A nucleic acid aptamer specifically recognizing DEHP and its application

Abstract

The present invention discloses a nucleic acid aptamer that specifically recognizes DEHP and its application, and belongs to the field of environmental safety biotechnology. The nucleic acid aptamer is any one of the following: (1) a single-stranded DNA sequence such as a nucleotide sequence shown in SEQ ID No.10; (2) a sequence that uses the nucleotide sequence shown in SEQ ID No.10 as a core sequence, is extended or shortened on both sides or on one side, and has the same function as the nucleotide sequence described in (1). The present invention is based on Capture‑SELEX technology, and after 10 rounds of repeated screening, a nucleic acid aptamer SEQ ID No.10 that can bind to DEHP with high affinity and high specificity is finally obtained. The nucleic acid aptamer is applied to the DEHP detection of actual samples, which has important application prospects for the analysis and detection of DEHP in blood samples, cell samples, food and drinking water.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and in particular relates to a nucleic acid aptamer for specifically recognizing DEHP and an application thereof. Background Art

[0002] Di(2-ethylhexyl) phthalate (DEHP) is the most widely used phthalate ester (PAEs) plasticizer, used in the production of flexible polyvinyl chloride (PVC) plastics, with an annual output of about 1 to 4 million tons. DEHP molecules are connected to plastic polymers through pure physical bonds rather than chemical bonds. During the reuse, heating or cleaning of plastic products, DEHP is more likely to migrate into the environment and enter the body through air, food, water and skin absorption, thus endangering people's health. More and more evidence has shown that DEHP is considered an endocrine disruptor. Long-term exposure to DEHP can affect the normal development of the human body and even induce hormone-related cancers, reproductive problems and metabolic disorders.

[0003] At present, DEHP is listed as an environmental priority pollutant by the Ministry of Ecology and Environment of the People's Republic of China. However, according to the "Hazardous Waste Leaching Toxicity Identification Standards Specified in the National Standard of the People's Republic of China (GB 5085.3-2007)", the DEHP leaching concentration limit is still at 3 mg / kg, and such a limit may have affected people's health. At present, the main detection methods for DEHP in plastics include chromatography and immunoassay. Chromatography includes high performance liquid chromatography (HPLC), gas chromatography-mass spectrometry (GC-MS), high performance liquid chromatography-mass spectrometry (HPLC-MS), etc. However, this type of chromatography requires cumbersome pretreatment of the sample when detecting DEHP. For example, when using gas chromatography-mass spectrometry (GC-MS) to detect DEHP, the sample needs to be subjected to vortex-assisted liquid-liquid microextraction, but the detection limit of this chromatography for DEHP is only 9x10 -6 μg / L. Although chromatography exhibits high selectivity and sensitivity, it is expensive, requires complex sample pretreatment, is time-consuming and has a high detection limit, and requires a stable laboratory environment, which will seriously limit their application in large-scale DEHP detection. However, immunoassay is mainly enzyme-linked immunosorbent assay (ELISA). However, the price of ELISA kits is very expensive, the types of enzyme-labeled antibodies are limited, and the operation steps are complicated. In order to overcome the limitations of the above detection methods, researchers have also tried to use electrochemical, surface enhanced Raman scattering (SERS) and other methods to detect DEHP. For example, researchers have developed a DEHP electrochemical sensor based on β-cyclodextrin (β-CD), using the cavity of β-cyclodextrin as a host to capture polar molecules of suitable size. The detection limit of this electrochemical sensor is 4.69×10 2pg / mL. In addition, DEHP can also be detected in water samples by electrochemical impedance spectroscopy, the principle of which is to record the changes in impedance of the material being tested when exposed to different concentrations of DEHP. Although the developed impedance sensors are easy to install in industrial environments, they still require the use of high-frequency (100kHz) circuits and impedance analyzers. In summary, the above traditional detection methods can no longer meet the current urgent detection needs, so there is an urgent need to develop a set of fast and convenient detection methods.

