A method and kit for detecting secretion expression of target proteins

Abstract

The application provides a method for detecting secretion expression of a target protein, which comprises the following steps: fusing the target protein with a fluorescence-enhanced nanobody to obtain a fusion protein; adding the obtained fusion protein into a system containing a fluorescent protein and a fluorescence-inhibited nanobody to perform a reaction; and measuring the fluorescence intensity of the system after the reaction is completed, and calculating the secretion expression amount of the target protein according to the change amount of the fluorescence intensity. In the application, the GBP1 is fused with the target protein, and the expression interference of the GBP1 on the target protein is reduced by adding a connecting peptide, so that the secretion expression amount of the target protein is determined. The method of the application can detect a wide concentration range of the target protein, has a high signal response multiple, and can be applied to a shake flask, a well plate and a droplet microfluidic screening system.

Description

Technical Field

[0001] This application belongs to the field of biotechnology, specifically relating to a method and kit for detecting the secretory expression of a target protein. Background Technology

[0002] Recombinant proteins, including industrial enzymes and pharmaceutical proteins, are widely used in the chemical, food, and pharmaceutical industries, with a market size exceeding hundreds of billions of yuan. To reduce costs and improve production efficiency, it is often necessary to optimize the expression system to increase the secretory expression level of recombinant proteins. For example, physical or chemical mutagenesis techniques can be used to mutate host cells, generating whole-genome random mutant libraries, and high-throughput screening of these libraries to obtain high-yielding strains. Alternatively, metabolic engineering and synthetic biology methods can be used to optimize expression elements and metabolic pathways to increase the secretory expression level of recombinant proteins. However, all of the above operations require methods for accurate quantification of the target protein. For enzyme-based recombinant proteins, their secretory expression level can be detected by measuring enzyme activity. However, many recombinant proteins, such as albumin, therapeutic antibodies, and collagen, do not possess enzymatic activity. Therefore, it is necessary to develop other simple and rapid quantitative methods that are not enzyme-dependent to detect their expression levels, laying the foundation for optimizing the secretory expression of recombinant proteins through high-throughput screening and other methods.

[0003] Non-enzyme-dependent quantification methods have been reported (see Haitjema CH et al., ACSSynthetic Biology. 2014 Feb 21; 3(2):74-82). These methods involve fusing a cysteine ​​peptide tag (CCPGCC) Tc-tag with the target protein. This tag binds to a dual-arsenic fluorescent probe (FlAsH-EDT2) to produce green fluorescence, and this system has been used to screen for high-secreting strains in *E. coli*. However, because the dual-arsenic fluorescent probe (FlAsH-EDT2) is a small molecule, it easily crosses the cell membrane and enters the cell, binding to the intracellular cysteine ​​peptide tag Tc-tag to produce fluorescence. This fluorescence cannot be distinguished from the extracellular fluorescence signal, leading to inaccurate quantification of the secretory expression level of the target protein.

[0004] Another quantitative method was also reported (see Knapp A et al., Journal of Biotechnology, 2017 Sep 20; 258:110-116). This system uses a split green fluorescent protein (GFP) to quantify the target protein. The target protein is fused with a 16-amino acid fragment of GFP (amino acids 215-230, also known as GFP11), while a complementary fragment (amino acids 1-214, also known as GFP1-10) is independently expressed. These two fragments, in a soluble state, can spontaneously fold to form a complete GFP and emit fluorescence, thereby allowing the detection of the secretory expression level of the recombinant protein. However, because GFP1-10 exists in E. coli as inclusion bodies, its purification is very difficult, and it can only be used as a reagent by dissolving the inclusion bodies in urea.

[0005] Nanobodies are naturally occurring antibodies lacking a light chain, found in camel peripheral blood. These antibodies contain only a heavy chain variable region (VHH) and two conventional CH2 and CH3 regions. Nanobodies have small molecular weights, not exceeding 15 kDa, and are easily secreted. They have been proven to be secreted and expressed in various systems (E. coli, Corynebacterium glutamicum, yeast, mammalian cells, etc.) and possess advantages such as good stability and high specificity, attracting widespread attention in biotechnology research and medical diagnostics. Reports have shown that anti-GFP or eGFP nanobodies (GFP-binding proteins, GBPs) can modulate the brightness of green fluorescent protein. For example, the enhancing nanobodies GBP1 can specifically enhance the luminescence intensity of GFP, while the inhibiting nanobodies GBP4 specifically weaken the luminescence intensity of GFP (see Kirchhofer A et al., Nature Structural & Molecular Biology, 2010 Jan; 17(1):133-8). Summary of the Invention

[0006] To address the problems existing in the prior art, this application provides a method and kit for detecting the secretory expression of a target protein.

[0007] Specifically, this application relates to the following aspects:

[0008] 1. A method for detecting the secretory expression of a target protein, characterized in that the method comprises:

[0009] The target protein was fused with a fluorescence-enhanced nanobody to obtain a fusion protein.

[0010] The obtained fusion protein was added to a system containing fluorescent protein and fluorescence-inhibiting nanobodies for reaction.

[0011] After the reaction is complete, the fluorescence intensity of the system is measured.

[0012] The secretory expression level of the target protein is calculated based on the change in fluorescence intensity.

