrator;

[0092] S5000. Establish a miR-Chr8:96 concentration standard curve with the concentration of the miR-Chr8:96 calibrator as the ordinate and the relative luminescence value unit of the miR-Chr8:96 calibrator as the abscissa.

[0093] Specifically, the concentration gradient of the miR-Chr8:96 calibrator is 0, 250, 500, 1000, 2000, and 4000 fmol / L.

[0094] Specifically, in step S2000, the volume of the miR-Chr8:96 calibrator is 5-50 μl; the ss DNA is dissolved in the hybridization solution to form an ss DNA hybridization solution with a concentration of 2000-10000 fmol / L and a volume of 10-100 μl.

[0095] Specifically, in step S3000, the volume of the reagent R1 is 10-100 μl, and the volume of the reagent R2 is 10-100 μl.

[0096] It should be noted that the above volume is a reasonable setting based on the volume of the reaction cup in the embodiment of the present invention, and should not be considered as a limitation of the present invention. Those skilled in the art can make appropriate adjustments according to actual conditions.

[0097] In some embodiments, after establishing a standard curve for miR-Chr8:96 concentration, a CLIA analyzer system for detecting the concentration of miR-Chr8:96 in a sample is established based on the standard curve.

[0098] The embodiment of the present invention also provides an application of a miR-Chr8:96 detection kit, which is used to detect the content of miR-Chr8:96 in plasma, serum, urine, tissue fluid, and milk samples.

[0099] In some embodiments, the miR-Chr8:96 detection kit can also be used to detect the content of miR-Chr8:96 in other body fluids or tissue samples.

[0100] The miR-Chr8:96 detection kit provided in the embodiment of the present invention can use a fully automatic chemiluminescence analyzer to perform quantitative automatic detection of miR-Chr8:96 in a sample. The operation process is mature and simple, the detection time is short, the sensitivity is high, the specificity is strong, the economic cost is low, and the application is wide.

[0101] The following is a further explanation of a miR-Chr8:96 detection kit and a detection method thereof of the present invention through specific examples:

[0102] Example 1 Preparation of CLIA Kit for Detecting miR-Chr8:96

[0103] The CLIA miR-Chr8:96 detection kit contains miR-Chr8:96 calibrator, ssDNA solution, reagent R1, reagent R2, and an additional RNA extraction kit.

[0104] (1) Preparation of miR-Chr8:96 calibrator

[0105] 1. Synthesize miR-Chr8:96 RNA as miR-Chr8:96 calibrator, the nucleotide sequence of which is shown in SEQ ID NO.1: UCUUGCAAUUAAAAGGGGGAA

[0106] 2. Synthesize miR-133-5p RNA as miRNA reference, the nucleotide sequence of which is shown in SEQ ID NO.3: AGCUGGUAAAAUGGAACCAAAT

[0107] (2) Preparation of ssDNA solution

[0108] 1. Synthesize ssDNA, the nucleotide sequence is shown in SEQ ID NO.2:

[0109] TTCCCCCTTTTAATTGCAAGATA

[0110] 2. ssDNA-3' end labeling with Biotin

[0111] 3. Addition of TA nucleotides to the 3' end of ssDNA

[0112] 4. Prepare hybridization solution: 20mM Tris (pH=7.5), 150mM NaCl, 1.0mM EDTA, 5.0mM MgCl2

[0113] 5. Prepare ssDNA solution and add ssDNA-3'-Biotin to the hybridization solution at a concentration of 2-10pmol / L.

[0114] (3) Preparation of reagent R1

[0115] 1. RNA / DNA antibody, purchased from Kerafast Inc., diluted to a concentration of 1.0 mg / ml with PBS (pH=7.0);

[0116] 2. Acridinium NHS ester, purchased from AAT Bioquest, 1.0 mg was dissolved in 250 μl DMF to obtain 4 mg / ml Acridinium NHS ester solution;

[0117] 3. Mix 0.5 ml RNA / DNA antibody with 20 μl Acridinium NHS ester solution and react at room temperature for 30 minutes;

[0118] 4. Add 20 μl 2.0 M Glycine, react at room temperature for 15 minutes, and then terminate the reaction;

[0119] 5. Dialyze the RNA / DNA antibody-AE solution obtained in the previous step with PBS (pH=7.4); dialysis at 4°C, protected from light, and replace PBS 3 times in the middle;

[0120] 6. Collect RNA / DNA antibody-AE liquid and determine the RNA / DNA antibody-AE concentration;

[0121] 7. Prepare R buffer, the formula is: 20mM NaPO4 (pH=7.0), 100mM NaCl, 0.5% BSA, 1.0% Sucrose, 0.1% PVP, 0.01% Tween-20, 0.03% ProClin300;

[0122] 8. Dilute the RNA / DNA antibody-AE to a concentration of 10-50 ng / ml with R buffer to form reagent R1, and then place at 2-8°C for storage.

