Gene editing system for constructing model pigs with adenomatous polyposis and model pigs with colorectal cancer and its application

Abstract

The present invention discloses a gene editing system for constructing a model pig with adenomatous polyposis and a model pig with colorectal cancer and its application. The present invention provides the use of APC-gRNA5 shown in SEQ ID NO: 18, APC-gRNA6 shown in SEQ ID NO: 19, and NCN protein in the preparation of a kit. The present invention also provides a method for preparing a recombinant cell: co-transfecting a porcine cell with APC-gRNA5, APC-gRNA6, and NCN protein to obtain a recombinant cell. The recombinant cell is a recombinant cell with a mutated APC gene. The uses of the kit are: preparing a recombinant cell; preparing a model pig with adenomatous polyposis; preparing a cell model, tissue model, or organ model of adenomatous polyposis; preparing a model pig with colorectal cancer; preparing a cell model, tissue model, or organ model of colorectal cancer. The present invention has great application value for the research and development of drugs for adenomatous polyposis and colorectal cancer and for revealing the pathogenesis of such diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, specifically to the field of gene editing technology, and more specifically relates to a gene editing system for constructing an adenomatous polyposis model pig and a colorectal cancer model pig based on APC gene mutation and its application. Background Art

[0002] Familial adenomatous polyposis (FAP) is an autosomal dominant genetic disease, mainly characterized by the growth of a large number of adenomatous polyps in the colorectum. The polyps that occur are precancerous lesions and are very likely to develop into cancer. FAP mostly occurs in young people, generally showing clinical symptoms starting from puberty at 15 - 25 years old, and being most obvious around 30 years old. FAP is divided into three types: severe type, intermediate type, and attenuated type. Among them, the canceration rate of the severe type is 100%, that of the attenuated type is 69%, and the intermediate type is between them. FAP is caused by the gene mutation of adenomatous polyposis coli (APC). The human APC gene is located at 5q21 - q22, containing 8535 nucleotides, 15 coding exons, encoding a 310 kDa protein, containing 2843 amino acids, and 75% of the coding sequence is located in exon 15. This exon is the most common site for germline mutations (referring to hereditary gene mutations carried by germ cells) and somatic mutations (referring to somatic cell gene mutations). The APC gene belongs to a tumor suppressor gene and is a signaling molecule in the Wnt signal transduction pathway, which negatively regulates the Wnt pathway by degrading β - catenin. APC mutation leads to an increase in β - catenin, which then promotes the interaction between β - catenin and TCF, up - regulates downstream target genes (such as cyclin D1 and Myc), and drives tumor formation.

[0003] There are many ways of APC gene mutation. The most common mutation is the change in the gene sequence, which leads to the premature appearance of a stop codon and produces a non - functional truncated protein. More than 80% of FAP patients can be detected with a mutated APC gene. Although about 20% of patients do not have a mutated APC gene, its promoter is epigenetically modified (such as methylation of CpG islands), resulting in its abnormal expression. The functional defect of a single allele of APC is sufficient to cause the occurrence of FAP.

[0004] Colorectal Cancer (CRC) is one of the most common malignant tumors. In recent years, with the improvement of living standards, the incidence of CRC at home and abroad has been increasing rapidly, seriously threatening human health. In 2020, it surpassed gastric cancer and became the second most common cancer. Moreover, nearly 80% of patients are in the middle and late stages at the time of diagnosis, and nearly half of the patients have a survival period of less than 5 years. Previous research data showed that most CRCs originate from abnormal crypts, gradually evolve into polyps, and finally develop into CRC. Early symptoms are not obvious. As the cancer grows, symptoms such as changes in bowel habits, blood in the stool, diarrhea, alternating diarrhea and constipation, and local abdominal pain appear. In the late stage, systemic symptoms such as anemia and weight loss are manifested. A large-scale clinical trial jointly conducted by 8 large tertiary hospitals in China showed that CRC has a window period of more than 10 years. If diagnosed and treated early, the survival rate can exceed 90%.

[0005] The cause of CRC is not very clear. Currently, more and more evidence indicates that it is related to gene mutations. Among them, APC gene mutation and the resulting FAP are considered the main driving causes of CRC development. Germline mutations in a single allele of APC can cause FAP in carriers of the mutant gene. Homozygous germline mutations in both alleles of APC are embryonically lethal. FAP further makes the other normal APC allele in carriers of APC single allele germline mutations prone to mutate in polyps and tumor cells, leading to polyp carcinogenesis and the production of CRC. Somatic mutations in APC (somatic mutations in APC refer to the random mutation of one of the normal APC alleles at the somatic cell level, and the other allele is an abnormal APC germline mutation inherited, resulting in defects in both alleles) are found in the tumor tissues of 80-85% of sporadic CRC patients. Loss of heterozygosity (LOH) at the APC gene locus (loss of heterozygosity at the APC locus refers to the partial or complete deletion of a normal APC allele fragment, resulting in only the remaining abnormal APC allele) is found in 30%-40% of CRCs.

