Antisense oligonucleotides promoting PD-L1 exon 3 skipping and their applications

Abstract

The present invention discloses antisense oligonucleotides that promote PD-L1 exon 3 skipping and their applications, belonging to the field of molecular genetics. The present invention discovered the key regulatory sequence for human PD-L1 exon 3 splicing and developed antisense oligonucleotides that inhibit the splicing of this exon. By promoting PD-L1 exon 3 skipping in cancer cells, PD-L1 can lose its ability to bind to PD-L1 and its immunosuppressive function, thereby inhibiting tumor immune escape and further improving the immunotherapy effect of anti-PD-L1 antibodies. The sequence of the antisense oligonucleotide of the present invention comprises an antisense oligonucleotide sequence that is more than 90% complementary to the bases 325-344 / 405-424 of the PD-L1 gene with Genbank number NM_014143.4 or its corresponding mRNA.

Description

Technical Field

[0001] The present invention relates to the field of molecular genetics, and in particular to antisense oligonucleotides that promote PD-L1 exon 3 skipping and applications thereof. Background Art

[0002] During tumor formation and progression, new tumor antigens emerge. The body's immune system can recognize these antigens and inhibit tumor development. However, tumor cells exploit inhibitory signaling pathway molecules of the immune system, such as PD-L1, PD-1, and CTLA4, to induce immunosuppression and evade immune surveillance. PD-L1 expressed by tumor cells and immunosuppressive cells binds to PD-1 expressed by T cells (particularly CD8+ effector T cells), transmitting immunosuppressive signals that inhibit the proliferation, activation, and tumor cell killing of effector T cells. Immunotherapy with anti-PD-L1 antibodies has been used in the treatment of various cancers and has demonstrated significant therapeutic benefits, but it still faces numerous challenges. Many patients never respond to anti-PD-L1 antibody therapy, or initially respond but then fail to respond to subsequent treatments, leading to immune escape and disease progression or recurrence. Currently, researchers at home and abroad are primarily seeking to improve the efficacy of anti-PD-L1 antibody immunotherapy by optimizing treatment regimens and combining them with other approaches. However, this remains far from ideal, and new technologies and approaches are urgently needed.

[0003] Exon 3 of the PD-L1 gene encodes a key IgV-like functional region that can bind to PD-1 and may be skipped during mRNA splicing ( Figure 1 ). The document “Identification of a novel splice variant of humanPD-L1 mRNA encoding an isoform-lacking Igv-like domain” mentions that PD-L1 without exon 3 (defined as exon 2 in the document) is expressed inside the cell, not on the cell membrane. PD-L1 must be expressed on the cell surface in order to bind to its ligand PD-1 and exert an immunosuppressive effect. In other words, PD-L1 without exon 3 will lose its ability to bind to PD-L1 and its immunosuppressive function. Therefore, by promoting PD-L1 exon 3 skipping in cancer cells, the production of PD-L1 with immunosuppressive function containing exon 3 can be reduced, thereby inhibiting tumor immune escape. However, the regulatory mechanism of exon 3 skipping is still unclear, and there is no related anti-PD-L1 method. Summary of the Invention

[0004] In order to solve the above problems, the present invention has discovered the key regulatory sequence of human PD-L1 exon 3 splicing through research, and provides antisense oligonucleotides and applications thereof that promote PD-L1 exon 3 skipping.

[0005] Specifically, the present invention first provides an antisense oligonucleotide, the sequence of which comprises:

[0006] An antisense oligonucleotide sequence that is more than 90% complementary to bases 325-344 (CGGCTGTTGAAGGACCAGCT) of the PD-L1 gene with Genbank number NM_014143.4 or its corresponding mRNA; and / or,

[0007] The antisense oligonucleotide sequence has more than 90% complementarity with bases 405-424 (CCGCTGCATGATCAGCTATG) of the PD-L1 gene with Genbank number NM_014143.4 or its corresponding mRNA.

[0008] Because there are many versions of a single gene sequence, the position of the starting base may be inconsistent in different versions. Therefore, for the convenience of describing the base sequence, the present invention defines the PD-L1 gene with Genbank number NM_014143.4 as the benchmark. In fact, those skilled in the art can find the corresponding base sequence in other versions of the PD-L1 gene sequence based on the above definition, and such sequences are also within the scope of protection of the present invention.

[0009] Preferably, the antisense oligonucleotide sequence comprises at least one antisense oligonucleotide sequence as shown in SEQ ID No. 102-122.

[0010] More preferably, the sequence of the antisense oligonucleotide comprises at least one of the following antisense oligonucleotide sequences:

[0011] 5'-AGCTGGTCCTTCAACAGCCG-3' (SEQ ID No. 105);

[0012] 5'-CATAGCTGATCATGCAGCGG-3' (SEQ ID No. 115).

[0013] Those skilled in the art can adjust the base modification method based on common knowledge. As long as the antisense oligonucleotide has the above sequence, it can promote PD-L1 exon 3 skipping.

[0014] Preferably, all bases of the antisense oligonucleotide are modified with 2'-methoxyethyl and thio groups.

[0015] The present invention further provides a composition comprising the antisense oligonucleotide and a pharmaceutically acceptable excipient.