[0123] (4) Preparation of reagent R2

[0124] Streptavidin-Magnetic Particles (SMP) with a diameter of 3.0 μm were purchased from Spherotech. The SMP concentration was diluted to 0.1-0.5% with R buffer to form reagent R2, which was then placed at 2-8° C. for storage.

[0125] Example 2 Establishment of CLIA Detection Procedures for miR-Chr8:96

[0126] 1. Mix 10 μl RNA sample with 40 μl ssDNA solution, react at 55°C for 2-10 minutes, and then slowly cool to room temperature;

[0127] 2. Take 50 μl of the mixture from the previous step and add it to the reaction cup of the CLIA analyzer;

[0128] 3. Add 50 μl of reagent R1 and 25 μl of reagent R2 to the reaction cup in sequence, react at 37°C for 5-20 minutes to form an AE-RNA / DNA antibody-RNA / DNA-Biotin-SMP complex, which is adsorbed to the bottom surface of the reaction cup by a magnet;

[0129] 4. Remove free RNA / DNA antibody-AE and other impurities;

[0130] 5. Wash the SMP complex with a washing solution (50 mM NaPO4 (pH = 7.4), 500 mM NaCl, 0.1% TritonX-100, 0.02% ProClin300), and then remove the washing solution;

[0131] 6. Add H2O2 pre-stimulation solution (1.25% H2O2, 0.1N Nitric acid) to dissociate the SMP complex and release RNA / DNA antibody-AE;

[0132] 7. Add NaOH excitation solution (0.25M NaOH) to start the luminescence reaction process of the Acridinium-H2O2-NaOH system and measure the relative luminescence unit (RLU) at a wavelength of 430nm.

[0133] Example 3 Effects of different miRNAs on CLIA detection results of miR-Chr8:96

[0134] The CLIA kit for detecting miR-Chr8:96 described in Example 1 was used, and the CLIA procedure for detecting miR-Chr8:96 described in Example 2 was used to detect different miRNAs.

[0135] (1) Reagents

[0136] miR-Chr8:96 calibrator: concentrations of 200, 1000, and 5000 fmol / L

[0137] miR-133-5p RNA control: concentrations of 200, 1000, and 5000 fmol / L

[0138] miR-Chr8:96 / miR-133-5p mixed solution: concentrations of 200 / 200, 1000 / 1000, 5000 / 5000 fmol / L

[0139] ssDNA solution: ssDNA concentration is 5pmol / L

[0140] Reagent R1: RNA / DNA Antibody-AE concentration is 25ng / ml

[0141] Reagent R2: SMP concentration is 0.2%

[0142] (2) Operation process

[0143] RNA and ssDNA hybridization time: 55°C, 5 minutes

[0144] RNA / DNA / reagent R1 / R2 reaction time: 10 minutes

[0145] (3) Test results

[0146] Table 1a. RLU detection results of miR-Chr8:96 calibrator

[0147]

[0148]

[0149] Table 1b. RLU detection results of miR-133-5p control

[0150]

[0151] Table 1c. RLU detection results of miR-Chr8:96 / miR-133-5p mixed solution

[0152]

[0153] It can be seen from Table 1a, Table 1b and Table 1c that the CLIA detection of miR-Chr8:96 kit established in the present invention can specifically detect miR-Chr8:96 and is not affected by miR-133-5p.

[0154] Example 4 Effect of ssDNA on CLIA Detection Results of miR-Chr8:96

[0155] The CLIA kit for detecting miR-Chr8:96 described in Example 1 and the CLIA procedure for detecting miR-Chr8:96 described in Example 2 were used to observe the effects of different ssDNA on the results of CLIA detection of miR-Chr8:96.