[0006] Existing research shows that APC gene mutations are common in FAP and CRC and are less common in other tumors. However, the pathogenic mechanisms and treatment methods of diseases caused by APC gene mutations have not been clarified, and all of these require the use of animal models. The currently commonly used animal model is the mouse model. However, mice are very different from humans in terms of body size, organ size, physiology, and pathology, and cannot truly simulate the normal physiological and pathological states of humans. As a large animal, pigs are similar to humans in terms of body size and physiological functions, are easy to breed on a large scale, and have lower requirements in terms of ethics and animal protection. They are ideal animal models for human diseases.

[0007] Gene editing is a biotechnology that has made significant developments in recent years. It includes gene editing based on homologous recombination to editing technologies such as nuclease-based ZFN, TALEN, CRISPR / Cas9, etc. Among them, the CRISPR / Cas9 technology is the most advanced gene editing technology currently. At present, gene editing technology is increasingly applied to the production of animal models. Summary of the Invention

[0008] The object of the present invention is to provide a gene editing system and its application for constructing an adenomatous polyposis model pig and a colorectal cancer model pig based on APC gene mutation.

[0009] The present invention provides the application of APC-gRNA5, APC-gRNA6 and NCN protein in the preparation of a kit.

[0010] The present invention also provides the application of APC-gRNA5, APC-gRNA6 and PRONCN protein in the preparation of a kit.

[0011] The present invention also provides the application of APC-gRNA5, APC-gRNA6 and a specific plasmid in the preparation of a kit.

[0012] The present invention provides a kit, comprising APC-gRNA5, APC-gRNA6 and NCN protein.

[0013] The present invention also provides a kit, comprising APC-gRNA5, APC-gRNA6 and PRONCN protein.

[0014] The present invention also provides a kit, comprising APC-gRNA5, APC-gRNA6 and a specific plasmid.

[0015] The present invention provides a method for preparing a recombinant cell, comprising the following steps: co-transfecting a porcine cell with APC-gRNA5, APC-gRNA6 and NCN protein to obtain a recombinant cell.

[0016] The co-transfection is specifically carried out by electroporation.

[0017] The parameter settings for electroporation can specifically be: 1450V, 10ms, 3pulse.

[0018] The co-transfection can specifically be carried out using a mammalian nucleofection kit (Neon kit, Thermofisher) and a NeonTM transfection system electroporator.

[0019] Any of the above-mentioned kits further comprises porcine cells.

[0020] The use of any of the above-mentioned kits is as follows (a) or (b) or (c) or (d) or (e): (a) preparing recombinant cells; (b) preparing a model pig with adenomatous polyposis; (c) preparing a cell model, tissue model or organ model of adenomatous polyposis; (d) preparing a model pig with colorectal cancer; (e) preparing a cell model, tissue model or organ model of colorectal cancer.

[0021] The ratio of APC-gRNA5, APC-gRNA6 and NCN protein is successively: 0.8 - 1.2 μg of APC-gRNA5: 0.8 - 1.2 μg of APC-gRNA6: 3 - 5 μg of NCN protein.

[0022] The ratio of APC-gRNA5, APC-gRNA6 and NCN protein is successively: 1 μg of APC-gRNA5: 1 μg of APC-gRNA6: 4 μg of NCN protein.

[0023] The ratio of porcine cells, APC-gRNA5, APC-gRNA6 and NCN protein is successively: 100,000 porcine cells: 0.8 - 1.2 μg of APC-gRNA5: 0.8 - 1.2 μg of APC-gRNA6: 3 - 5 μg of NCN protein.

[0024] The ratio of porcine cells, APC-gRNA5, APC-gRNA6 and NCN protein is successively: 100,000 porcine cells: 1 μg of APC-gRNA5: 1 μg of APC-gRNA6: 4 μg of NCN protein.

[0025] Any of the above-mentioned APC-gRNA5 is sgRNA, and its target sequence binding region is shown as the nucleotides at positions 3 - 22 in SEQ ID NO: 18.

[0026] Specifically, the APC-gRNA5 is as shown in SEQ ID NO: 18.