[0013] 2. The method according to item 1, wherein the molar ratio of fluorescent protein to fluorescence-inhibiting nanobody is 1:1.

[0014] 3. The method according to item 1, wherein the fluorescence-enhanced nanobody is GBP1.

[0015] 4. The method according to claim 1, wherein the fluorescent protein is green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), blue fluorescent protein (BFP), yellow fluorescent protein (YFP), or other fluorescent proteins of different colors.

[0016] 5. The method according to claim 1, wherein the fluorescence-inhibiting nanobody is GBP4.

[0017] 6. The method according to item 1, wherein the concentration of the fluorescent protein in the system is 0.05-50 μM, preferably 0.5-5 μM.

[0018] 7. The method according to item 1, characterized in that the target protein is fused with a fluorescence-enhanced nanobody via a linker peptide to obtain a fusion protein.

[0019] 8. The method according to item 7, wherein the length of the linker peptide is 1 to 100 amino acids, preferably 10 amino acids, and more preferably the amino acid sequence is as shown in SEQ ID NO:1.

[0020] 9. The method according to claim 1, characterized in that the target protein is a protein of 50-1000 amino acids.

[0021] Preferred ingredients include human serum albumin, bovine serum albumin, immunoglobulins, growth factors, antigens, or industrial enzymes.

[0022] 10. A kit for detecting the secretory expression of recombinant proteins, characterized in that the kit comprises a system containing a fluorescent protein and a fluorescence-inhibiting nanobody.

[0023] 11. The kit according to claim 10, characterized in that it contains green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), blue fluorescent protein (BFP), yellow fluorescent protein (YFP), or other fluorescent proteins of different colors.

[0024] 12. The kit according to item 10, wherein the fluorescence-inhibiting nanobody is GBP4.

[0025] 13. The kit according to item 10, characterized in that the molar ratio of the fluorescent protein to the fluorescence-inhibiting nanobody is 1:1, preferably the concentration of the fluorescent protein in the system is 0.5-2.5 μM.

[0026] 14. The kit according to claim 10, characterized in that the kit further comprises reagents for constructing a fusion protein comprising a target protein, a linker peptide and a fluorescence-enhanced nanobody.

[0027] This application utilizes GBP1 fusion with a target protein and reduces its interference with target protein expression by adding a linker peptide. Simultaneously, GFP or eGFP and GBP4 are independently expressed, purified, and prepared into equimolar mixtures. By adding this mixture to the GBP1-tagged target protein, GBP1 and GBP4 competitively bind to GFP or eGFP, ultimately causing GBP1 to replace GBP4, resulting in the re-generation of a fluorescent signal by GFP or eGFP. This enables precise quantitative determination of the secretory expression level of the target protein. The fluorescent proteins and nanobodies included in this system are easily expressed and prepared, and do not readily penetrate cell membranes. Experimental data show that this system can detect a wide concentration range of target proteins, exhibits a high signal response fold, and can be applied to well plate and droplet microfluidic screening systems. Attached Figure Description

[0028] Figure 1 Fluorescence response curves for different systems;

[0029] Figure 2 This demonstrates the specificity of the GFP+GBP4 fluorescent reporter system;

[0030] Figure 3 The fluorescence response curve of Pichia pastoris HSA as the target protein;

[0031] Figure 4 The fluorescence assay results of Pichia pastoris HSA-GBP1 strain in microdroplets are shown in the left image: bright field; right image: fluorescence channel.

[0032] Figure 5 The electrophoresis results of PCR identification of the high-yielding Pichia pastoris HSA-GBP1 strain after microfluidic enrichment in droplets. Detailed Implementation

[0033] The present application is further illustrated below with reference to embodiments. It should be understood that the embodiments are only used to further illustrate and explain the present application and are not intended to limit the present application.

[0034] Unless otherwise defined, technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. While similar or identical methods and materials may be applied in experimental or practical applications, materials and methods are described herein. In case of conflict, the definitions included herein shall prevail. Furthermore, materials, methods, and examples are for illustrative purposes only and are not intended to be limiting. The present application is further described below with reference to specific embodiments, but is not intended to limit the scope of the application.

[0035] To address the problems existing in the prior art, this application provides a method for detecting the secretory expression of a target protein, the method comprising:

[0036] The target protein was fused with a fluorescence-enhanced nanobody to obtain a fusion protein.

[0037] The obtained fusion protein was added to a system containing fluorescent protein and fluorescence-inhibiting nanobodies for reaction.

[0038] After the reaction is complete, the fluorescence intensity of the system is measured.

[0039] The secretory expression level of the target protein is calculated based on the change in fluorescence intensity.

[0040] Nanobodies are naturally occurring antibodies in camel peripheral blood that lack a light chain. These antibodies contain only a single heavy chain variable region (VHH) and two conventional CH2 and CH3 regions. Nanobodies have a small molecular weight, not exceeding 15 kDa, and are easily secreted. They have been proven to be secreted and expressed in various systems (E. coli, Corynebacterium glutamicum, yeast, mammalian cells, etc.) and possess advantages such as good stability and high specificity, thus attracting widespread attention in biotechnology research and medical diagnostics.