[0156] (1) Reagents

[0157] Synthesize ssDNA-dTA: The nucleotide sequence is complementary to the miR-Chr8:96 nucleotide sequence, the 3' end is labeled with Biotin, and there is no TA nucleotide; its sequence is as follows:

[0158] TTCCCCCTTTTAATTGCAAGA-Biotin

[0159] miR-Chr8:96 calibrator: concentration 1000fmol / L

[0160] ssDNA solution: ssDNA concentrations are 2, 5, and 10 pmol / L respectively

[0161] ssDNA-dTA solution: ssDNA-dTA concentrations are 2, 5, and 10 pmol / L respectively

[0162] Reagent R1: RNA / DNA Antibody-AE concentration is 25ng / ml

[0163] Reagent R2: SMP concentration is 0.2%

[0164] (2) Operation process

[0165] RNA and ssDNA hybridization time: 55°C, 5 minutes

[0166] RNA / DNA / reagent R1 / R2 reaction time: 10 minutes

[0167] (3) Test results

[0168] Table 2a. RLU detection results of ssDNA-3' end with TA

[0169]

[0170] Table 2b. RLU detection results of ssDNA-dTA-3' end without TA

[0171]

[0172] From the results in Table 2a and Table 2b, it can be seen that compared with ssDNA-dTA, ssDNA obtains a stronger signal; at the same time, 5 pmol / L ssDNA and 10 pmol / L ssDNA can both obtain strong signals, and 5 pmol / L ssDNA was further selected as the ideal condition.

[0173] Example 5 Effect of RNA / DNA Antibody-AE Concentration on CLIA Detection Results of miR-Chr8:96

[0174] Using the CLIA kit for detecting miR-Chr8:96 described in Example 1 and the CLIA procedure for detecting miR-Chr8:96 described in Example 2, the effects of different RNA / DNA antibody-AE concentrations on the results of CLIA detection of miR-Chr8:96 were observed.

[0175] (1) Reagents

[0176] miR-Chr8:96 calibrator: concentrations of 500 and 5000 fmol / L

[0177] ssDNA solution: ssDNA concentration is 5pmol / L

[0178] Reagent R1: RNA / DNA antibody-AE concentrations of 10, 25, and 50 ng / ml

[0179] Reagent R2: SMP concentration is 0.2%

[0180] (2) Operation process

[0181] RNA and ssDNA hybridization time: 55°C, 5 minutes

[0182] RNA / DNA / reagent R1 / R2 reaction time: 10 minutes

[0183] (3) Test results

[0184] Table 3a. RLU detection results of different RNA / DNA antibody-AE concentrations at low concentration of miR-Chr8:96

[0185]

[0186] The concentration of miR-Chr8:96 calibrator is 500 fmol / L

[0187] Table 3b. RLU detection results of different RNA / DNA antibody-AE concentrations at high concentration of miR-Chr8:96

[0188]

[0189] The concentration of miR-Chr8:96 calibrator is 5000fmol / L

[0190] From the results in Table 3a and Table 3b, it can be seen that 25 ng / ml RNA / DNA antibody-AE can meet the requirements for detecting 500 and 5000 fmol / L miR-Chr8:96 calibrators, so 25 ng / ml concentration is selected as the RNA / DNA antibody-AE concentration in reagent R1.

[0191] Example 6 Effect of SMP concentration on CLIA detection results of miR-Chr8:96

[0192] The CLIA kit for detecting miR-Chr8:96 described in Example 1 and the CLIA procedure for detecting miR-Chr8:96 described in Example 2 were used to observe the effect of different SMP concentrations on the results of CLIA detection of miR-Chr8:96.

[0193] (1) Reagents

[0194] miR-Chr8:96 calibrator: concentrations of 1000 and 5000 fmol / L

[0195] ssDNA solution: ssDNA concentration is 5pmol / L

[0196] Reagent R1: RNA / DNA Antibody-AE concentration is 25ng / ml

[0197] Reagent R2: SMP concentrations of 0.1, 0.2, and 0.5%

[0198] (2) Operation process

[0199] RNA and ssDNA hybridization time: 55°C, 5 minutes

[0200] RNA / DNA / reagent R1 / R2 reaction time: 10 minutes

[0201] (3) Test results

[0202] Table 4a. RLU detection results of different SMP concentrations at low concentration of miR-Chr8:96