[0016] Preferably, the composition is formulated so that when administered in combination with an anti-PD-L1 antibody, it can reduce PD-L1-related immune escape, which is more conducive to the therapeutic effect of the anti-PD-L1 antibody.

[0017] The present invention further provides use of the antisense oligonucleotide in the preparation of a drug for promoting PD-L1 exon 3 skipping.

[0018] The present invention further provides use of the antisense oligonucleotide in the preparation of a drug for inhibiting the binding between PD-L1 and PD-1.

[0019] The present invention further provides use of the antisense oligonucleotide in the preparation of a drug for reducing the immunosuppressive function of PD-L1.

[0020] The present invention further provides the use of the antisense oligonucleotide in preparing drugs for treating tumors.

[0021] Preferably, the tumor cells express PD-L1.

[0022] Preferably, the tumor includes oral cancer, breast cancer, lung cancer, cervical cancer, pharyngeal cancer, myeloma and the like.

[0023] The "PD-L1" mentioned in the present invention is human PD-L1.

[0024] Based on the above technical solution, the beneficial effects of the present invention are as follows:

[0025] The present invention discovered the key regulatory sequence for the splicing of human PD-L1 exon 3 and developed antisense oligonucleotides that inhibit the splicing of this exon. By promoting PD-L1 exon 3 skipping in cancer cells, PD-L1 can lose its ability to bind to PD-L1 and its immunosuppressive function, thereby inhibiting tumor immune escape and further improving the immunotherapy effect of anti-PD-L1 antibodies. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Exon 3 of the human PD-L1 gene encodes an important IgV-like region that can be skipped to produce a shorter isoform 2. Boxes represent exons, solid lines between boxes represent introns, and dotted lines above introns indicate the direction of RNA splicing.

[0027] Figure 2Human PD-L1 exon 3 contains a splicing enhancer element that promotes splicing. Figure A shows a schematic diagram of the human PD-L1 mini-gene expression plasmid. Figure B shows RT-PCR analysis of alternative splicing in exon 3. The right side shows a schematic diagram of RNA splicing and PCR products. The dashes above and below the exon indicate the upstream and downstream primers used in the PCR. Figure C shows the isoform 1 / isoform 2 ratio, derived from two combined experiments.

[0028] Figure 3 Screening of antisense oligonucleotides. Panel A shows antisense oligonucleotides designed for two splicing enhancer elements. Panel B shows 293 cells transfected with a synthetic thiophosphate-modified antisense oligonucleotide targeting splicing enhancer element 1 and a PD-L1 minigene, followed by RT-PCR analysis of PD-L1 RNA levels. Panel C shows the results from two experiments. Panel D shows 293 cells transfected with a synthetic thiophosphate-modified antisense oligonucleotide targeting splicing enhancer element 2 and a PD-L1 minigene, followed by RT-PCR analysis of PD-L1 RNA levels. Panel E shows the results from two experiments. NS is a nonspecific antisense oligonucleotide with the sequence CTCATTCCTACCGACACCCC.

[0029] Figure 4 Figure 1 shows antisense oligonucleotides promoting exon 3 skipping. Panel A shows the effects of antisense oligonucleotides binding to splicing enhancers. Panel B shows RT-PCR results after transfection of oral cancer cells SCC-9 and CAL 27, and breast cancer cells MCF-7, with mt21 ASO and mt29 ASO. NS denotes a nonspecific antisense oligonucleotide.

[0030] Figure 5 Figure 3. Flow cytometric analysis of oral squamous cell carcinoma cells SCC-9 or CAL 27 transfected with the antisense oligonucleotides mt21 ASO or mt29 ASO. The isotype control is the negative control for anti-PD-L1 antibody. NS is a nonspecific antisense oligonucleotide. The histogram on the right is the statistical results of three repeated experiments.

[0031] Figure 6 RT-PCR results of human lung cancer cells H1264 and H1299 transfected with antisense oligonucleotides mt21 and mt29; NS indicates nonspecific antisense oligonucleotide.

[0032] Figure 7 Figure 3 shows the RT-PCR results after transfection of antisense oligonucleotides mt21 ASO and mt29 ASO in human cervical cancer cells Ca Ski; NS is a nonspecific antisense oligonucleotide.

[0033] Figure 8Figure 3 shows the RT-PCR results after transfection of antisense oligonucleotides mt21 ASO and mt29 ASO in human pharyngeal carcinoma cells FaDu; NS is a nonspecific antisense oligonucleotide.