[0027] Specifically, the APC-gRNA5 is as shown in SEQ ID NO: 14.

[0028] Any of the above-mentioned APC-gRNA6 is sgRNA, and its target sequence binding region is shown as the nucleotides at positions 3 - 22 in SEQ ID NO: 19.

[0029] Specifically, the APC-gRNA6 is as shown in SEQ ID NO: 19.

[0030] Specifically, the APC-gRNA6 is as shown in SEQ ID NO: 15.

[0031] Any of the above-mentioned NCN proteins is a Cas9 protein or a fusion protein with a Cas9 protein.

[0032] Specifically, the NCN protein is as shown in SEQ ID NO: 3.

[0033] Any of the above-mentioned porcine cells is a porcine fibroblast cell.

[0034] Any of the above-mentioned porcine cells is a primary porcine fibroblast cell.

[0035] Any of the above-mentioned porcine cells is a primary porcine fibroblast cell obtained from a newly born pig.

[0036] The method for preparing the NCN protein includes the following steps:

[0037] (1) Introduce the plasmid pKG-GE4 into Escherichia coli BL21(DE3) to obtain a recombinant bacterium;

[0038] (2) Culture the recombinant bacterium in a liquid medium at 30 °C, then add IPTG and perform induction culture at 25 °C, and then collect the bacterial cells;

[0039] (3) Disrupt the collected bacterial cells and collect the crude protein solution;

[0040] (4) Purify the fusion protein with a His6 tag from the crude protein solution by affinity chromatography;

[0041] (5) Digest the fusion protein with a His6 tag with enterokinase with a His6 tag, and then remove the protein with a His6 tag using Ni-NTA resin to obtain the purified NCN protein;

[0042] The plasmid pKG-GE4 has a fusion gene shown by the nucleotides at positions 5209-9852 in SEQ ID NO: 1.

[0043] The method for preparing the NCN protein specifically includes the following steps:

[0044] (1) Introduce the plasmid pKG-GE4 into Escherichia coli BL21(DE3) to obtain a recombinant bacterium.

[0045] (2) Inoculate the recombinant bacterium obtained in step (1) into a liquid LB medium containing ampicillin and shake culture;

[0046] (3) Inoculate the bacterial liquid obtained in step (2) into a liquid LB medium and shake culture at 30 °C and 230 rpm until the OD 600nm value = 1.0, then add IPTG and make its concentration in the system 0.5 mM, then shake culture at 25 °C and 230 rpm for 12 hours, and then centrifuge to collect the bacterial cells;

[0047] (4) Take the bacterial cells obtained in step (3) and wash them with PBS buffer.

[0048] (5) Take the bacterial cells obtained in step (4), add crude extraction buffer and suspend the bacterial cells, then disrupt the bacterial cells, then centrifuge to collect the supernatant, filter through a 0.22 μm pore size filter membrane, and collect the filtrate.

[0049] (6) Purify the His6-tagged fusion protein (the fusion protein shown in SEQ ID NO: 2) from the filtrate obtained in step (5) by affinity chromatography.

[0050] (7) Take the solution after passing through the column collected in step (6), concentrate it using an ultrafiltration tube, and then dilute it with 25 mM Tris-HCl (pH 8.0).

[0051] (8) Add recombinant bovine enterokinase with His6 tag to the solution obtained in step (7) and perform enzymatic digestion.

[0052] (9) Mix the solution after completing step (8) with Ni-NTA resin, incubate, and then centrifuge to collect the supernatant.

[0053] (10) Take the supernatant obtained in step (9), concentrate it using an ultrafiltration tube, and then add it to the enzyme storage solution to obtain the NCN protein solution.

[0054] The specific method for purifying the His6-tagged fusion protein from the filtrate obtained in step (5) by affinity chromatography is as follows:

[0055] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then load 50 ml of the filtrate obtained in step (5) (flow rate: 0.5 - 1 ml / min); then wash the column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate: 1 ml / min) to remove impurity proteins; then elute with 10 column volumes of elution buffer at a flow rate of 0.5 - 1 ml / min and collect the solution after passing through the column (90 - 100 ml).

[0056] Any of the above-mentioned PRONCN proteins sequentially includes the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease cleavage site, nuclear localization signal, Cas9 protein, nuclear localization signal.