[0004] Aptamers refer to single-stranded DNA (ssDNA) or RNA selected from a DNA or RNA library using the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technique. Aptamers can be folded into a unique three-dimensional conformation, and then bind to homologous targets with high specificity and affinity through van der Waals forces, hydrogen bonds, and electrostatic interactions. The dissociation constant of the binding can reach the nmol / L or even pmol / L level. Moreover, nucleic acid aptamers are also called "chemical antibodies", which are a new type of molecular recognition technology compared to the traditional "antibody-antigen" model. Compared with antibodies, aptamers have a small molecular weight and are easier to penetrate cell membranes and tumor tissues. At the same time, nucleic acid aptamers also have the characteristics of thermal stability, low immunogenicity, and a wide range of target molecules, and can be quickly obtained in vitro. Studies have found that the sequence of nucleic acid aptamers can be further shortened, retaining the function and binding characteristics, making it more cost-effective. At the same time, aptamers can be labeled with groups such as biotin, fluorescent dyes, carboxyl groups, and amino groups to give them new functions. At present, nucleic acid aptamers have been widely used in environmental detection, disease diagnosis, imaging and targeted therapy. In summary, nucleic acid aptamers are expected to replace antigen-antibody reaction and enzyme-linked immunosorbent assay and become a powerful tool for detecting various chemical substances, molecules or cells. Summary of the invention

[0005] One of the purposes of the present invention is to provide a nucleic acid aptamer and its application for specifically recognizing DEHP in view of the problems existing in the above-mentioned prior art. The present invention uses SELEX technology to screen and characterize a single-stranded DNA aptamer sequence that can bind to DEHP specifically and with high affinity. The nucleotide sequence of the nucleic acid aptamer for specific detection of DEHP is: TTCCGGGCATACGTATCGAATGTTGTGAGCCGTGGGCTGC (as shown in SEQ ID No.10). The single-stranded DNA nucleic acid aptamer can effectively and specifically recognize DEHP with affinity.

[0006] The second object of the present invention is to provide the use of the above-mentioned nucleic acid aptamer in separation, enrichment, detection or analysis of DEHP.

[0007] The third object of the present invention is to provide the use of the above-mentioned nucleic acid aptamer in the preparation of a product for separation, enrichment, detection or analysis of DEHP.

[0008] A fourth object of the present invention is to provide a product for detecting DEHP.

[0009] A fifth object of the present invention is to provide a method for detecting DEHP.

[0010] The purpose of the present invention can be achieved through the following technical solutions:

[0011] A nucleic acid aptamer that specifically recognizes DEHP, the nucleic acid aptamer is any one of the following:

[0012] (1) The single-stranded DNA sequence is the nucleotide sequence shown in SEQ ID No. 10;

[0013] SEQ ID No.10: TTCCGGGCATACGTATCGAATGTTGTGAGCCGTGGGCTGC;

[0014] (2) The nucleotide sequence shown in SEQ ID No. 10 is used as the core sequence, and the sequence is extended or shortened on both sides or on one side, and has the same function as the nucleotide sequence described in (1).

[0015] The nucleic acid aptamer has high affinity and high specificity for DEHP.

[0016] As a preferred technical solution, the 5' end or 3' end of the nucleotide sequence of the nucleic acid aptamer is modified with a functional group or molecule.

[0017] Further preferably, the functional group is at least one of a fluorescent group, an amino group, a carboxyl group, a thiol group, biotin, avidin, an electrochemical marker and an enzyme marker.

[0018] The application of the above-mentioned nucleic acid aptamer in separation, enrichment, detection or analysis of DEHP.

[0019] The above-mentioned nucleic acid aptamer is used in the preparation of a product for separating, enriching, detecting or analyzing DEHP, wherein the product is a kit, a test paper or a chip.

[0020] A product for detecting DEHP contains the above-mentioned nucleic acid aptamer, and the product is a kit, a test paper or a chip.

[0021] A method for detecting DEHP uses the above-mentioned nucleic acid aptamer or the above-mentioned product to detect DEHP in the environment, food, tools, in vitro samples or biological materials.