[0034] Figure 9 Figure 5 shows the RT-PCR results after transfection of antisense oligonucleotides mt21 ASO and mt29 ASO in human myeloma U2OS cells; NS is a nonspecific antisense oligonucleotide. DETAILED DESCRIPTION

[0035] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0036] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0037] Example 1 Discovery of key sequences that enhance PD-L1 exon 3 skipping

[0038] Exons with alternative splicing may carry some sequences (or elements) that regulate splicing. This example uses a mutation method to find these elements. A fragment of exon 2, intron 2, exon 3, part of intron 3, and part of exon 4 of human PD-L1 was obtained from oral cancer cell CAL 27 by PCR (the PCR primers used were: 5'-TTCCGGCTAGCGGCATTCCAGAAAGATGAGGAT-3', 5'-GCTCTGTGTTGTTTGTCTCTGGAT-3'; 5'-TTCCGGAATTCAGGTGTTCCCCACGGCTGA-3', and 5'-TCCTCTCTCTTGGAATTGGTGGTG-3', respectively). The fragment containing exon 2, intron 2, exon 3, part of intron 3, and part of exon 4 (SEQ ID No. 1) was first cloned into the CMV promoter of pEGFP-N1 via the NheI and EcoRI sites to obtain a recombinant plasmid; then the fragment containing part of intron 3 and part of exon 4 (SEQ ID No. 1) was cloned into the CMV promoter of pEGFP-N1 via the EcoRI and BamHI sites. No.2) was cloned into the above recombinant plasmid to obtain an expression plasmid carrying exon 2, intron 2, exon 3, part of intron 3 and part of exon 4. The plasmid expresses the mRNA of human PD-L1 exons 2 to 4 and is a mini gene (Mini) that can simulate the alternative splicing of PD-L1 exon 3. Figure 2After the minigene was introduced into cells, mRNA containing or excluding exon 3 was produced. Then, the 342-bp exon 3 sequence was serially mutated every 10 bases in the minigene, resulting in a total of 33 mutants (mt1 to mt33) ( Figure 2 The corresponding unmutated (wt) sequence in PD-L1 exon 3 and the primers for constructing mutants are shown in SEQ ID Nos. 3-101, respectively. Each mutant corresponds to two mutant primers. For example, SEQ ID No. 3 is the unmutated (wt) sequence of mt1 in PD-L1 exon 3, and SEQ ID Nos. 4-5 are primers for constructing mt1; SEQ ID No. 6 is the unmutated (wt) sequence of mt2 in PD-L1 exon 3, and SEQ ID Nos. 7-8 are primers for constructing mt2; and so on. These plasmids were transfected into 293 cells, and the splicing changes of exon 3 were detected by RT-PCR. The results showed that the 21st (mt21, mutated from CTGTTGAAGG to GTCTAGTACG) and 29th (mt29, mutated from CTGCATGATC to GTCCTTCAAC) mutations led to a significant decrease in the expression of the full-length isoform 1, while the expression of the isoform 2 without exon 3 was relatively increased (i.e., the ratio of isoform 1 to isoform 2 expression was significantly reduced) ( Figure 2 The results (Figures B-C in the middle) suggest that the sequences at these two sites are key splicing enhancer elements (ESEs) that enhance the splicing of exon 3. They were named splicing enhancer element 1 (ESE1) and splicing enhancer element 2 (ESE2), respectively.

[0039] Example 2: Design Method of Antisense Oligonucleotides

[0040] Antisense oligonucleotides are synthetic single-stranded oligonucleotides that are complementary to target genes or mRNAs and possess excellent specificity and safety. An increasing number of antisense oligonucleotides are being used to treat diseases. Based on previous research experience, 2'-O-methoxyethyl (MOE) and thiolated antisense oligonucleotides, unlike those typically used for gene silencing, have been synthesized. These antisense oligonucleotides can bind to target RNA to exert steric hindrance while not inducing RNase H, thus preventing target RNA degradation. These antisense oligonucleotides are well-suited for regulating RNA alternative splicing.

[0041] An important factor influencing the design of antisense oligonucleotides for the two splicing enhancement elements found in Example 1 is that the antisense oligonucleotides should be able to bind to these two sites on the mRNA of PD-L1. Due to the complex secondary structure of RNA, it will significantly affect the binding of antisense oligonucleotides, and further screening of suitable antisense oligonucleotides is required. However, the synthesis cost of antisense oligonucleotides modified with 2'-methoxyethyl (2'-O-methoxyethyl, MOE) and thioate is very high and not suitable for large-scale screening. Therefore, the present invention synthesized antisense oligonucleotides that were only thioate-modified to screen for antisense oligonucleotide sequences that can bind to the mRNA of PD-L1. If such an antisense oligonucleotide can bind to RNA, it will induce the action of RNase H, leading to the degradation of the target RNA, which can clearly indicate the sequence information of the antisense oligonucleotide that can bind to the mRNA of PD-L1. Therefore, based on the sequences of PD-L1 corresponding to mt21 and mt29, a series of antisense oligonucleotides with only thiolation modifications were designed and optimized, among which the sequences of mt21-1 to mt21-10 are shown in SEQ ID No.102 to 111, respectively, and the sequences of mt29-1 to mt29-11 are shown in SEQ ID No.112 to 122, respectively. 293 cells were transfected with the minigene, RNA was extracted the next day, and the RNA level of PD-L1 was detected by RT-PCR. The results showed that the two antisense oligonucleotides, mt21-4 and mt29-4, caused the most significant decrease in the RNA level of PD-L1, indicating that these two antisense oligonucleotides have the best ability to bind to the mRNA of PD-L1 ( Figure 3 ).