[0057] The function of the signal peptide is to promote the secretory expression of proteins. The signal peptide can be selected from the signal peptide of Escherichia coli alkaline phosphatase (phoA), the protein A signal peptide of Staphylococcus aureus, the outer membrane protein (ompa) signal peptide of Escherichia coli, or the signal peptide of any other prokaryotic gene, and is preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used to direct the secretory expression of the target protein into the bacterial periplasm, so as to separate it from the intracellular proteins of the bacteria. Moreover, the target protein secreted into the bacterial periplasm is expressed in a soluble form and can be cleaved by the signal peptidase in the bacterial periplasm.

[0058] The function of the molecular chaperone protein is to increase the solubility of the protein. The molecular chaperone can be any protein that helps to form disulfide bonds, and is preferably thioredoxin (TrxA protein). Thioredoxin can act as a molecular chaperone to help the co-expressed target protein (such as Cas9 protein) form disulfide bonds, improve the stability and correct folding of the protein, and increase the solubility and activity of the target protein.

[0059] The function of the protein tag is for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), a GST tag, a Flag tag, an HA tag, a c-Myc tag, or any other protein tag, and is further preferably a His tag. The His tag can bind to the Ni column, and the target protein can be purified by one-step Ni column affinity chromatography, which can greatly simplify the purification process of the target protein.

[0060] The function of the protease cleavage site is to excise the non-functional segment after purification to release the native form of Cas9 protein. The protease can be selected from enterokinase, Factor Xa, thrombin, TEV protease, HRV 3C protease, WELQut protease, or any other endoprotease, and is further preferably enterokinase. EK is the enterokinase cleavage site, which is convenient for using enterokinase to excise the fused TrxA-His segment to obtain the native form of Cas9 protein. After using the commercial enterokinase with a His tag to cleave the fusion protein in this application, the TrxA-His segment and the enterokinase with a His tag can be removed by one-step affinity chromatography to obtain the native form of Cas9 protein, avoiding the damage and loss of the target protein caused by multiple purification and dialysis.

[0061] The nuclear localization signal can be any nuclear localization signal, preferably the SV40 nuclear localization signal and / or the nucleoplasmin nuclear localization signal. NLS is the nuclear localization signal. An NLS site is designed at the N-terminus and C-terminus of Cas9 respectively, enabling Cas9 to enter the cell nucleus more effectively for gene editing.

[0062] The Cas9 protein can be saCas9 or spCas9, preferably the spCas9 protein.

[0063] The PRONCN protein is specifically shown as SEQ ID NO: 2.

[0064] Any of the above specific plasmids sequentially includes the following elements from upstream to downstream: promoter, operator, ribosome binding site, coding gene of PRONCN protein, terminator.

[0065] The promoter can specifically be the T7 promoter. The T7 promoter is a strong prokaryotic expression promoter that can efficiently drive the expression of foreign genes.

[0066] The operator can specifically be the Lac operator. The Lac operator is a regulatory element for lactose-induced expression. After the bacteria grow to a certain number, IPTG can be used to induce the expression of the target protein at low temperature, which can avoid the influence of premature expression of the target protein on the growth of the host bacteria, and the expression at low temperature also significantly improves the solubility of the expressed target protein.

[0067] The ribosome binding site is the ribosome binding site during protein translation and is necessary for protein translation.

[0068] The terminator can specifically be the T7 terminator. The T7 terminator can effectively terminate gene transcription at the end of the target gene, avoiding the transcription and translation of other downstream sequences outside the target gene.

[0069] For the codons of the spCas9 protein, the present application optimized its codons to fully adapt to the codon preference of the highly efficient expression strain E. coli BL21(DE3) selected in the present application, thereby improving the expression level of the Cas9 protein.

[0070] The T7 promoter is shown as the nucleotides at positions 5121 - 5139 in SEQ ID NO: 1.

[0071] The Lac operator is shown as the nucleotides at positions 5140 - 5164 in SEQ ID NO: 1.

[0072] The ribosome binding site is shown as the nucleotides at positions 5178 - 5201 in SEQ ID NO: 1.

[0073] The coding sequence of the alkaline phosphatase signal peptide is shown as the nucleotides at positions 5209 - 5271 in SEQ ID NO: 1.

[0074] The coding sequence of the TrxA protein is shown as the nucleotides at positions 5272 - 5598 in SEQ ID NO: 1.

[0075] The coding sequence of the His - Tag is shown as the nucleotides at positions 5620 - 5637 in SEQ ID NO: 1.

[0076] The coding sequence of the enterokinase cleavage site is shown as the nucleotides at positions 5638 - 5652 in SEQ ID NO: 1.

[0077] The coding sequence of the nuclear localization signal is shown as the nucleotides at positions 5656 - 5670 in SEQ ID NO: 1.

