A method for regulating proliferation of a virus in a rice planthopper
By regulating the PI(3,5)P2 content in rice planthoppers and using PI(3,5)P2 inhibitors or homologs to regulate virus proliferation, the problem of virus proliferation in insects was solved, the accumulation of viruses was controlled, and the spread of viruses was reduced.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- JIANGSU ACAD OF AGRI SCI
- Filing Date
- 2022-04-14
- Publication Date
- 2026-07-24
AI Technical Summary
Current technologies have not been able to effectively regulate the proliferation of viruses within insects, leading to serious insect-borne plant viral diseases that negatively impact agricultural production.
By applying exogenous PI(3,5)P2 inhibitor YM201636, dsRNA of PI(3,5)P2 synthase gene, or PI(3,5)P2 homolog PI(3,5)P2-diC8, the content of PI(3,5)P2 in rice planthoppers can be regulated, thereby controlling virus proliferation.
It significantly inhibits or promotes the proliferation of viruses in rice planthoppers, reduces or increases the amount of virus accumulation, and effectively controls the spread of viruses.
Smart Images

Figure HSB0000215164990000011 
Figure HSB0000215164990000012 
Figure HSB0000215164990000013
Abstract
Description
Technical Field
[0001] This invention relates to a method for controlling the proliferation of viruses in rice planthoppers by targeting and regulating the content of phosphatidylinositol 3,5-bisphosphate (PI(3,5)P2), which belongs to the field of biotechnology. Background Technology
[0002] Phospholipids are important components of cell membranes and can be divided into glycerophospholipids and sphingomyelins. Glycerophospholipids can be further classified into phosphatidylinositol, phosphatidylcholine, etc., based on the polarity of their head groups. Phosphorylation at the 3, 4, and 5 positions of the inositol ring in the phosphatidylinositol head forms phosphatidylinositol 3,5-bisphosphate (PI(3,5)P2). PI(3,5)P2 plays a crucial role in eukaryotic cells. Studies in yeast and animals have shown that PI(3,5)P2 affects the morphology of vacuoles, endosomes, and lysosomes, and is closely related to the maintenance of endometrial homeostasis. It can also regulate processes such as osmosis, vacuolar pH, and autophagy. However, there are currently no reports of using PI(3,5)P2 to regulate viral proliferation in insects.
[0003] Plant viral diseases have become the second leading cause of agricultural losses, causing enormous economic damage to global agriculture annually. Once infected, plants are often incurable and can easily suffer devastating consequences. For example, since the beginning of this century, rice stripe virus (RSV) and rice black-streaked dwarf virus (RBSDV), transmitted by planthoppers, have caused successive outbreaks in rice-wheat rotation areas in my country. In 2005, the affected area in Jiangsu and Anhui provinces exceeded 40 million mu (approximately 6.67 million hectares), severely impacting rice production, food security, and rural stability. There are numerous types of plant viruses; approximately 1100 species are currently known, with over 76% transmitted by insect vectors. For persistently proliferating plant viruses transmitted by insect vectors, the virus must accumulate to a certain level within the insect before it can be effectively transmitted to plants. Therefore, finding effective methods to regulate viral replication within insects is crucial for controlling insect-borne viral diseases.
[0004] Rice planthoppers are a major pest of rice, damaging plants by piercing and sucking their flesh from the stems and leaves. Large infestations can cause plant dieback and widespread lodging, a condition commonly known as "planthopper burn." Besides sucking, rice planthoppers also transmit rice virus diseases, causing significant losses. The main rice planthoppers causing damage in my country are the brown planthopper, white-backed planthopper, and gray planthopper. Gray planthoppers transmit not only maize rough dwarf virus but also rice stripe leaf blight and rice black-streaked dwarf virus. Brown planthoppers can transmit rice tooth leaf dwarf virus and rice grass dwarf virus. White-backed planthoppers transmit southern rice black-streaked dwarf virus, first discovered in Guangdong Province in 2001, and in 2009, it caused a large-scale outbreak in nine provinces including Guangdong, Jiangxi, and Hunan, affecting approximately 333,300 hectares.2 In 2010, the affected area reached 1.33 million hectares. 2 These viral diseases pose a serious threat to rice production. This invention targets the rice planthopper and significantly inhibits viral proliferation in rice planthoppers by injecting the PI(3,5)P2 inhibitor YM201636 or the dsRNA of the PI(3,5)P2 synthase gene; and significantly increases the accumulation of virus in rice planthoppers after injection of the PI(3,5)P2 homolog PI(3,5)P2-diC8.
[0005] This invention inhibits the proliferation of viruses in rice planthoppers by exogenously applying PI(3,5)P2 inhibitors or dsRNA of the PI(3,5)P2 synthase gene; and promotes the proliferation of viruses in rice planthoppers by exogenously applying the homologous compound PI(3,5)P2-diC8. This invention provides a new technology and method for controlling the transmission of viruses by vector insects. Summary of the Invention
[0006] This invention provides a method for controlling viral proliferation in rice planthoppers by targeting and regulating the content of PI(3,5)P2. This method regulates the content of PI(3,5)P2 by applying a PI(3,5)P2 inhibitor, the dsRNA of the PI(3,5)P2 synthase gene, or the PI(3,5)P2 homolog PI(3,5)P2-diC8 to the rice planthopper, thereby controlling viral proliferation within the planthopper.