[0041] The fluorescence-enhancing nanobodies described in this application refer to nanobodies that, upon binding to fluorescent proteins, can enhance the luminescence intensity of the fluorescent proteins. Correspondingly, the fluorescence-inhibiting nanobodies described in this application refer to nanobodies that, upon binding to fluorescent proteins, can inhibit the luminescence intensity of the fluorescent proteins.

[0042] Previous reports have shown that anti-GFP or eGFP nanobodies (GFP-binding proteins, GBPs) can modulate the brightness of green fluorescent protein. For example, the enhancing nanobodies GBP1 can specifically enhance the luminescence intensity of GFP, while the inhibiting nanobodies GBP4 specifically weaken the luminescence intensity of GFP (see Kirchhofer A et al. Nature Structute & Molecular Biology. 2010 Jan; 17(1):133-8).

[0043] In this application, a fluorescence-enhanced nanobody is fused with a target protein, and a mixture containing a fluorescent protein and a fluorescence-inhibiting nanobody is added to the target protein tagged with the fluorescence-enhanced nanobody. Since the fluorescence-enhanced nanobody and the fluorescence-inhibiting nanobody competitively bind to the fluorescent protein, the fluorescence-enhanced nanobody eventually replaces the fluorescence-inhibiting nanobody, causing the fluorescent protein to generate a fluorescent signal again. Thus, the secretory expression level of the target protein can be measured based on the change in fluorescence intensity.

[0044] In one specific embodiment, the molar ratio of the fluorescent protein to the fluorescence-inhibiting nanobody in the system is 1:1.

[0045] In one specific embodiment, the fluorescence-enhanced nanobody is GBP1.

[0046] Fusion proteins are expression products of two recombined genes obtained through DNA recombination technology. The basic method for constructing fusion proteins involves modularizing naturally or artificially encoded polypeptide sequences with specific functions, synthesizing them using a gene-encoded DNA sequence template, then deleting the stop codon of the first protein gene, and inserting a second protein gene containing the stop codon to achieve co-expression of both genes. Fusion genes can be expressed in prokaryotic cells (such as E. coli) as well as eukaryotic cells.

[0047] The target protein of this application can be fused with a fluorescence-enhanced nanobody at either the C-terminus or the N-terminus.

[0048] Fluorescent proteins are a class of proteins that emit fluorescence. Their luminescence works by activating their chromophores when exposed to light of a specific wavelength (excitation light), releasing energy as light. Green fluorescent protein (GFP), a protein composed of approximately 238 amino acids, can be excited by light ranging from blue to ultraviolet light, emitting green fluorescence. Other colored fluorescent proteins differ from GFP in the structural domains involved in excitation.

[0049] In one specific embodiment, the fluorescent protein is green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), blue fluorescent protein (BFP), yellow fluorescent protein (YFP), or fluorescent protein of other colors.

[0050] In one specific embodiment, the fluorescence-inhibiting nanobody is GBP4.

[0051] In one specific embodiment, the concentration of the fluorescent protein in the system is 0.05-50 μM, for example, it can be 0.05 μM, 0.1 μM, 0.2 μM, 0.5 μM, 1 μM, 2 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM, 10 μM, 11 μM, 12 μM, 13 μM, 14 μM, 15 μM, 16 μM, 17 μM, 18 μM, 19 μM, 20 μM, 21 μM, etc. μM, 22μM, 23μM, 24μM, 25μM, 26μM, 27μM, 28μM, 29μM, 30μM, 31μM, 32μM, 33μM, 34μM, 35μM, 36μM, 3 7 μM, 38 μM, 39 μM, 40 μM, 41 μM, 42 μM, 43 μM, 44 μM, 45 μM, 46 μM, 47 μM, 48 μM, 49 μM, 50 μM, preferably 0.5-5 μM.

[0052] When fusing a target protein with a fluorescence-enhanced nanobody to obtain a fusion protein, it can be achieved through direct fusion of the target protein and the fluorescence-enhanced nanobody. Alternatively, a linker peptide can be used to fuse the target protein with the fluorescence-enhanced nanobody. Using a linker peptide can reduce the interference of the fluorescence-enhanced nanobody on the expression of the target protein.

[0053] In one specific embodiment, the length of the linker peptide is 1-100 amino acids, for example, 1 amino acid, 2 amino acids, 5 amino acids, 8 amino acids, 10 amino acids, 12 amino acids, 15 amino acids, 20 amino acids, 25 amino acids, 30 amino acids, 35 amino acids, 40 amino acids, 45 amino acids, 50 amino acids, 55 amino acids, 60 amino acids, 65 amino acids, 70 amino acids, 75 amino acids, 80 amino acids, 85 amino acids, 90 amino acids, 95 amino acids, 100 amino acids, preferably 10 amino acids, and more preferably the amino acid sequence is GSGSGSGSGS (SEQ ID NO:1).

[0054] The reaction is considered complete when the fluorescence intensity of the system reaches a stable state after a certain reaction time.

[0055] Fluorescence intensity can be measured using an ELISA reader, with the detection wavelength set according to the type of fluorescent protein selected.

[0056] The method for detecting secretory expression described in this application is applicable to target proteins with a length of 50-1000 amino acids, for example, 50 amino acids, 100 amino acids, 200 amino acids, 250 amino acids, 300 amino acids, 350 amino acids, 400 amino acids, 450 amino acids, 500 amino acids, 550 amino acids, 600 amino acids, 650 amino acids, 700 amino acids, 750 amino acids, 800 amino acids, 850 amino acids, 900 amino acids, 950 amino acids, and 1000 amino acids.