[0022] The present invention provides a method for screening nucleic acid aptamers for detecting DEHP, comprising the following steps:

[0023] (1) ssDNA library design: Design and synthesize a random single-stranded oligonucleotide library with 20 nt fixed sequences at both ends, including restriction endonuclease sites, primer binding sites, and RNA promoter binding sites, as well as a 40 nt random sequence in the middle. The capacity of the ssDNA library needs to reach 10 14 , to ensure that the library contains nucleic acid aptamers that have the potential to bind to the target molecule.

[0024] (2) Immobilization of ssDNA library: A complementary strand P3 (5'-TCAAGAGGTAGACGC-3') complementary to the primer region of the random ssDNA library is calculated and labeled with biotin. Then, the ssDNA library is immobilized on magnetic beads through the specific binding of avidin and biotin.

[0025] (3) Incubation: Add DEHP solution to the magnetic beads of the fixed ssDNA library and incubate to dissociate the ssDNA bound to DEHP from the magnetic beads to form a DEHP / ssDNA complex.

[0026] (4) PCR amplification, enzyme digestion and purification: After adding the target and incubating, magnetic separation is performed and the ssDNA in the supernatant is used as a template for PCR amplification. The ssDNA is then identified by agarose gel electrophoresis, recovered and purified.

[0027] (5) Preparation of ssDNA enriched library.

[0028] (6) Cloning sequencing and sequence analysis.

[0029] (7) Affinity and specificity experiments.

[0030] The PCR reaction conditions are: denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 1 min, and denaturation and extension at 72°C for 10 min. In the process of ssDNA enrichment library, the present invention increases the screening pressure by reducing the library concentration, shortening the incubation time, and adding counter-screening materials, so as to obtain the nucleic acid aptamer sequence that specifically binds to DEHP.

[0031] Beneficial effects of the present invention:

[0032] The present invention uses the Capture-SELEX technology to screen out the nucleic acid aptamer DEHP-Apt that specifically binds to DEHP for the first time, and its sequence is shown in SEQ ID No.10. It has been verified that SEQ ID No.10 can recognize and bind to DEHP with high affinity and high specificity. In addition, the secondary structure of the nucleic acid aptamer SEQ ID No.10 that specifically binds to DEHP of the present invention has a ring and stem structure, and the Gibbs free energy is -9.9Kcal / mol. At the same time, the dissociation constant Kd of the nucleic acid aptamer SEQ ID No.10 to DEHP is: 0.16±0.08μM. In the present invention, the nucleic acid aptamer SEQ ID No.10 can be labeled with groups such as biotin, fluorescent dyes, carboxyl groups, amino groups, etc. and endowed with new functions, and has a wide range of clinical applications and basic application prospects in the fields of environmental detection, disease diagnosis, imaging and targeted therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 .Recovery efficiency of each round during aptamer screening.

[0034] Figure 2 .Agarose gel electrophoresis of the products after enzyme digestion and purification in each round of screening.

[0035] Figure 3 .Analysis of aptamer sequence evolution tree.

[0036] Figure 4 .The secondary structure of DEHP candidate aptamers predicted by RNA Structure software.

[0037] Figure 5 .Sequencing chromatogram of candidate DEHP aptamers.

[0038] Figure 6 .Optimization of adsorption conditions of nucleic acid aptamers and graphene oxide.

[0039] Figure 7 . Determination of the dissociation constant K of candidate aptamer sequences by fluorescence method d value.

[0040] Figure 8 .The specificity of candidate nucleic acid aptamers was verified by fluorescence method.

[0041] Fig. 9 .Diagram of the binding mechanism of nucleic acid aptamer Seq.10 and DEHP. DETAILED DESCRIPTION

[0042] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified.

[0043] Example 1 Screening and enrichment of nucleic acid aptamers specifically binding to DEHP based on SELEX technology

[0044] (1) Design and pretreatment of ssDNA libraries

[0045] Design and synthesize a random single-stranded oligonucleotide library (ssDNA library), with 20 nt fixed sequences at both ends, including restriction endonuclease sites, primer binding sites, and RNA promoter binding sites, as well as 40 nt random sequences in the middle. The capacity of the ssDNA library needs to reach 10 14 , to ensure that the library contains nucleic acid aptamers that have the potential to bind to the target molecule.