[0007] The invention includes the following aspects:
[0008] 1. Inhibition of viral proliferation in the planthopper (Grey Planthopper) or white-backed planthopper by exogenous application of the PI(3,5)P2 inhibitor YM201636. The specific method is as follows:
[0009] (1) Dissolve YM201636 in DMSO to prepare a 10mM stock solution. When using, dilute the YM201636 stock solution 500 to 1000 times with PBS buffer to a working concentration of 10 to 20 μM. At the same time, dilute DMSO with PBS solution 500 to 1000 times as a control solution.
[0010] (2) The virus-carrying gray planthoppers or white-backed planthoppers were treated with YM201636 solution diluted with PBS by microinjection, drip or spray method, and DMSO solution diluted with PBS was used as a control.
[0011] (3) After 4 to 10 days of treatment with YM201636, the amount of virus accumulation was detected by methods such as quantitative fluorescence, immunofluorescence, and Western blot.
[0012] 2. Inhibit viral proliferation in the planthopper (Grey Planthopper) or white-backed planthopper by exogenously applying dsRNA of the PI(3,5)P2 synthase gene. The specific method is as follows:
[0013] (1) Design specific primers to amplify gene fragments of PI(3,5)P2 synthase gene PIKfyve and control gene GFP.
[0014] (2) The dsRNA of the PI(3,5)P2 synthase gene PIKfyve was synthesized using dsRNA, and the dsRNA of the GFP gene was synthesized at the same time.
[0015] (3) dsRNA was injected into the bodies of gray or white-backed planthoppers carrying the virus using microinjection.
[0016] (4) After treatment with dsRNA, the amount of virus accumulation was detected by methods such as quantitative fluorescence, immunofluorescence, and Western blot.
[0017] 3. Virus proliferation in the planthopper was promoted by exogenously applying PI(3,5)P2-diC8. The specific method was as follows:
[0018] (1) Prepare a 1 mM stock solution of commercial PI(3,5)P2-diC8 with DMSO. When using it, dilute the PI(3,5)P2-diC8 stock solution 1000 to 10000 times with PBS buffer to a concentration of 1 nM to 1 μM. At the same time, dilute DMSO with PBS solution 1000 to 10000 times as a control solution.
[0019] (2) The virus-carrying planthoppers were treated with YM201636 solution diluted with PBS by microinjection, dripping or spraying. The control solution was DMSO solution diluted with PBS.
[0020] (3) After treatment with PI(3,5)P2-diC8 solution for 4 to 10 days, the amount of virus accumulation was detected by methods such as fluorescence quantification, immunofluorescence, and Western blot.
[0021] For those skilled in the art, this invention can be adapted to use other inhibitors of PI(3,5)P2 to suppress PI(3,5)P2 levels or to apply other PI(3,5)P2 homologous compounds to increase PI(3,5)P2 levels in insects. The solution concentration used in this invention can be adjusted based on the actual virus proliferation effect. Attached Figure Description
[0022] Figure 1In Example 1, the viral accumulation in planthoppers carrying RBSDV after treatment with YM201636 was detected using quantitative real-time PCR (A) and Western blot (B).
[0023] Figure 2 In Example 2, the accumulation of RBSDV-carrying planthoppers was detected by quantitative real-time PCR (A) and Western blot (B) after injecting the PI(3,5)P2 synthase PIKfyve gene and eGFP dsRNA.
[0024] Figure 3 In Example 3, the viral accumulation in white-backed planthoppers carrying SRBSDV was detected using quantitative real-time PCR (A) and Western blot (B) methods after treatment with YM201636.
[0025] Figure 4 In Example 4, the viral accumulation in planthoppers carrying RBSDV after treatment with PI(3,5)P2-diC8 was detected using quantitative real-time PCR (A) and Western blot (B). Detailed Implementation
[0026] The following examples illustrate the content of the present invention, but the content of the present invention is not limited to the implementation examples described herein.
[0027] Example 1 uses the PI(3,5)P2 inhibitor YM201636 to inhibit the proliferation of RBSDV in the planthopper.
[0028] YM201636 was dissolved in DMSO to prepare a 10 mM stock solution. The YM201636 stock solution was diluted 500-fold with PBS buffer to a usable concentration of 20 μM. Simultaneously, DMSO was diluted 500-fold with PBS solution as a control solution. The diluted YM201636 solution was injected into RBSDV-carrying planthoppers using a microinjector, while the diluted DMSO solution was injected as a control. Four days after injection, planthoppers injected with YM201636 and DMSO solutions were collected, total RNA was extracted, and reverse transcription was performed. Quantitative real-time PCR was used to compare the virus levels in the control and YM201636-treated planthoppers. The results showed that the accumulation of RBSDV significantly decreased after YM201636 injection. Figure 1 A). Furthermore, total protein was extracted from the planthopper, and the accumulation of the virus was detected using a polyclonal antibody against RBSDVP10 protein via Western blot. The results showed that the accumulation of RBSDV in planthoppers treated with YM201636 was significantly reduced. Figure 1 B).