[0042] Based on the sequences of mt21-4 and mt29-4 screened above, two antisense oligonucleotides mt21 ASO and mt29 ASO with 2'-methoxyethyl (MOE) and thiolation modifications were synthesized, respectively. The sequences are:

[0043] 5'-AGCTGGTCCTTCAACAGCCG-3' (SEQ ID No. 105);

[0044] 5'-CATAGCTGATCATGCAGCGG-3' (SEQ ID No. 115).

[0045] Example 3: Promoting PD-L1 exon 3 skipping using antisense oligonucleotides

[0046] like Figure 4 Figure A shows that antisense oligonucleotides bind to the splicing enhancer and block its splicing-promoting effect, thereby promoting exon 3 skipping and resulting in decreased expression of PD-L1 isoform 1.

[0047] In oral cancer cells SCC-9 and CAL 27, and breast cancer cells MCF-7, full-length PD-L1 (subtype 1) is mainly expressed, and subtype 2 is difficult to detect when the number of PCR cycles is low. Cells were transfected with mt21 ASO and mt29 ASO, and RNA was extracted the next day. The RNA level of PD-L1 was detected by RT-PCR (primers 5'-CATGACCTACTGGCATTTGCTG-3' and 5'-CCACTCAGGACTTGATGGTCACT-3'). The results showed that the level of full-length PD-L1 (subtype 1) decreased significantly, and the level of subtype 2 increased significantly, indicating that the skipping of exon 3 increased significantly ( Figure 4 (Figure B).

[0048] Oral squamous cell carcinoma cells SCC-9 or CAL 27 were transfected with antisense oligonucleotides mt21 ASO or mt29 ASO targeting the PD-L1 exon 3 splicing enhancer element. A nonspecific antisense oligonucleotide NS (sequence: CTCATTCCTACCGACACCCC) was used as a control. Two days later, cell surface PD-L1 expression was detected by flow cytometry, expressed as the PD-L1 positive rate. The isotype control was a negative control for anti-PD-L1 antibodies. Results ( Figure 5 ) found that after oral cancer cells CAL 27 and SCC-9 were transfected with mt21 ASO and mt29 ASO, the level of PD-L1 on the cell surface was significantly decreased.

[0049] The above results show that antisense oligonucleotides designed against the two exon splicing enhancers of PD-L1 exon 3 can effectively promote exon 3 skipping, thereby reducing the expression of full-length functional PD-L1.

[0050] Example 4 Application of antisense oligonucleotides in lung cancer cells, cervical cancer cells, pharyngeal cancer cells, and myeloma cells

[0051] In lung cancer cells H1264 and H1299 ( Figure 6 )、Cervical cancer cells Ca Ski( Figure 7 ) pharyngeal cancer cell FaDu( Figure 8 ) and myeloma cells U2OS ( Figure 9 ) were transfected with mt21 ASO and mt29 ASO, and a nonspecific antisense oligonucleotide (NS) was used as a control. RNA was extracted the day after transfection, and PD-L1 RNA levels were measured by RT-PCR. The results showed that mt21 ASO and mt29 ASO also effectively promoted exon 3 skipping, indicating that this method of inhibiting PD-L1 exon 3 splicing is effective in various cancers.

[0052] In addition, referring to the methods of Examples 3 and 4, the present invention also conducted experiments on antisense oligonucleotides of other sequences in SEQ ID No. 102 to 122, and the effects thereof were slightly worse than those of the antisense oligonucleotides of sequences such as SEQ ID No. 105 and SEQ ID No. 115, and the trends were similar to those of the present invention. Figure 3 The same trend in .