[0046] The sequence of the random single-stranded oligonucleotide library is: 5'-ATAGGAGTCACGACGACCAG-N-TATGTGCGTCTACCTCTTGA-3', where N is a 40 nt random base sequence.

[0047] A complementary strand P3 (5'-TCAAGAGGTAGACGC-3') complementary to the primer region of the random ssDNA library was designed and labeled with biotin. The random ssDNA library and the designed biotin-labeled complementary short strand Bio-P3 were mixed in a binding buffer (50mM Tris-HCl, 5mM KCl, 100mM NaCl, 1mM MgCl2, pH 7.4) at a molar ratio of 1:1.5, denatured at 95°C for 10 minutes, and then incubated at 37°C, 230rpm for 3 hours. After the complementary hybridization was completed, the ssDNA concentration in the solution was measured using a micro-nucleic acid analyzer.

[0048] (2) ssDNA library fixation

[0049] The ssDNA library after complementation with the short chain was incubated with the magnetic beads at 37°C and 300rpm for 6 hours. Due to the specific binding of avidin and biotin, the ssDNA was fixed on the magnetic beads. In order to remove the ssDNA that failed to bind and ensure the stability and specificity of ssDNA binding, the magnetic beads need to be washed 3 times with binding buffer and the supernatant is separated under the action of an external magnetic field. The ssDNA concentration in the supernatant is measured to check the fixation of the library, and then the supernatant is discarded.

[0050] (3) Positive screening incubation

[0051] Add 1 ml of 0.1 mmol / L DEHP solution to the magnetic beads fixed with ssDNA (1 nmol) library and incubate at 37°C, 300 rpm for 2 hours. The DEHP competes with the complementary short chain for binding to ssDNA. The ssDNA that does not bind to the target or binds weakly remains on the magnetic beads, while the ssDNA bound to the target falls off into the supernatant. Free DEHP can compete and dissociate the nucleic acid aptamer from the magnetic beads, specifically bind to DEHP to form a DEHP / ssDNA complex and remain in the supernatant. Then, the magnetic beads are removed by magnetic separation, and the collected supernatant is used as a template for PCR amplification.

[0052] (4) PCR amplification

[0053] After incubation, the supernatant was collected under the action of an external magnetic field as a library template for PCR amplification. The total PCR amplification system (50 μL) was: ssDNA 10 ng (volume determined according to ssDNA concentration), forward primer f1 (5'-ATAGGAGTCACGACGACCAG-3') 2 μL; phosphorylated reverse primer r1 (5'-TCAAGAGGTAGACGCACATA-3') 2 μL, 10×PCR buffer 5 μL, Mg 2+ 3μL, dNTP 4μL, Taq Plus DNA polymerase 1μL, add ddH2O to 50μL. PCR reaction conditions are: 95℃ denaturation for 5min, 95℃ denaturation for 30s, 59℃ annealing for 30s, 72℃ extension for 1min, after 30 cycles, denaturation and extension at 72℃ for 10min.

[0054] (5) Enzyme digestion and purification of PCR products

[0055] ssDNA was prepared using Lambda exonuclease. 2 μL Lambda exonuclease and 1 / 10 volume of 10× Lambda Exo Buffer were added to the PCR product, and the product was digested at 37°C for 30 minutes and then denatured and inactivated at 75°C for 10 minutes. Then, 1 / 10 volume of 3M sodium acetate solution and 2 volumes of anhydrous ethanol were added to the digested product, and the product was placed in a -20°C refrigerator for 12 hours. After the standing period, the solution was placed in a low-temperature high-speed centrifuge at 4°C and 14000rpm for 15 minutes, the supernatant was discarded, and 200 μL of 70% ethanol solution was added, resuspended, and the supernatant was discarded after centrifugation under the same conditions for 15 minutes. Then, the EP tube was placed at room temperature to allow the ethanol to evaporate completely, and 10-20 μL ddH2O was added. The ssDNA concentration was measured with a micro-nucleic acid analyzer, and the recovery rate was calculated. The secondary library after digestion and purification was stored in a -20°C refrigerator.