[0057] The target protein can be any type of protein, such as human serum albumin, bovine serum albumin, immunoglobulin, growth factor, antigen, or industrial enzyme.

[0058] In one specific embodiment, this application provides a method for detecting the secretory expression of a target protein, the method comprising:

[0059] The target protein was fused with GBP1 via a linker peptide to obtain a fusion protein.

[0060] The obtained fusion protein was added to a system containing GFP or eGFP and GBP4 for reaction.

[0061] After the reaction is complete, the fluorescence intensity of the system is measured.

[0062] The secretory expression level of the target protein is calculated based on the change in fluorescence intensity.

[0063] This application also provides a kit for detecting the secretory expression of recombinant proteins, the kit comprising a system containing fluorescent proteins and fluorescence-inhibiting nanobodies.

[0064] In one specific embodiment, the fluorescent protein in the kit is green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), blue fluorescent protein (BFP), yellow fluorescent protein (YFP), or other fluorescent proteins of different colors.

[0065] In one specific embodiment, the fluorescence-enhanced nanobody in the kit is GBP1.

[0066] In one specific embodiment, the fluorescence-inhibiting nanobody described in the kit is GBP4.

[0067] In one specific embodiment, the concentration of the fluorescent protein in the kit is 0.05-50 μM.

[0068] Furthermore, the kit also includes reagents for constructing a fusion protein comprising a target protein, a linker peptide, and a fluorescence-enhanced nanobody.

[0069] The protein secretion expression detection method of this application has the advantages of high sensitivity, high specificity, high response fold, and wide dynamic range. It can accurately quantify target proteins in the concentration range of 10–1000 nM and is independent of the enzyme activity of the target protein itself. It can be applied to a variety of target proteins and has strong versatility. The protein secretion expression method of this application can be further used to screen high-yielding strains, providing a solution for ultra-high throughput screening of recombinant protein-efficient secretory cell factories.

[0070] Example

[0071] Example 1

[0072] GFP and eGFP expression and purification in the large intestine

[0073] After the GFP and eGFP gene sequences were synthesized (the nucleotide sequence of the GFP gene is shown in SEQ ID NO:12, and the nucleotide sequence of the eGFP gene is shown in SEQ ID NO:13), they were digested with NdeI / XhoI enzymes and ligated into the pET21a(+) vector, in which a 6×His-tag tag was fused to the C-terminus for purification.

[0074] The process of expression and purification of E. coli is as follows:

[0075] Plasmids carrying GFP or eGFP were transformed into *E. coli* BL21(DE3) strain and cultured overnight at 37°C and 200 rpm in 5 mL LB medium (1% tryptone, 0.5% yeast extract, 1% sodium chloride). Then, 2% inoculum was transferred to 100 mL LB medium and cultured at 37°C and 200 rpm until the OD600 reached 0.6–0.8. 0.2 mM IPTG was added, and the cells were cultured at 16°C and 200 rpm for 24 hours. Cells expressing GFP or eGFP were collected by centrifugation, washed, resuspended in 10 mL of binding buffer, and homogenized by high-pressure homogenization. The cells were then centrifuged at low temperature and high speed. The supernatant containing crude protein was loaded with nickel-NTA-histidine binding resin, and the protein was eluted with elution buffer containing 0.25 M imidazole. Finally, the sample was dialyzed, the buffer was replaced with HEPES-NaOH buffer, and the target protein sample was collected and stored at -80°C for later use.

[0076] Example 2

[0077] GBP1, GBP4, and GFP-L10-GBP4 fusion proteins were expressed and purified in Pichia pastoris.

[0078] After the GBP1 and GBP4 gene sequences were synthesized (the nucleotide sequence of GBP1 is shown in SEQ ID NO:14 and the nucleotide sequence of GBP4 is shown in SEQ ID NO:15), they were digested with EcoRI / SalI and ligated into the pPICZαA vector, with a 6×His-tag fused to the C-terminus for purification.

[0079] Meanwhile, a GFP-L10-GBP4 fusion protein was constructed, which contains a 10-amino acid linker peptide and a 6×His-tag tag at the C-terminus of the fusion protein for purification.

[0080] The specific construction process is as follows:

[0081] The GFP gene sequence was amplified by PCR using primers GFP-F (GAGAGGCTGAAGCTGAATTCATGGGGAAAGGAGAAGAGCT(SEQ ID NO:2)) / GFP-R (CCTGAACCAGAGCCGGACCCCTTGTATAATTCATCCATACCATGGG(SEQ ID NO:3)). The GBP4 gene sequence was amplified by PCR using primers L10-GBP4-F (GGGTCCGGCTCTGGTTCAGGAAGTGGAAGCATGGCTGATGTACAGCTACA(SEQ ID NO:4)) / GBP4-R (TCATGTCTAAGGCTACAAACTTAATGATGGTGGTGGTGATGGC(SEQ ID NO:5)). The GBP4 gene sequence was amplified by PCR using primers ZαA-F (GTTTGTAGCCTTAGACATGA(SEQ ID NO:6)) / ZαA-R (GAATTCAGCTTCAGCCTC(SEQ ID NO:5)). NO:7))PCR amplification of the pPICZαA vector sequence, and Gibson assembly of the above fragment to obtain plasmid pPICZαA-GFP-L10-GBP4, where L is a 10-amino acid linker peptide, and its sequence is GSGSGSGSGS (SEQ ID NO:1).