[0053] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein. Sequence Listing <110> Wuhan University <120> Antisense oligonucleotides promoting PD-L1 exon 3 skipping and their applications <160> 122 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1463 <212> DNA <213> Artificial Sequence <400> 1 ggcattccag aaagatgagg atatttgctg tctttatatt catgacctac tggcatttgc 60 tgaacggtaa gacaccaaat ccttccatta ggttctatat tttaaatatt ttaaccatga 120 gtttaaaact aaaatgatca tttaaaatgc atgcaatttt cttatagaga gaacattcta 180 ttctttcttc tactttacac aatggcaaag tcttctttct actttacgca atgataaagt 240 tacctgtgtc attttgtaaa aatatagaga atatagacaa attgaaagac acaaaataat 300 ctattaccca tttcccaggg ttaactactg aaaatatctg gggaaatggc ctgtatgtat 360 acatttattt gtttgctttc aacaaggcca agatcctttg atctttcagt cttggttgct 420 ctgtgacatg cctttcctga tgaggatact ttaaggaaga attgtaagat acatggaaaa 480 tgtcaggcta acacagtact ggcatcaccc tgtgctcttt cctgaactcc ataccaatgt 540 acttcttgcc agaaaactga tcaaaagttt agggaagtaa aaagagatga ctgttagaat 600 ctaccattcc ctctatgtag gaagcaaata ggtgtcctgt caaaggacat tctggggatg 660 tctacatgaa accaagtctc cctggttgta aggactccat ctccatataa tatttataca 720 gtaatatatg tttataaatt gtgggggcaa cttgtttagc taattttatt attctgctat 780 tgggacactg tgtctcagca tgagatatag tgtcccaaaa catatttcaa gcccattgga 840 taaaatatgt gtttagcaag ttcttaaata taatgataac ataaccgacc agataaagtg 900 atttataaac gctgtgccaa ttttgtaaat gtttcgagga attttccctt ttctgaagat 960 tgtccttctt tctttttagc atttactgtc acggttccca aggacctata tgtggtagag 1020 tatggtagca atatgacaat tgaatgcaaa ttcccagtag aaaaacaatt agacctggct 1080 gcactaattg tctattggga aatggaggat aagaacatta ttcaatttgt gcatggagag 1140 gaagacctga aggttcagca tagtagctac agacagaggg cccggctgtt gaaggaccag 1200 ctctccctgg gaaatgctgc acttcagatc acagatgtga aattgcagga tgcaggggtg 1260 taccgctgca tgatcagcta tggtggtgcc gactacaagc gaattactgt gaaagtcaat 1320 ggtaagaatt attatagatg agaggcctga tctttattga aaacatattc caagtgttga 1380 agacttttca ttcttgtaag tccatactta ttttcaaaca gaacagcata gtctgttcat 1440 tcattcattc aattcatgaa ttc 1463 <210> 2 <211> 321 <212> DNA <213> Artificial Sequence <400> 2 aggtgttccc cacggctgag gcatctgaac attaagcata tccctctgag aaccagcctg 60 cattgatact ctttctaatg tggacagcat caagctatgt acgtagttct gtgctcagca 120 aaagccctga cttctttttg tttatgtcct agccccatac aacaaaatca accaaagaat 180 tttggttgtg gatccagtca cctctgaaca tgaactgaca tgtcaggctg agggctaccc 240 caaggccgaa gtcatctgga caagcagtga ccatcaagtc ctgagtggta agaccaccac 300 caccaattcc aagagagagg a 321 <210> 3 <211> 41 <212> DNA <213> Artificial Sequence <400> 3 ctttcttttt agcatttact gtcacggttc ccaaggacct a 41 <210> 4 <211> 41 <212> DNA <213> Artificial Sequence <400> 4 ctttcttttt agcattttca gactccgttc ccaaggacct a 41 <210> 5 <211> 41 <212> DNA <213> Artificial Sequence <400> 5​​​​​​​​​​​​​​​​​​​<212> DNA <213> Artificial Sequence <400> 7 gcatttactg tcacggatgc gatgcaccta tatgtggtag 40 <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <400> 8 ctaccacata taggtgcatc gcatccgtga cagtaaatgc 40 <210> 9 <211> 40 <212> DNA <213> Artificial Sequence <400> 9 tcacggttcc caaggaccta tatgtggtag agtatggtag 40 <210> 10 <211> 40 <212> DNA <213> Artificial Sequence <400> 10 tcacggttcc caaggagcaa aaagaggtag agtatggtag 40 <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <400> 11 ctaccatactctacctctttttgctccttgggaaccgtga 40 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <400> 12 caaggaccta tatgtggtag agtatggtag caatatgaca 40 <210> 13 <211> 40 <212> DNA <213> Artificial Sequence <400> 13 caaggaccta tatgtgcttg tgaaaggtag caatatgaca 40 <210> 14 <211> 40 <212> DNA <213> Artificial Sequence <400> 14 tgtcatattg ctacctttca caagcacata taggtccttg 40 <210> 15 <211> 40 <212> DNA <213> Artificial Sequence <400> 15 tatgtggtag agtatggtag caatatgaca attgaatgca 40 <210> 16 <211> 40 <212> DNA <213> Artificial Sequence <400> 16 tatgtggtag agtatgcttg gattttgaca attgaatgca 40 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <400> 17 tgcattcaat tgtcaaaatc caagcatact ctaccacata 40 <210> 18 <211> 41 <212> DNA <213> Artificial Sequence <400> 18 