[0056] (6) Cyclic screening

[0057] Starting from the second round, the screening incubation system was changed to 300 μL. In order to obtain aptamers with higher affinity, the screening pressure needs to be increased, the amount of ssDNA used is reduced, the target concentration is reduced, and the incubation time is shortened. Starting from the fifth round, a reverse screening is required to eliminate the interference of target analogs. DBP (dibutyl phthalate) was added as the reverse screening target, placed on a shaker at 300 rpm, and incubated at 37 ° C for 2 hours. The supernatant containing ssDNA that specifically binds to the reverse screening target was discarded, the magnetic beads were washed 3 times with binding buffer, and then the positive screening target was added for incubation. The positive screening conditions were exactly the same as the reverse screening. After each incubation and binding, the ssDNA concentration in the supernatant needs to be collected and measured to facilitate the subsequent establishment of a PCR amplification system. The specific screening conditions are shown in Table 1.

[0058] Table 1 Capture-SELEX screening conditions

[0059]

[0060] (7) Calculation of recovery rate

[0061] In each round of ssDNA, ethanol precipitation is used to recover the ssDNA. The ssDNA concentration (ng / μL) is measured with a nucleic acid protein meter. The recovery rate is calculated by calculating the ratio of recovered ssDNA to the input ssDNA. After several rounds of screening, ssDNA that fails to bind to DEHP or has weak binding ability is continuously removed, while ssDNA with high affinity for DEHP is gradually enriched, and the recovery rate continues to increase. When the recovery rate tends to be stable, the screening process is terminated. The purpose of this improved method of alternating positive and negative screening is to inhibit the nonspecific physical adsorption of low-affinity DNA caused by the electrostatic effect of the magnetic beads themselves, and at the same time reduce the cross-reaction of the aptamer to other DEHP analogs (DBP (dibutyl phthalate), DNOP (di-n-octyl phthalate), DEP (diethyl phthalate)). As the screening process increases, the amount of DNA affinity binding increases. For example Figure 1 As shown, the DNA elution rate in the 8th round of elution was close to saturation. Continuing to the 10th round, the DNA elution rate still did not show an obvious increasing trend, so it was decided to send the tenth round of PCR products to sequencing, thus completing the screening stage.

[0062] (8) Verification of each round of screening products

[0063] The PCR amplification products were verified by 2.5% agarose gel electrophoresis. The products purified by enzyme digestion during the 1st to 10th round of screening were subjected to agarose gel electrophoresis. Figure 2 As shown, the products obtained by screening have bands of 80 bp, the correct size, and obvious bands. The final round of screening products can be used for subsequent ligation and transformation.

[0064] Example 2 Cloning, sequencing and structural analysis of DEHP nucleic acid aptamers

[0065] (1) DEHP nucleic acid aptamer cloning and sequencing

[0066] The eluate from the tenth round of screening was selected for symmetrical PCR amplification using downstream primers (5'-TCAAGAGGTAGACGCACATA-3') and cloned for sequencing. The main steps are as follows:

[0067] a. PCR amplification of the ssDNA pooled in the last round of screening using the upstream primer f1 (5'-ATAGGAGTCACGACGACCAG-3') and the downstream primer r1 (5'-TCAAGAGGTAGACGCACATA-3');

[0068] b. The entire amount of the PCR amplification product was loaded onto a 2.5% agarose gel for agarose gel electrophoresis, and the PCR product was recovered using a gel recovery kit.

[0069] c. Refer to the T vector instructions to connect the purified PCR product with the vector, transform into E. coli competent cells, and culture overnight.

[0070] d. The correct transformants were verified by colony PCR and agarose gel analysis, and 50 positive clones were selected and sent to Nanjing Qingke Biotechnology Co., Ltd. for sequence determination.

[0071] The sequences were then analyzed using DNAMAN software, where non-monoclonal sequences and erroneous sequences were removed and 38 nucleic acid aptamer sequences were selected for further detailed analysis. A total of 25 sequences were obtained, named Seq.1 to Seq.25. The sequence results are shown in Table 2.