[0203]

[0204] The concentration of miR-Chr8:96 calibrator is 1000fmol / L

[0205] Table 4b. RLU detection results of different SMP concentrations at high concentration of miR-Chr8:96

[0206]

[0207] The concentration of miR-Chr8:96 calibrator is 5000fmol / L

[0208] The results in Table 4a and Table 4b show that when 0.1% SMP was used to detect 5000fmol / L miR-Chr8:96 calibrator, a lower RLU was obtained, while when 0.2% SMP was used to detect 1000 and 5000fmol / L miR-Chr8:96 calibrator, satisfactory results were obtained. Therefore, 0.2% concentration was selected as the SMP concentration in reagent R2.

[0209] Example 7 Effect of reaction conditions on CLIA detection results of miR-Chr8:96

[0210] The CLIA kit for detecting miR-Chr8:96 described in Example 1 and the CLIA procedure for detecting miR-Chr8:96 described in Example 2 were used to observe the effects of different reaction conditions on the results of CLIA detection of miR-Chr8:96.

[0211] (1) Reagents

[0212] miR-Chr8:96 calibrator: concentrations of 1000 and 5000 fmol / L

[0213] ssDNA solution: ssDNA concentration is 5pmol / L

[0214] Reagent R1: RNA / DNA Antibody-AE concentration is 25ng / ml

[0215] Reagent R2: SMP concentration is 0.2%

[0216] (2) Reaction Condition 1

[0217] RNA and ssDNA hybridization time: 55°C, 2, 5, 10 minutes

[0218] RNA / DNA / reagent R1 / R2 reaction time: 10 minutes

[0219] Test results

[0220] Table 5a. RLU detection results of different RNA / DNA hybridization times at low concentrations of miR-Chr8:96

[0221]

[0222] The concentration of miR-Chr8:96 calibrator is 1000fmol / L

[0223] Table 5b. RLU detection results of different RNA / DNA hybridization times at high concentrations of miR-Chr8:96

[0224]

[0225] The concentration of miR-Chr8:96 calibrator is 5000fmol / L

[0226] From the results in Table 5a and Table 5b, it can be seen that sufficient signals can be obtained when the RNA / DNA hybridization time is 5 minutes, so the RNA / DNA hybridization time is selected to be 5 minutes.

[0227] (3) Reaction Condition 2

[0228] RNA and ssDNA hybridization time: 55°C, 5 minutes

[0229] RNA / DNA / reagent R1 / R2 reaction time: 5, 10, 20 minutes

[0230] Test results

[0231] Table 6a. RLU detection results of different RNA / DNA / reagent R1 / R2 reaction times at low concentration of miR-Chr8:96

[0232]

[0233] The concentration of miR-Chr8:96 calibrator is 1000fmol / L

[0234] Table 6b. RLU detection results of different RNA / DNA / reagent R1 / R2 reaction times at high concentration of miR-Chr8:96

[0235]

[0236] The concentration of miR-Chr8:96 calibrator is 5000fmol / L

[0237] From the results of Table 6a and Table 6b, it can be seen that when the reaction time of RNA / DNA / reagent R1 / R2 is 5 minutes, a lower RLU signal is obtained; when the reaction time of RNA / DNA / reagent R1 / R2 is 20 minutes, there is no obvious increase in RLU; when the reaction time of RNA / DNA / reagent R1 / R2 is 10 minutes, a higher RLU is obtained. Therefore, the reaction time of RNA / DNA / reagent R1 / R2 is determined to be 10 minutes.

[0238] Example 8 Preparation of miR-Chr8:96 concentration standard curve

[0239] 1. Preparation of miR-Chr8:96 Calibrator Concentration Gradient

[0240] Take 6 centrifuge tubes and number them in sequence (A5-A0); first add 450μl H2O to the first centrifuge tube (A5), and add 200μl H2O to the remaining tubes (A4-A0); then take 50μl of miR-Chr8:96 calibrator with a concentration of 40pmol / L and add it to the A5 centrifuge tube, mix well; take 200μl from A5 and add it to the A4 centrifuge tube, mix well; take 200μl from A4 and add it to the A3 centrifuge tube, mix well; take 200μl from A3 and add it to the A2 centrifuge tube, mix well; take 200μl from A2 and add it to the A1 centrifuge tube, mix well; the A0 test tube only contains H2O for blank well control. That is, the concentration gradient of miR-Chr8:96 calibrator is 0, 250, 500, 1000, 2000, 4000fmol / L.