agtatggtag caatatgaca attgaatgca aattcccagt a 41 <210> 19 <211> 41 <212> DNA <213> Artificial Sequence <400> 19 agtatggtag caatatcaga ttagtatgca aattcccagt a 41 <210> 20 <211> 41 <212> DNA <213> Artificial Sequence <400> 20 tactgggaat ttgcatacta atctgatatt gctaccatac t 41 <210> twenty one <211> 40 <212> DNA <213> Artificial Sequence <400> twenty one caatatgaca attgaatgca aattcccagt agaaaaacaa 40 <210> twenty two <211> 40 <212> DNA <213> Artificial Sequence <400> twenty two caatatgaca attgaaagga taatgccagt agaaaaacaa 40 <210> twenty three <211> 40 <212> DNA <213> Artificial Sequence <400> twenty three ttgtttttct actggcatta tcctttcaat tgtcatattg 40 <210> twenty four <211> 40 <212> DNA <213> Artificial Sequence <400> twenty four attgaatgca aattcccagt agaaaaacaa ttagacctgg 40 <210> 25 <211> 40 <212> DNA <213> Artificial Sequence <400> 25 attgaatgca aattccgact tgtataacaa ttagacctgg 40 <210> 26 <211> 40 <212> DNA <213> Artificial Sequence <400> 26 ccaggtctaa ttgttataca agtcggaatt tgcattcaat 40 <210> 27 <211> 40 <212> DNA <213> Artificial Sequence <400> 27 aattcccagt agaaaaacaa ttagacctgg ctgcactaat 40 <210> 28 <211> 40 <212> DNA <213> Artificial Sequence <400> 28 aattcccagt agaaaatcta cttgtcctgg ctgcactaat 40 <210> 29 <211> 40 <212> DNA <213> Artificial Sequence <400> 29 attagtgcag ccaggacaag tagattttct actgggaatt 40 <210> 30 <211> 40 <212> DNA <213> Artificial Sequence <400> 30 agaaaaacaa ttagacctgg ctgcactaat tgtctattgg 40 <210> 31 <211> 40 <212> DNA <213> Artificial Sequence <400> 31 agaaaaacaa ttagacgtcg gtcctctaat tgtctattgg 40 <210> 32 <211> 40 <212> DNA <213> Artificial Sequence <400> 32 ccaatagaca attagaggac cgacgtctaa ttgtttttct 40 <210> 33 <211> 41 <212> DNA <213> Artificial Sequence <400> 33 ttagacctgg ctgcactaat tgtctattgg gaaatggagg a 41 <210> 34 <211> 41 <212> DNA <213> Artificial Sequence <400> 34 ttagacctgg ctgcacgatt agacaattgg gaaatggagg a 41 <210> 35 <211> 41 <212> DNA <213> Artificial Sequence <400> 35 tcctccattt cccaattgtc taatcgtgca gccaggtcta a 41 <210> 36 <211> 41 <212> DNA <213> Artificial Sequence <400> 36 ctgcactaat tgtctattgg gaaatggagg ataagaacat t 41 <210> 37 <211> 41 <212> DNA <213> Artificial Sequence <400> 37 ctgcactaat tgtctatagc gtattcgagg ataagaacat t 41 <210> 38 <211> 41 <212> DNA <213> Artificial Sequence <400> 38 aatgttctta tcctcgaata cgctatatagac aattagtgca g 41 <210> 39 <211> 41 <212> DNA <213> Artificial Sequence <400> 39 tgtctattgg gaaatggagg ataagaacat tattcaattt g 41 <210> 40 <211> 41 <212> DNA <213> Artificial Sequence <400> 40 tgtctattgg gaaatggtgc aaatgtacat tattcaattt g 41 <210> 41 <211> 41 <212> DNA <213> Artificial Sequence <400> 41 caaattgaat aatgtacatt tgcaccattt cccaatagac a 41 <210> 42 <211> 41 <212> DNA <213> Artificial Sequence <400> 42 gaaatggagg ataagaacat tattcaattt gtgcatggag a 41 <210> 43 <211> 41 <212> DNA <213> Artificial Sequence <400> 43 gaaatggagg ataagaagaa tgtactattt gtgcatggag a 41 <210> 44 <211> 41 <212> DNA <213> Artificial Sequence <400> 44 tctccatgca caaatagtac attcttctta tcctccattt c 41 <210> 45 <211> 40 <212> DNA <213> Artificial Sequence <400> 45 taagaacatt attcaatttg tgcatggaga ggaagacctg 40 <210> 46 <211> 40 <212> DNA <213> Artificial Sequence <400> 46 taagaacatt attcaaatag aggaaggaga ggaagacctg 40 <210> 47 <211> 40 <212> DNA <213> Artificial Sequence <400> 47 caggtcttcc tctccttcctctatttgaat aatgttctta 40 <210> 48 <211> 40 <212> DNA <213> Artificial Sequence <400> 48 attcaatttg tgcatggaga ggaagacctg aaggttcagc 40 <210> 49 <211> 40 <212> DNA <213> Artificial Sequence <400> 49 attcaatttg tgcatgcaca cgtacacctg aaggttcagc 40 <210> 50 <211> 40 <212> DNA <213> Artificial Sequence <400> 50 gctgaacctt caggtgtacg tgtgcatgca caaattgaat 40 <210> 51 <211> 40 <212> DNA <213> Artificial Sequence <400> 51 tgcatggaga ggaagacctg aaggttcagc atagtagcta 40 <210> 52 <211> 40 <212> DNA <213> Artificial Sequence <400> 52 tgcatggaga ggaagagcag tacgatcagc atagtagcta 40 <210> 53 <211> 40 <212> DNA <213> Artificial Sequence <400> 53 tagctactat gctgatcgta ctgctcttcc tctccatgca 40 <210> 54 <211> 