[0082] The expression and purification process of Pichia pastoris:

[0083] Electroporation was performed using a previous method (Liao et al. 2019) to transform the plasmid into *Pichia pastoris* X33. Recombinant clones from the same culture dishes were collected and cultured at 250 rpm and 30°C for 20–24 hours (5 mL of BMGY in a 50 mL shake flask: 1% yeast extract, 2% peptone, 1.34% amino acid-free yeast nitrogen source, 1% glycerol, 100 mM potassium phosphate, pH 6.0). Strains with an OD600 of 20 were then cultured at 250 rpm and 30°C (20 mL of BMMY in a 250 mL shake flask: 1% yeast extract, 2% peptone, 1.34% amino acid-free yeast nitrogen source, 1% methanol, 100 mM potassium phosphate, pH 6.0). Fermentation was carried out with 1% methanol in a fed-batch manner for 24 hours, followed by expression over 72–120 hours. The supernatant was collected, filtered, and loaded with nickel-NTA-histidine binding resin. The proteins were eluted with elution buffer containing 0.25 M imidazole to obtain purified GBP1, GBP4, and GFP-L10-GBP4 proteins. Finally, the proteins were dialyzed, and the buffer was replaced with HEPES-NaOH buffer. The collected protein samples were stored at -80°C for later use.

[0084] Example 3

[0085] Establishment and optimization of fluorescence reporting system

[0086] Purified GBP1 was diluted a series of times (1 nM-40 μM), and then GFP, GFP-L10-GBP4 fusion protein, GFP+GBP4 (an equimolar mixture of GFP and GBP4), and eGFP+GBP4 (an equimolar mixture of eGFP and GBP4) were added as a fluorescent reporter system. Bovine serum albumin (BSA) was used as a negative control (BSA was added to GFP+GBP4). The final concentrations of GBP4, GFP-L10-GBP4, GFP+GBP4, and eGFP+GBP4 were all 0.5 μM, and HEPES-NaOH was used as the buffer. After stabilization at room temperature for 5-30 min, fluorescence values ​​were measured using a microplate reader at excitation wavelengths of 485 nm and emission wavelengths of 535 nm. The normalized fluorescence value (F / F0) was calculated, a scatter plot was plotted, and the maximum response fold ΔF / F0 was calculated (F...). max -F min ) / F min Simultaneously, Graphpad Prism 8 was used for nonlinear fitting to calculate the dissociation constant Kd (representing the affinity for GBP1). F represents the fluorescence value measured at a specific GBP1 concentration, F0 represents the fluorescence value when the GBP1 concentration is 0, and F... max F represents the maximum fluorescence value measured. minThis represents the minimum fluorescence value measured.

[0087] Fluorescence response results of different systems as fluorescence reporter systems, as follows Figure 1 As shown in the figure, when using GFP, GFP-L10-GBP4, GFP+GBP4, and eGFP+GBP4 as fluorescent reporter systems, all showed significant response signals to GBP1. However, the response fold and dynamic range of GFP and GFP-L10-GBP4 were relatively poor. In contrast, when using GFP+GBP4 as a fluorescent reporter system, significant fluorescence responses were observed at concentrations of GBP1 from 10 to 1000 nM, with a maximum response fold ΔF / F0 reaching 21.9 ± 0.2 and a dissociation constant Kd of 323 ± 59 nM. Simultaneously, no fluorescence response signal was observed for BSA, indicating that this system has strong specificity for target protein recognition (e.g., ...). Figure 2 (As shown in the figure); In contrast, when eGFP+GBP4 is used as a fluorescent reporter system, although the dissociation constant Kd also reaches the nanomolar level (310±68 nM), the maximum response fold ΔF / F0 is only 4.5±0.1. In summary, compared with other systems, the GFP+GBP4 fluorescent reporter system has advantages such as high specificity, high response fold, and wide dynamic range. Therefore, an equimolar mixture of GFP and GBP4 was chosen as the fluorescent reporter system for detecting the secretory expression level of recombinant proteins.

[0088] Example 4

[0089] Detection of human serum albumin (HSA) secretion expression in Pichia pastoris

[0090] The C-terminus of the HSA vector was fused with a GBP1 tag, and a 10-amino acid linker peptide (GSGSGSGSGS) was added in the middle. The GBP1 was amplified by PCR using primers L10-GBP1-F(CCCAAGCTGCTTTGGGTCTTGGATCAGGGTCCGGGAGCGGTTCTGGTTCTAT(SEQ ID NO:8)) / GBP1-R(AGAAAGCTGGCGGCCGCCTAGCTACTAACCGTTACTTGGG(SEQ ID NO:9)). The pPICZαA-HSA vector was amplified by PCR using HSA-F(TAGGCGGCCGCCAGCTTT(SEQ ID NO:10)) / HSA-R(AAGACCCAAAGCAGCTTG(SEQ ID NO:11)). After Gibson recombination, the pPICZαA-HSA-L10-GBP1 plasmid was obtained.