[0029] Example 2: Injection of dsRNA from the PI(3,5)P2 synthase PIKfyve gene inhibited the proliferation of RBSDV in the planthopper.
[0030] Specific primers for the PIKfyve and eGFP genes of the planthopper synthase were designed: dseGFP-F: TAATACGACTCACTATAGGCGACTTCTTCAAGTCCGCCA; dseGFP-R: TAATACGACTCACTATAGGCTCAGGTAGTGGTTGTCGGG. dsLsPIKfyve-F: TAATACGACTCACTATAGGGGAACAAAGCCTCTTCCCAATCG; dsLsPIKfyve-R: TAATACGACTCACTATAGGGGGATACATGATGGCGCAACTCA. After PCR amplification, the dsRNA of the PIKfyve and eGFP genes was synthesized using the TranscriptAid T7 highyield transcription kit (Thermo, 518K0441). The dsRNA of the PIKfyve and eGFP genes was injected into planthoppers carrying RBSDV using a FemtoJet microinjector (Eppendorf). Two to four days after injection, treated planthoppers were collected, and RBSDV proliferation in the planthoppers was detected by quantitative real-time PCR and Western blot, respectively. Total RNA was extracted, reverse transcribed, and the virus content in planthoppers injected with dseGFP and dsPIKfyve was compared using quantitative real-time PCR. The results showed that RBSDV accumulation was significantly reduced after injection of dsPIKfyve. Figure 2 A). Furthermore, total protein was extracted from the planthopper, and the accumulation of RBSDV10 was detected using Western blot with antibody. The results showed that injection of PIKfyve's dsRNA significantly reduced the accumulation of RBSDV in the planthopper. Figure 2 B).
[0031] Example 3 uses the PI(3,5)P2 inhibitor YM201636 to inhibit the proliferation of Southern Rice Black-Streaked Dwarf Virus in the white-backed planthopper.
[0032] YM201636 was dissolved in DMSO to prepare a 10 mM stock solution. The YM201636 stock solution was diluted 500-fold with PBS buffer to a usable concentration of 20 μM. Simultaneously, DMSO was diluted 500-fold with PBS solution as a control solution. The diluted YM201636 solution was injected into white-backed planthoppers carrying SRBSDV using a microinjector, while the diluted DMSO solution was injected as a control. Four days after injection, white-backed planthoppers injected with YM201636 and DMSO solutions were collected, total RNA was extracted, and reverse transcription was performed. Quantitative real-time PCR was used to compare the virus levels in the white-backed planthoppers treated with YM201636 and those treated with YM201636. The results showed that the accumulation of SRBSDV significantly decreased after injection of YM201636. Figure 3 A). Furthermore, total protein was extracted from the white-backed planthopper, and SRBSDV monoclonal antibody accumulation was detected using Western blotting. The results showed that the accumulation of SRBSDV in white-backed planthoppers treated with YM201636 was significantly reduced. Figure 3 B).
[0033] Example 4: Injection of PI(3,5)P2-diC8 promotes the proliferation of RBSDV in the planthopper.
[0034] PI(3,5)P2-diC8 was dissolved in DMSO to prepare a 1 mM stock solution. The PI(3,5)P2-diC8 stock solution was diluted 2000-fold with PBS buffer to 0.5 μM, and DMSO was diluted 2000-fold with PBS solution as a control solution. The 0.5 μM PI(3,5)P2-diC8 solution was injected into RBSDV-carrying planthoppers using a microinjector, with the diluted DMSO solution injected simultaneously as a control. Four days after injection of PI(3,5)P2-diC8 and DMSO solutions, planthoppers were collected, total RNA was extracted, and reverse transcription was performed. Quantitative real-time PCR was used to compare the virus levels in the control and PI(3,5)P2-diC8-treated planthoppers. The results showed that RBSDV accumulation significantly increased after PI(3,5)P2-diC8 injection. Figure 4 A). Furthermore, total protein was extracted from the planthopper, and the accumulation of RBSDV was detected using a polyclonal antibody against RBSDV P10 via Western blotting. The results showed that the accumulation of RBSDV in planthoppers treated with YM201636 was significantly increased. Figure 4 B).
Claims
1. A method for regulating the proliferation of viruses in rice planthoppers, characterized in that, The proliferation of rice black-streaked dwarf virus in the gray planthopper and southern rice black-streaked dwarf virus in the white-backed planthopper was inhibited by reducing the content of PI(3,5)P2, or the proliferation of rice black-streaked dwarf virus in the gray planthopper was promoted by increasing the content of PI(3,5)P2.
2. The method for regulating virus proliferation in rice planthoppers according to claim 1, characterized in that, The levels of PI(3,5)P2 in the planthopper and white-backed planthopper were reduced by applying the PI(3,5)P2 inhibitor YM201636 or the dsRNA of the PI(3,5)P2 synthase gene PIKfyve, while the levels of PI(3,5)P2 in the planthopper were increased by applying the homolog PI(3,5)P2-diC8.