40 <212> DNA <213> Artificial Sequence <400> 54 ggaagacctg aaggttcagc atagtagcta cagacagagg 40 <210> 55 <211> 40 <212> DNA <213> Artificial Sequence <400> 55 ggaagacctg aaggttgacc tttgaagcta cagacagagg 40 <210> 56 <211> 40 <212> DNA <213> Artificial Sequence <400> 56 cctctgtctg tagcttcaaa ggtcaacctt caggtcttcc 40 <210> 57 <211> 40 <212> DNA <213> Artificial Sequence <400> 57 aaggttcagc atagtagcta cagacagagg gcccggctgt 40 <210> 58 <211> 40 <212> DNA <213> Artificial Sequence <400> 58 aaggttcagc atagtaccaa gacagagagg gcccggctgt 40 <210> 59 <211> 40 <212> DNA <213> Artificial Sequence <400> 59 acagccgggc cctctctgtc ttggtactat gctgaacctt 40 <210> 60 <211> 40 <212> DNA <213> Artificial Sequence <400> 60 atagtagcta cagacagagg gcccggctgt tgaaggacca 40 <210> 61 <211> 40 <212> DNA <213> Artificial Sequence <400> 61 atagtagcta cagacacacg tcgctgctgt tgaaggacca 40 <210> 62 <211> 40 <212> DNA <213> Artificial Sequence <400> 62 tggtccttca acagcagcga cgtgtgtctg tagctactat 40 <210> 63 <211> 40 <212> DNA <213> Artificial Sequence <400> 63 cagacagagg gcccggctgt tgaaggacca gctctccctg 40 <210> 64 <211> 40 <212> DNA <213> Artificial Sequence <400> 64 cagacagagg gcccgggtct agtacgacca gctctccctg 40 <210> 65 <211> 40 <212> DNA <213> Artificial Sequence <400> 65 cagggaggc tggtcgtact agacccgggc cctctgtctg 40 <210> 66 <211> 40 <212> DNA <213> Artificial Sequence <400> 66 gcccggctgt tgaaggacca gctctccctg ggaaatgctg 40 <210> 67 <211> 40 <212> DNA <213> Artificial Sequence <400> 67 gcccggctgt tgaaggtcga ccacgccctg ggaaatgctg 40 <210> 68 <211> 40 <212> DNA <213> Artificial Sequence <400> 68 cagcatttcc cagggcgtgg tcgaccttca acagccgggc 40 <210> 69 <211> 40 <212> DNA <213> Artificial Sequence <400> 69 tgaaggacca gctctccctg ggaaatgctg cacttcagat 40 <210> 70 <211> 40 <212> DNA <213> Artificial Sequence <400> 70 tgaaggacca gctctcgcag cgtattgctg cacttcagat 40 <210> 71 <211> 40 <212> DNA <213> Artificial Sequence <400> 71 atctgaagtg cagcaatacg ctgcgagagc tggtccttca 40 <210> 72 <211> 40 <212> DNA <213> Artificial Sequence <400> 72 gctctccctg ggaaatgctg cacttcagat cacagatgtg 40 <210> 73 <211> 40 <212> DNA <213> Artificial Sequence <400> 73 gctctccctg ggaaatccag gagtacagat cacagatgtg 40 <210> 74 <211> 40 <212> DNA <213> Artificial Sequence <400> 74 cacatctgtg atctgtactc ctggatttcc cagggagagc 40 <210> 75 <211> 40 <212> DNA <213> Artificial Sequence <400> 75 ggaaatgctg cacttcagat cacagatgtg aaattgcagg 40 <210> 76 <211> 40 <212> DNA <213> Artificial Sequence <400> 76 ggaaatgctg cacttctgtt gagacatgtg aaattgcagg 40 <210> 77 <211> 40 <212> DNA <213> Artificial Sequence <400> 77 cctgcaattt cacatgtctc aacagaagtg cagcatttcc 40 <210> 78 <211> 40 <212> DNA <213> Artificial Sequence <400> 78 cacttcagat cacagatgtg aaattgcagg atgcaggggt 40 <210> 79 <211> 40 <212> DNA <213> Artificial Sequence <400> 79 cacttcagat cacagaagag tattagcagg atgcaggggt 40 <210> 80 <211> 40 <212> DNA <213> Artificial Sequence <400> 80 acccctgcat cctgctaata ctcttctgtg atctgaagtg 40 <210> 81 <211> 40 <212> DNA <213> Artificial Sequence <400> 81 cacagatgtg aaattgcagg atgcaggggt gtaccgctgc 40 <210> 82 <211> 40 <212> DNA <213> Artificial Sequence <400> 82 cacagatgtg aaattggacg ttcctggggt gtaccgctgc 40 <210> 83 <211> 40 <212> DNA <213> Artificial Sequence <400> 83 gcagcggtac accccaggaa cgtccaattt cacatctgtg 40 <210> 84 <211> 40 <212> DNA <213> Artificial Sequence <400> 84 aaattgcagg atgcaggggt gtaccgctgc atgatcagct 40 <210> 85 <211> 40 <212> DNA <213> Artificial Sequence <400> 85 aaattgcagg atgcagcgct cttcggctgc atgatcagct 40 <210> 86 <211> 40 <212> DNA <213> Artificial Sequence <400> 86 agctgatcat gcagccgaag agcgctgcat cctgcaattt 40 <210> 87 <211> 40 <212> DNA <213> Artificial Sequence <400> 87 atgcaggggt gtaccgctgc atgatcagct atggtggtgc 40 <210> 88 <211> 40 <212> DNA <213> Artificial Sequence <400> 88 atgcaggggt gtaccggtcc ttcaacagct atggtggtgc 40 <210> 89 <211> 40 <212> DNA <213> Artificial Sequence <400> 89 gcaccaccat agctgttgaa ggaccggtac acccctgcat 40 <210> 90 <211> 40 <212> DNA <213> Artificial Sequence <400> 90 