[0072] Table 2 The tenth round of nucleic acid aptamer sequences

[0073]

[0074]

[0075] (2) Primary characterization of candidate nucleic acid aptamers

[0076] According to RNA structure software, the secondary structure of the aptamer was predicted and the ΔG value was calculated. The smaller the ΔG, the more stable the secondary structure formed by DEHP-ssDNA. Then, the evolutionary tree of these sequences was analyzed. The results are as follows Figure 3As shown, according to the results of the phylogenetic tree homology analysis, non-homologous sequences were selected for affinity and specificity analysis tests, and 6 sequences were finally determined, namely Seq.10, Seq.13, Seq.14, Seq.18, Seq.19, and Seq.22. These 6 sequences represent the intermediate random sequences of nucleic acid aptamers and the number of repetitions are shown in Table 3. At the same time, Figure 4 and Figure 5 The secondary structure diagrams and sequencing chromatograms of the six nucleic acid aptamer sequences are shown respectively.

[0077] Table 3 6 candidate nucleic acid aptamer sequences

[0078]

[0079] Example 3 Analysis of affinity and specificity of nucleic acid aptamers

[0080] (1) Optimization of adsorption conditions of nucleic acid aptamers and graphene oxide

[0081] Graphene oxide (GO) solutions at different concentrations have different effects on the fluorescence quenching of nucleic acid aptamers. Figure 6 As shown in the figure, when the amount of nucleic acid aptamer is constant, the fluorescence quenching efficiency of GO on nucleic acid aptamer increases with the increase of GO solution concentration. When the mass ratio of GO to nucleic acid aptamer reaches 100:1, the adsorption of GO to nucleic acid aptamer reaches saturation, and the fluorescence is basically quenched, with a good effect. Therefore, in the subsequent affinity test, the mass ratio of GO to nucleic acid aptamer is kept at 100:1.

[0082] (2) Determination of the dissociation constant K of candidate aptamer sequences by fluorescence method d value

[0083] The six aptamer sequences with stable secondary structures modified by the fluorescent group 6-carboxyfluorescein (FAM) were labeled with FAM and affinity analysis was performed to verify the affinity of these sequences with DEHP. The specific experimental steps are as follows: First, the FAM-labeled nucleic acid aptamer was pre-denatured at 95°C for 10 minutes, ice-bathed for 10 minutes, and placed at room temperature for 10 minutes. Then the treated FAM-labeled nucleic acid aptamer was added to DEHP solutions of different concentrations (0, 0.4, 1.2, 1.6, 4, 12 μM) and incubated for 1.5 hours at 37°C with light shielding and shaking. After the reaction was completed, a certain amount of GO was added according to the mass ratio of GO to aptamer of 100:1, and incubated for 30 minutes under the same conditions. After the incubation, the above solution was centrifuged at 14000 rpm for 15 minutes, the supernatant was taken, and the fluorescence intensity value of each group was detected by an enzyme marker (emission wavelength 520 nm, excitation wavelength 494 nm). Finally, GraphPad-Prism8 software was used to perform nonlinear fitting of the fluorescence values ​​corresponding to the DEHP concentration, and the dissociation constant K of each aptamer was calculated and analyzed. d The K values ​​of these six aptamer sequences are d The values ​​were between 0.1 and 1.0 μM, indicating that the aptamers we screened had a high affinity for DEHP. d The values ​​are relatively low, showing a strong affinity for the target DEHP. The affinity of these sequences for binding to their target DEHP mainly comes from the fact that there are many target binding sites on the surface of the aptamer, coupled with the unique and complex three-dimensional conformation formed by the interaction between molecules. In addition, the dissociation constant curves of the six nucleic acid aptamers are shown in Figure 7 As shown, when the DEHP concentration was 4 μM, the fluorescence intensity also tended to be stable and the binding reaction reached saturation.