[0241] 2. Reaction of miR-Chr8:96 calibrator with ssDNA solution

[0242] Take 10 μl of miR-Chr8:96 calibrator and mix it with 40 μl of ssDNA solution (ssDNA concentration is 5 pmol / L), react at 55°C for 5 minutes, and slowly cool to room temperature.

[0243] 3. Take 50 μl of the mixed solution and add it to the reaction cup, and then add 50 μl of reagent R1 (RNA / DNA antibody-AE concentration is 25 ng / ml) and 25 μl of reagent R2 (SMP concentration is 0.2%) to the reaction cup in turn, react at 37°C for 10 minutes to obtain AE-RNA / DNA antibody-RNA / DNA-Biotin-SMP complex.

[0244] 4. Wash the SMP composite with a washing solution, and then remove the washing solution by suction.

[0245] 5. Add H2O2 pre-stimulation solution to dissociate the SMP complex and release RNA / DNA antibody-AE.

[0246] 6. Add NaOH excitation solution to start the luminescence reaction process of the Acridinium-H2O2-NaOH system and measure the RLU. The results are shown in Table 7:

[0247] Table 7 Concentration gradient miR-Chr8:96 calibrator RLU

[0248]

[0249] 7. Preparation of miR-Chr8:96 concentration standard curve

[0250] The miR-Chr8:96 concentration standard curve was prepared with the miR-Chr8:96 calibrator concentration as the ordinate and the RLU of the miR-Chr8:96 RNA calibrator as the abscissa. Figure 1 As shown. The horizontal axis is RLU×10 4 , the ordinate is the miR-Chr8:96 RNA concentration in the miR-Chr8:96 calibrator, in fmol / L. y = 25.227x–326.78, R 2 =0.9909.

[0251] 8. Based on the miR-Chr8:96 concentration standard curve, a CLIA analyzer system for detecting miR-Chr8:96 concentration was established to further detect the miR-Chr8:96 concentration in human plasma, serum, urine, tissue fluid, and milk samples.

[0252] Example 9 Extraction of RNA from the sample to be tested

[0253] The present invention uses miRNeasy Serum / Plasma Advanced Kit purchased from QIAGEN to extract RNA from the sample to be tested.

[0254] 1. Collect the sample to be tested (such as plasma) and take 200 μl of plasma into a 1.5 ml centrifuge tube;

[0255] 2. Add 60 μl Buffer RPL to the centrifuge tube in the previous step, shake for 5 seconds, and leave at room temperature for 3 minutes;

[0256] 3. Add 20 μl Buffer RPP to the centrifuge tube in the previous step, shake for 20 seconds, and place at room temperature for 3 minutes

[0257] 4. Centrifuge at 12000g for 3 minutes at room temperature;

[0258] 5. Take about 230 μl of supernatant, transfer to a new 1.5 ml centrifuge tube, add 230 μl of isopropanol, and shake to mix;

[0259] 6. Transfer the liquid in the centrifuge tube in the previous step to the RNeasy UCP MinElute column and centrifuge at 8000g for 15 seconds;

[0260] 7. Remove the flow-through, add 700 μl Buffer RWT to the RNeasy UCP MinElute column, and centrifuge at 8000 g for 15 seconds;

[0261] 8. Remove the effluent, add 500 μl Buffer RPE to the RNeasy UCP MinElute column, and centrifuge at 8000 g for 15 seconds;

[0262] 9. Remove the flow-through, add 500 μl 80% ethanol to the RNeasy UCP MinElute column, and centrifuge at 8000 g for 15 seconds;

[0263] 10. Place the RNeasy UCP MinElute column into a new collection tube and centrifuge at 13,000 rpm for 5 minutes;

[0264] 11. Place the RNeasy UCP MinElute column in a new 1.5 ml centrifuge tube and add 25 μl of H2O to the center of the column;

[0265] 12. After standing for 1 minute, centrifuge at 13000 rpm for 1 minute;

[0266] 13. Collect the liquid in the centrifuge tube and measure the RNA concentration in the liquid.