gtaccgctgc atgatcagct atggtggtgc cgactacaag 40 <210> 91 <211> 40 <212> DNA <213> Artificial Sequence <400> 91 gtaccgctgc atgatctggt ttcgaggtgc cgactacaag 40 <210> 92 <211> 40 <212> DNA <213> Artificial Sequence <400> 92 cttgtagtcg gcacctcgaa accagatcat gcagcggtac 40 <210> 93 <211> 40 <212> DNA <213> Artificial Sequence <400> 93 atgatcagct atggtggtgc cgactacaag cgaattactg 40 <210> 94 <211> 40 <212> DNA <213> Artificial Sequence <400> 94 atgatcagct atggtgctcc ggtcaacaag cgaattactg 40 <210> 95 <211> 40 <212> DNA <213> Artificial Sequence <400> 95 cagtaattcg cttgttgacc ggagcaccat agctgatcat 40 <210> 96 <211> 41 <212> DNA <213> Artificial Sequence <400> 96 atggtggtgc cgactacaag cgaattactg tgaaagtcaa t 41 <210> 97 <211> 41 <212> DNA <213> Artificial Sequence <400> 97 atggtggtgc cgactagatg ggtaatactg tgaaagtcaa t 41 <210> 98 <211> 41 <212> DNA <213> Artificial Sequence <400> 98 attgactttc acagtattac ccatctagtc ggcaccacca t 41 <210> 99 <211> 40 <212> DNA <213> Artificial Sequence <400> 99 cgactacaag cgaattactg tgaaagtcaa tggtaagaat 40 <210> 100 <211> 40 <212> DNA <213> Artificial Sequence <400> 100 cgactacaag cgaatttcag agtatgtcaa tggtaagaat 40 <210> 101 <211> 40 <212> DNA <213> Artificial Sequence <400> 101 attcttacca ttgacatact ctgaaattcg cttgtagtcg 40 <210> 102 <211> 20 <212> DNA <213> Artificial Sequence <400> 102 gagagctggt ccttcaacag 20 <210> 103 <211> 20 <212> DNA <213> Artificial Sequence <400> 103 agagctggtc cttcaacagc 20 <210> 104 <211> 20 <212> DNA <213> Artificial Sequence <400> 104 gagctggtcc ttcaacagcc 20 <210> 105 <211> 20 <212> DNA <213> Artificial Sequence <400> 105 agctggtcct tcaacagccg 20 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <400> 106 gctggtcctt caacagccgg 20 <210> 107 <211> 20 <212> DNA <213> Artificial Sequence <400> 107 ctggtccttc aacagccggg 20 <210> 108 <211> 20 <212> DNA <213> Artificial Sequence <400> 108 tggtccttca acagccgggc 20 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <400> 109 ggtccttcaa cagccgggcc 20 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <400> 110 gtccttcaac agccgggccc 20 <210> 111 <211> 20 <212> DNA <213> Artificial Sequence <400> 111 tccttcaaca gccgggccct 20 <210> 112 <211> 20 <212> DNA <213> Artificial Sequence <400> 112 caccatagct gatcatgcag 20 <210> 113 <211> 20 <212> DNA <213> Artificial Sequence <400> 113 accatagctg atcatgcagc 20 <210> 114 <211> 20 <212> DNA <213> Artificial Sequence <400> 114 ccatagctga tcatgcagcg 20 <210> 115 <211> 20 <212> DNA <213> Artificial Sequence <400> 115 catagctgat catgcagcgg 20 <210> 116 <211> 20 <212> DNA <213> Artificial Sequence <400> 116 atagctgatc atgcagcggt 20 <210> 117 <211> 20 <212> DNA <213> Artificial Sequence <400> 117 tagctgatca tgcagcggta 20 <210> 118 <211> 20 <212> DNA <213> Artificial Sequence <400> 118 agctgatcat gcagcggtac 20 <210> 119 <211> 20 <212> DNA <213> Artificial Sequence <400> 119 gctgatcatg cagcggtaca 20 <210> 120 <211> 20 <212> DNA <213> Artificial Sequence <400> 120 ctgatcatgc agcggtacac 20 <210> 121 <211> 20 <212> DNA <213> Artificial Sequence <400> 121 tgatcatgca gcggtacacc 20 <210> 122 <211> 20 <212> DNA <213> Artificial Sequence <400> 122 gatcatgcag cggtacaccc 20

Claims

1. An antisense oligonucleotide, characterized in that Its sequence is 5'-AGCTGGTCCTTCAACAGCCG-3'.

2. The antisense oligonucleotide according to claim 1, characterized in that All of its bases are modified with 2'-methoxyethyl and thio groups.

3. A composition, characterized in that The invention comprises the antisense oligonucleotide according to claim 1 or 2 and a pharmaceutically acceptable excipient.

4. The composition according to claim 3, characterized in that The composition is formulated for administration in combination with an anti-PD-L1 antibody.

5. Use of the antisense oligonucleotide according to claim 1 or 2 in the preparation of a drug for treating tumors, characterized in that: The cells of the tumor express PD-L1; the tumor is oral cancer, breast cancer, lung cancer, cervical cancer, pharyngeal cancer, or myeloma.

Images