[0084] (3) Fluorescence verification of the specificity of candidate nucleic acid aptamers

[0085] In determining the structural analysis and dissociation constant (K d) value, we need to further verify the specificity of the aptamer. Because the aptamers obtained by SELEX screening not only need to have high affinity and sensitivity with the target, but also need to have good specific recognition ability. Therefore, the specificity of the 6 nucleic acid aptamers obtained above was evaluated. The specific operation is as follows: First, the 6 FAM-labeled nucleic acid aptamers were added to 500μLddH2O at the same concentration (500ng / mL), and then pre-denatured at 95℃ for 10min, ice bathed for 10min, and placed at room temperature for 10min. Then 1.2μM DEHP, DBP (dibutyl phthalate), DNOP (di-n-octyl phthalate), and DEP (diethyl phthalate) were added to the above reaction solution, respectively, and incubated for 1.5h at 37℃ with light shielding and shaking. Subsequently, 50μL GO was added and incubated for 30min under the same conditions. The above mixture was centrifuged at high speed (14000rpm) for 15min. The supernatant was taken and the fluorescence intensity of each group was detected by a microplate reader (emission wavelength 520nm, excitation wavelength 494nm). The DEHP aptamer and graphene oxide mixture reacted competitively with DBP, DNOP and DEP respectively. Finally, the GO solution with DEHP added was used as the background value. It can be seen that the larger the fluorescence value, the stronger the binding ability with the aptamer. Figure 8 As shown, DEHP has the strongest binding ability with SEQ ID No. 10, another DEHP structural analog DBP shows slight binding with SEQ ID No. 10, while DNOP and DEP are negligible. Finally, it is concluded that SEQ ID No. 10 is the best aptamer.

[0086] (4) Molecular docking analysis of Seq-10 and DEHP

[0087] The above-obtained nucleic acid aptamer SEQ ID No.10 was subjected to molecular docking analysis with DEHP, and the specific operations were as follows: The primary structure of the SEQ ID No.10 sequence was analyzed by DNAMAN and SnapGene. The secondary structure of the aptamer was simulated and analyzed by RNA Structure software. Then, the tertiary structure of the aptamer SEQ ID No.10 was simulated by 3dRNA-2.0 software and saved as a pdb file, and the 3D structure of DEHP was obtained from the Pubchem Project website and saved in pdb format. Then, the molecular docking software Auto Dock Tools 1.5.6 was used to perform molecular docking between the aptamer SEQ ID No.10 and DEHP, and then, the results of the molecular docking were analyzed by PyMoL1.7.6 software, and the docking results were exported as a stick model schematic diagram. The docking results are shown in the figure. Fig. 9As shown, it is speculated that the aptamer and the target bind to each other through non-covalent interactions, and the target enters the active site of the aptamer through hydrophobic forces, van der Waals forces, hydrogen bonds, etc. In addition, the results show that the oxygen atoms of the ligand can form hydrogen bonds with the oxygen atoms of T-10 on DNA, and the hydrogen bond length is The formation of hydrogen bonds enhances the ability of the ligand to target DNA. The docking results of SEQ ID No. 10 and DEHP molecules show that the active sites A-9, T-10, and G-18 of the aptamer interact with DEHP. Analysis of these sites can provide technical support for subsequent applications.

Claims

1. A nucleic acid aptamer that specifically recognizes DEHP, characterized in that: The nucleic acid aptamer is a single-stranded DNA sequence such as the nucleotide sequence shown in SEQ ID No.

10.

2. The nucleic acid aptamer according to claim 1, characterized in that The 5' end or 3' end of the nucleotide sequence of the nucleic acid aptamer is modified with a functional group or molecule.

3. The nucleic acid aptamer according to claim 2, characterized in that The functional group is at least one of a fluorescent group, an amino group, a carboxyl group, a sulfhydryl group, biotin, avidin, an electrochemical marker and an enzyme marker.

4. Use of the nucleic acid aptamer according to any one of claims 1 to 3 in separation, enrichment, detection or analysis of DEHP.

5. Use of the nucleic acid aptamer according to any one of claims 1 to 3 in the preparation of a product for separation, enrichment, detection or analysis of DEHP, wherein the product is a kit, a test paper or a chip.

6. A product for detecting DEHP, characterized in that: The product contains the nucleic acid aptamer described in any one of claims 1 to 3, and the product is a kit, a test paper or a chip.

7. A method for detecting DEHP for non-disease diagnosis purposes, characterized in that: The nucleic acid aptamer described in any one of claims 1 to 3, or the product described in claim 6, is used to detect DEHP in the environment, food, tools or biogenic materials.

Images