[0267] Example 10 Detecting the content of miR-Chr8:96 in the sample to be tested

[0268] Based on the reagents, concentrations, reaction steps, reaction conditions, etc. determined in Examples 1-9, the content of miR-Chr8:96 in artificial plasma and plasma samples was detected.

[0269] (1) Determination of miRNA concentrations in artificial plasma

[0270] 1. Preparation of artificial plasma samples

[0271] Artificially synthesized miR-Chr8:96 RNA was added to human plasma to form miR-Chr8:96 artificial plasma, containing miR-Chr8:96 at concentrations of 0, 250, 1000, and 4000 fmol / L, respectively;

[0272] Artificially synthesized miR-133-5p RNA was added to human plasma to form miR-133-5p artificial plasma, containing miR-133-5p at concentrations of 0, 250, 1000, and 4000 fmol / L, respectively;

[0273] 2. Extraction of RNA from artificial plasma

[0274] 200 μl of the artificial plasma was taken respectively, and RNA in the artificial plasma was extracted using miRNeasy Serum / Plasma Advanced Kit.

[0275] 3. Based on the aforementioned CLIA detection method for miR-Chr8:96, the concentrations of miR-Chr8:96 and miR-133-5p in artificial plasma were detected, respectively. The results are shown in Table 8a-b below:

[0276] Table 8a. Results of detection of miR-Chr8:96 concentration in artificial plasma

[0277]

[0278] Table 8b. Results of detection of miR-133-5p concentration in artificial plasma

[0279]

[0280]

[0281] As can be seen from Tables 8a-8b, the established CLIA procedure for detecting miR-Chr8:96 can specifically detect and quantify miR-Chr8:96, but cannot effectively detect the content of miR-133-5p.

[0282] (2) Determination of miR-Chr8:96 concentration in plasma

[0283] 1. Extraction of RNA from plasma

[0284] Take 200 μl of plasma and use miRNeasy Serum / Plasma Advanced Kit to extract RNA from artificial plasma.

[0285] 2. Based on the above CLIA detection method of miR-Chr8:96, the concentration of miR-Chr8:96 in plasma was detected. The results are shown in Table 9 below:

[0286]

[0287] As shown in Table 9, the CLIA detection procedure for miR-Chr8:96 established in the embodiment of the present invention can accurately quantify the concentration of miR-Chr8:96 in samples such as plasma, with a sensitivity of 10 -15 mol / L.

[0288] In summary, the present invention provides a miR-Chr8:96 detection kit and a detection method thereof. The miR-Chr8:96 detection kit comprises a miR-Chr8:96 calibrator, ssDNA, reagent R1, reagent R2 and an RNA extraction kit; wherein the ssDNA nucleotide sequence is complementary to the miR-Chr8:96 nucleotide sequence, the reagent R1 contains RNA / DNA antibody-Acridinium ester, and the reagent R2 contains streptavidin-magnetic particles. Based on the miR-Chr8:96 detection kit, the present invention establishes a CLIA operating procedure for detecting the content of miR-Chr8:96, which is used to detect the level of miR-Chr8:96 in blood, urine, tissue fluid, and milk samples. The CLIA detection method provided by the present invention can use a fully automatic chemiluminescence analyzer to quantitatively detect miR-Chr8:96 in a sample, has high sensitivity, strong specificity, short detection time, simple operation, low economic cost, can meet conventional inspection requirements, and is widely used.

[0289] It should be understood that the application of the present invention is not limited to the above examples. For ordinary technicians in this field, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention. Sequence Listing <110> Shenzhen Deda Technology Co., Ltd. <120> A miR-Chr8:96 detection kit and detection method thereof <160> 3 <210> 1 <211> twenty one <212> RNA <213> Artificial sequence <400> ucuugcaauu aaaaggggga a 21 <210> 2 <211> twenty three <212> RNA <213> Artificial sequence <400> ttcccccttt taattgcaag ata 23 <210> 3 <211> twenty two <212> RNA <213> Artificial sequence <400> agcugguaaaaaaaccaaa at 22