[0091] A GBP1 tag was fused to the N-terminus of the HSA protein. Following the same strategy as for the C-terminal fusion, the pPICZαA-GBP1-L10-HSA plasmid was obtained and electroporated into Pichia pastoris X33 wild-type strain (WT). After 72 hours of shake-flask methanol-induced fermentation, the supernatant was separated by centrifugation and purified to obtain the HSA target protein with GBP1 fused to either the N-terminus or C-terminus. A GFP+GBP4 fluorescent reporter system was added at a final concentration of 0.5-2.5 μM. After stabilization at room temperature for 30 minutes, the fluorescence intensity was measured at 485 nm / 535 nm using a microplate reader, and a response curve was plotted. Figure 3 As shown, the results indicate that the secretory expression level of HSA can be accurately detected by fusing GBP1 at the N-terminus or C-terminus, with a dynamic range between 10-1000 nM and maximum response folds ΔF / F0 of 19.3±0.8 and 18.8±0.8, respectively.

[0092] For example, quantifying HSA secretory expression when the C-terminus of HSA is fused with GBP1 can be performed. Figure 3 The response curve was nonlinearly fitted using Graphpad Prism 8 software to obtain the equation for HSA quantification: Y = 0.67 + 22.36 / (1 + 10^(3.03 - X)). Substituting the Y value (the measured normalized fluorescence value) into the equation, the molar concentration (X) of HSA can be calculated. HSA-L10-GBP1 strain was induced to ferment with methanol in a 250 mL shake flask for 72 hours. The supernatant of the fermentation broth was used to measure the normalized fluorescence value Y. Substituting this value into the above equation, the secretory expression level of HSA was calculated to be 68 mg / L.

[0093] Example 5

[0094] The constructed high-yield and low-yield Pichia pastoris strains of HSA-L10-GBP1 were cultured in 5 mL of BMGY medium for 20-24 hours, and then transferred to BMMY medium. The initial OD600 was controlled at 0.3. The high-yield and low-yield strains were mixed in a 1:1 ratio, and a GFP+GBP4 mixture was added to a final concentration of 2 μM. Using a droplet microfluidic cell sorting system (DREM cell, Tsinghua University Wuxi Institute of Applied Technology, Center for Biological Breeding Research), the cells were separated by shearing the aqueous phase from the oil phase at a concentration of 10 μM. 3 Single-cell microdroplets with a diameter of approximately 30 μm are generated at a rate of / s, with single-cell microdroplets accounting for approximately 10% of the total microdroplets. These microdroplets are incubated at 30°C for 24 hours. A small sample of the droplets is observed under a fluorescence microscope, revealing microdroplets with varying fluorescence intensities. These different intensities represent high-yielding and low-yielding bacteria, respectively. Figure 4 As shown.

[0095] Simultaneously, the cultured single-cell microdroplets were re-injected into the microdroplet sorting chip using a DREM cell, at a ratio of 10... 2 -10 3 The first 1‰ of the fluorescent signals were sorted at a rate of / s. The selected single-cell droplets were demulsified and plated on YPD plates, incubated at 30°C for 3 days. Since high-yielding strains overexpressed the Hac1 gene compared to low-yielding strains, high-yielding strains could be rapidly identified by picking colonies and performing PCR amplification of the Hac1 gene expression cassette. The electrophoresis results after PCR amplification are shown below. Figure 5 As shown in the figure, after two rounds of screening and enrichment, the proportion of high-yielding bacteria reached over 95%, indicating that this system can screen and enrich high-yielding strains in droplet microfluidics, providing a solution for ultra-high throughput screening of recombinant protein-efficient secretory cell factories.

[0096] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features of the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0097] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims.