Claims

1. A miR-Chr8:96 detection kit, characterized in that: include: miR-Chr8:96 calibrator, ssDNA, reagent R1, reagent R2 and RNA extraction kit; wherein the ssDNA end is labeled with biotin, the reagent R1 contains 25-50ng / mL RNA / DNA antibody-AE, and the reagent R2 contains 0.2-0.5% streptavidin-magnetic particles; the streptavidin-magnetic particles have a diameter of 3.0 μm; The miR-Chr8:96 calibrator is an artificially synthesized miR-Chr8:96 RNA, and the nucleotide sequence is shown in SEQ ID NO.1; The ssDNA is an artificially synthesized single-stranded DNA, and the nucleotide sequence is complementary to the miR-Chr8:96 nucleotide sequence, and the nucleotide sequence is shown in SEQ ID NO.2; The 3' end of the ssDNA is labeled with biotin; The ssDNA is dissolved in a hybridization solution to prepare an ssDNA hybridization solution; wherein the hybridization solution formula is: 20mM Tris, 150mM NaCl, 1.0mM EDTA, 5.0mM MgCl2; the ssDNA concentration in the ssDNA hybridization solution is 5-10pmol / L.

2. The miR-Chr8:96 detection kit according to claim 1, characterized in that The preparation method of the RNA / DNA antibody-AE is: Providing RNA / DNA antibodies and adjusting them to a predetermined concentration; Dissolve Acridinium NHS ester in dimethylformamide to a predetermined concentration; reacting the RNA / DNA antibody with Acridinium NHS ester; After the reaction is terminated, free Acridinium NHS ester is removed to obtain purified RNA / DNA antibody-AE.

3. A method for detecting miR-Chr8:96, characterized in that: The detection method is based on the miR-Chr8:96 detection kit according to any one of claims 1-2, comprising the steps of: 1.1 Isolate RNA from the sample to be tested; 1.2 mixing the RNA with ss DNA to form an RNA / DNA hybrid chain; 1.3 Add the RNA / DNA hybrid chain and reagents R1 and R2 into a reaction cup and react for a predetermined time to form an AE-RNA / DNA antibody-RNA / DNA-biotin-streptavidin-magnetic particle complex; 1.4 adsorbing the complex to the bottom of the reaction cup, adding a washing solution for washing, and then removing the washing solution; 1.5 Adding pre-stimulation solution to dissociate the complex and release RNA / DNA antibody-AE; 1.6 Add excitation solution to activate the luminescence reaction process of the system; 1.7 Determine the luminescence intensity value and analyze the content of miR-Chr8:96 in the sample to be tested; The detection method is not intended for disease diagnosis and treatment.

4. The miR-Chr8:96 detection method according to claim 3, characterized in that It also includes establishing a miR-Chr8:96 concentration standard curve, the specific steps are: preparing miR-Chr8:96 calibrators and setting the concentration gradient of the miR-Chr8:96 calibrators; The miR-Chr8:96 calibrator was mixed with ss DNA and reacted at 55° C. for 2-10 min to obtain a calibrator RNA / DNA hybrid chain; The calibrator RNA / DNA hybrid chain and reagents R1 and R2 are added to a reaction cup and reacted for 5-20 min to obtain a calibrator AE-RNA / DNA antibody-RNA / DNA-biotin-streptavidin-magnetic particle complex; After washing the calibrator AE-RNA / DNA antibody-RNA / DNA-biotin-streptavidin-magnetic particle complex, activating the luminescence program and detecting the luminescence intensity of the system to obtain the relative luminescence value unit of the miR-Chr8:96 calibrator; A miR-Chr8:96 concentration standard curve was established with the concentration of the miR-Chr8:96 calibrator as the ordinate and the relative luminescence value unit of the miR-Chr8:96 calibrator as the abscissa.

5. The miR-Chr8:96 detection method according to claim 4, characterized in that The concentration gradient of the miR-Chr8:96 calibrator is 0, 250, 500, 1000, 2000, and 4000 fmol / L.

6. The miR-Chr8:96 detection method according to claim 4, characterized in that Based on the miR-Chr8:96 concentration standard curve, a CLIA analyzer miR-Chr8:96 concentration detection system was established to detect the miR-Chr8:96 content in the sample to be tested.

7. An application of a miR-Chr8:96 detection kit, characterized in that: Applying the miR-Chr8:96 detection kit as described in any one of claims 1-2 to the detection of miR-Chr8:96 content in plasma, serum, urine, tissue fluid or milk samples; The application is not for the purpose of disease diagnosis and treatment.

Images