[0098] sequence list

[0099] SEQ ID NO:1

[0100] GSGSGSGSGS

[0101] SEQ ID NO:2

[0102] GAGAGGCTGAAGCTGAATTCATGGGGAAAGGAGAAGAGCT

[0103] SEQ ID NO:3

[0104] CCTGAACCAGAGCCGGACCCCTTGTATAATTCATCCATCCATGGG

[0105] SEQ ID NO:4

[0106] GGGTCCGGCTCTGGTTCAGGAAGTGGAAGCATGGCTGATGTACAGCTAC

[0107] SEQ ID NO:5

[0108] TCATGTCTAAGGCTACAAACTTAATGGTGGTGGTGATGGC

[0109] SEQ ID NO:6

[0110] GTTTGTAGCCTTAGACATGA

[0111] SEQ ID NO:7

[0112] GAATTCAGCTTCAGCCTC

[0113] SEQ ID NO:8

[0114] CCCAAGCTGCTTTGGGTCTTGGATCAGGGTCCGGGAGCGGTTCTGGTTCTAT

[0115] SEQ ID NO:9

[0116] AGAAAGCTGGCGGCCGCCTAGCTACTAACCGTTACTTGGG

[0117] SEQ ID NO:10

[0118] TAGGCGGCCGCCAGCTTT

[0119] SEQ ID NO:11

[0120] AAGACCCAAAGCAGCTTG

[0121] SEQ ID NO:12

[0122] ATGGGGAAAGGAGAAGAGCTATTTACAGGTGTAGTACCGATCCTGGTCGAGCTGGATGGTGACGTGAACGGCCACAAGTTCAGCGTTAGCGGTGAGGGCGAAGGCGACGCGACCTACGGCAAATTGACCCTGAAATTCATTTGTACCACGGGTAAGCTCCCAGTGCCGTGGCCGACCCTTGTGACGACCTTTTCCTATGGCGTTCAGTGCTTTTCTCGTTATCCGGATCACATGAAACGCCACGATTTTTTCAAGTCTGCTATGCCGGAAGGATACGTGCAAGAGCGCACCATCAGCTTTAAGGACGACGGGAACTACAAGACCCGTGCAGAAGTTAAATTTGAAGGTGACACCTTGGTCAATCGTATTGAGCTGAAGGGTATTGACTTCAAAGAGGATGGCAACATCCTGGGTCACAAGCTGGAATACAATTATAACAGCCATAATGTTTATATCACGGCTGATAAACAAAAAAACGGTATTAAAGCCAACTTCAAGATCCGTCACAACATTGAGGACGGCAGCGTTCAACTGGCGGACCACTACCAGCAGAACACTCCGATCGGCGATGGTCCGGTTTTGCTGCCGGATAATCATTATCTGTCCACCCAGAGCGCGCTGTCGAAAGACCCGAATGAAAAAAGAGACCACATGGTGTTGCTGGAGTTCGTGACTGCGGCAGGTATCACCCATGGTATGGATGAATTATACAAG

[0123] SEQ ID NO:13

[0124] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG

[0125] SEQ ID NO:14

[0126] ATGGCCCAGGTTCAGTTGGTAGAATCAGGTGGCGCCCTAGTCCAACCTGGCGGGTCGCTCCGTCTGTCATGTGCAGCGTCTGGTTTTCCAGTGAACAGGTACTCTATGCGCTGGTATAGACAAGCTCCGGGAAAGGAACGTGAGTGGGTGGCAGGTATGAGTTCGGCGGGCGATCGATCCAGCTACGAAGACAGTGTAAAGGGGCGGTTCACAATATCAAGAGATGATGCTCGAAATACGGTCTATCTTCAGATGAACTCTTTAAAACCCGAGGACACTGCCGTCTATTATTGCAACGTGAATGTTGGCTTCGAGTACTGGGGACAGGGAACCCAAGTAACGGTTAGTAGC

[0127] SEQ ID NO:15

[0128] ATGGCTGATGTACAGCTACAAGAATCAGGGGGAGGCTCTGTGCAGGCGGGTGGTTCCTTGCGCCTGAGCTGTGCGGCGTCCGGTGATACCTTCAGCTCCTATAGCATGGCGTGGTTCCGCCAGGCACCGGGTAAGGAGTGCGAGCTGGTTAGCAATATTCTGCGTGACGGCACAACCACGTACGCCGGCTCGGTCAAAGGTCGTTTTACCATCAGCCGTGATGACGCCAAAAACACCGTGTATCTGCAAATGGTTAACCTCAAGAGTGAAGACACCGCTCGTTATTACTGCGCAGCGGATAGCGGCACTCAACTGGGTTACGTGGGCGCTGTGGGTTTGTCTTGCCTGGACTACGTAATGGATTACTGGGGTAAGGGCACGCAGGTTACCGTTTCAAGC Sequence Listing <110> Tsinghua University <120> Method and Kit for Detecting Secretory Expression of Target Protein <130> PF02149 <160> 15 <170> PatentIn version 3.5 <210> 1 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 1 Gly Ser Gly Ser Gly Ser Gly Ser Gly Ser 1 5 10 <210> 2 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 2 gagaggctga agctgaattc atggggaaag gagaagagct 40 <210> 3 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 3 cctgaaccag agccggaccc cttgtataat tcatccatac catggg 46 <210> 4 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 4 gggtccggct ctggttcagg aagtggaagc atggctgatg tacagctac 49 <210> 5 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 5 tcatgtctaa ggctacaaac ttaatgatgg tggtggtgat ggc 43 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 6 gtttgtagcc ttagacatga 20 <210> 7 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 7 gaattcagct tcagcctc 18 <210> 8 <211> 52 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 8 cccaagctgc tttgggtctt ggatcagggt ccggggagcgg ttctggttct at 52 <210> 9 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 9 agaaagctgg cggccgccta gctactaacc gttattggg 40 <210> 10 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 10 taggcggccg ccagcttt 18 <210> 11 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 11 aagacccaaa gcagcttg 18 <210> 12 <211> 714 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 12 atggggaaag gagaagagct atttacaggt gtagtaccga tcctggtcga gctggatggt 60 gacgtgaacg gccacaagtt cagcgttagc ggtgagggcg aaggcgacgc gacctacggc 120 aaattgaccc tgaaattcat ttgtaccacg ggtaagctcc cagtgccgtg gccgaccctt 180 gtgacgaccttttcctatgg cgttcagtgc ttttctcgtt atccggatca catgaaacgc 240 cacgattttt tcaagtctgc tatgccggaa ggatacgtgc aagagcgcac catcagcttt 300 aaggacgacg ggaactacaa gacccgtgca gaagttaaat ttgaaggtga caccttggtc 360 aatcgtattg agctgaaggg tattgacttc aaagaggatg gcaacatcct gggtcacaag 420 ctggaataca attataacag ccataatgtt tatatcacgg ctgataaaca aaaaaacggt 480 attaaagcca acttcaagat ccgtcacaac attgaggacg gcagcgttca actggcggac 540 cactaccagc agaacactcc gatcggcgat ggtccggttt tgctgccgga taatcattat 600 ctgtccaccc agagcgcgct gtcgaaagac ccgaatgaaa aaagagacca catggtgttg 660 ctggagttcg tgactgcggc aggtatcacc catggtatgg atgaattata caag 714 <210> 13 <211> 717 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence Description: Synthetic sequence <400> 13 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420 aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480 ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600 tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaag 717 <210> 14 <211> 351 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequence <400> 14 atggcccagg ttcagttggt agaatcaggt ggcgccctag tccaacctgg cgggtcgctc 60 cgtctgtcat gtgcagcgtc tggttttcca gtgaacaggt actctatgcg ctggtataga 120 caagctccgg gaaaggaacg tgagtgggtg gcaggtatga gttcggcggg cgatcgatcc 180 agctacgaag acagtgtaaa ggggcggttc acaatatcaa gagatgatgc tcgaaatacg 240 gtctatcttc agatgaactc tttaaaaccc gaggacactg ccgtctatta ttgcaacgtg 300 aatgttggct tcgagtactg gggacaggga acccaagtaa cggttagtag c 351 <210> 15 <211> 399 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence Description: Artificially synthesized sequence <400> 15 atggctgatg tacagctaca agaatcaggg ggaggctctg tgcaggcggg tggttccttg 60 cgcctgagct gtgcggcgtc cggtgatacc ttcagctcct atagcatggc gtggttccgc 120 caggcaccgg gtaaggagtg cgagctggtt agcaatattc tgcgtgacgg cacaaccacg 180 tacgccggct cggtcaaagg tcgttttacc atcagccgtg atgacgccaa aaacaccgtg 240 tatctgcaaa tggttaacct caagagtgaa gacaccgctc gttattactg cgcagcggat 300 agcggcactc aactgggtta cgtgggcgct gtgggtttgt cttgcctgga ctacgtaatg 360 gattactggg gtaagggcac gcaggttacc gtttcaagc 399

Claims

1. A method for detecting the secretory expression of a target protein, characterized in that, The method includes: The target protein was fused with a fluorescence-enhanced nanobody to obtain a fusion protein. The obtained fusion protein was added to a system containing fluorescent protein and fluorescence-inhibiting nanobodies for reaction. After the reaction is complete, the fluorescence intensity of the system is measured. The secretory expression level of the target protein is calculated based on the change in fluorescence intensity.

2. The method according to claim 1, wherein, The molar ratio of the fluorescent protein to the fluorescence-inhibiting nanobody in the system is 1:

1.

3. The method according to claim 1, characterized in that, The fluorescence-enhanced nanobody is GBP1.

4. The method according to claim 1, characterized in that, The fluorescent protein is green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), blue fluorescent protein (BFP), yellow fluorescent protein (YFP), or other fluorescent proteins of different colors.

5. The method according to claim 1, characterized in that, The fluorescence-inhibiting nanobody is GBP4.

6. The method according to claim 1, characterized in that, The concentration of the fluorescent protein in the system is 0.05-50 μM.

7. The method according to claim 1, characterized in that, The concentration of the fluorescent protein in the system is 0.5-5 μM.

8. The method according to claim 1, characterized in that, The target protein is fused with a fluorescence-enhanced nanobody via a linker peptide to obtain a fusion protein.

9. The method according to claim 8, characterized in that, The length of the linker peptide is 1-100 amino acids.

10. The method according to claim 9, characterized in that, The linker peptide is 10 amino acids in length.

11. The method according to claim 9, characterized in that, The amino acid sequence is shown in SEQ ID NO:

1.

12. The method according to claim 1, characterized in that, The target protein is 50-1000 amino acids in length.

13. The method according to claim 1, characterized in that, The target protein is human serum albumin, bovine serum albumin, immunoglobulin, growth factor, antigen, or industrial enzyme.

14. A kit for detecting the secretory expression of recombinant proteins, characterized in that, The kit includes a system containing a fluorescent protein, a fluorescence-inhibiting nanobody, and reagents for constructing a fusion protein comprising a target protein, a linker peptide, and a fluorescence-enhancing nanobody.

15. The kit according to claim 14, characterized in that, The fluorescent protein is green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), blue fluorescent protein (BFP), yellow fluorescent protein (YFP), or other fluorescent proteins of different colors.

16. The kit according to claim 14, characterized in that, The fluorescence-enhanced nanobody is GBP1.

17. The kit according to claim 14, characterized in that, The fluorescence-inhibiting nanobody is GBP4.

18. The kit according to claim 14, characterized in that, The molar ratio of the fluorescent protein to the fluorescence-inhibiting nanobody is 1:

1.

19. The kit according to claim 14, characterized in that, The concentration of the fluorescent protein in the system is 0.05-50 μM.

20. The reagent kit according to claim 19, characterized in that, The concentration of the fluorescent protein in the system is 0.5-5 μM.

Images