[0078] The coding sequence of the spCas9 protein is shown as the nucleotides at positions 5701 - 9801 in SEQ ID NO: 1.

[0079] The coding sequence of the nuclear localization signal is shown as the nucleotides at positions 9802 - 9849 in SEQ ID NO: 1.

[0080] The T7 terminator is the nucleotides at positions 9902 - 9949 in SEQ ID NO: 1.

[0081] Specifically, the specific plasmid is plasmid pKG - GE4.

[0082] Plasmid pKG - GE4 contains the DNA molecule shown as the nucleotides at positions 5121 - 9949 in SEQ ID NO: 1.

[0083] Specifically, any of the above - mentioned plasmid pKG - GE4 is as shown in SEQ ID NO: 1.

[0084] The present invention also protects the recombinant cells prepared by any of the above - mentioned methods.

[0085] The recombinant cells are recombinant cells with a mutated APC gene.

[0086] The recombinant cells are single - cell clones with a mutated APC gene, and the genotype based on the APC gene is heterozygous and non - triple - mutant.

[0087] Specifically, the recombinant cells can be single - cell clones with a heterozygous genotype and non - triple - mutant as shown in Table 1.

[0088] Non - triple - mutant refers to a deletion mutation and / or an insertion mutation occurring, and the number of deleted and / or inserted nucleotides is not a multiple of 3.

[0089] The present invention also protects the use of the recombinant cells in the preparation of a porcine model of adenomatous polyposis.

[0090] By using the recombinant cells as nuclear transfer donor cells for somatic cell cloning, cloned pigs can be obtained, which are porcine models of adenomatous polyposis.

[0091] The present invention also protects the porcine tissues of the model pigs prepared using the recombinant cells, namely, the tissue model of adenomatous polyposis.

[0092] The present invention also protects the porcine organs of the model pigs prepared using the recombinant cells, namely, the organ model of adenomatous polyposis.

[0093] The present invention also protects the porcine cells of the model pigs prepared using the recombinant cells, namely, the cell model of adenomatous polyposis.

[0094] The present invention also protects the use of the recombinant cells, the tissue model of adenomatous polyposis, the organ model of adenomatous polyposis, the cell model of adenomatous polyposis, or the porcine model of adenomatous polyposis, which is as follows (d1) or (d2) or (d3) or (d4):

[0095] (d1) Screening for drugs for the treatment of adenomatous polyposis;

[0096] (d2) Evaluating the efficacy of drugs for adenomatous polyposis;

[0097] (d3) Evaluating the efficacy of gene therapy and / or cell therapy for adenomatous polyposis;

[0098] (d4) Studying the pathogenesis of adenomatous polyposis.

[0099] The present invention also protects the use of the recombinant cells in the preparation of a porcine model of colorectal cancer.

[0100] By using the recombinant cells as nuclear transfer donor cells for somatic cell cloning, cloned pigs can be obtained, which are porcine models of colorectal cancer.

[0101] By using the recombinant cells as nuclear transfer donor cells for somatic cell cloning, cloned pigs can be obtained, and the pigs with colorectal cancer in the cloned pigs are porcine models of colorectal cancer.

[0102] The present invention also protects the porcine tissues of the model pigs prepared using the recombinant cells, namely, the tissue model of colorectal cancer.

[0103] The present invention also protects the porcine organs of the model pigs prepared using the recombinant cells, namely, the organ model of colorectal cancer.

[0104] The present invention also protects the porcine cells of the model pigs prepared using the recombinant cells, namely, the cell model of colorectal cancer.

[0105] The present invention also protects the application of the recombinant cell, the colorectal cancer tissue model, the colorectal cancer organ model, the colorectal cancer cell model or the colorectal cancer model pig, which is as follows (e1) or (e2) or (e3) or (e4):

[0106] (e1) Screening for drugs for treating colorectal cancer;

[0107] (e2) Evaluating the efficacy of drugs for colorectal cancer;

[0108] (e3) Evaluating the efficacy of gene therapy and / or cell therapy for colorectal cancer;

[0109] (e4) Studying the pathogenesis of colorectal cancer.

[0110] Any of the above-mentioned pigs may specifically be Congjiang Xiang pigs.

[0111] Any of the above-mentioned pigs may specifically be newborn Congjiang Xiang pigs.

[0112] Any of the above-mentioned adenomatous polyposis is caused by APC gene mutation.

[0113] Any of the above-mentioned adenomatous polyposis is familial adenomatous polyposis.

[0114] Any of the above-mentioned colorectal cancers is caused by APC gene mutation and the resulting adenomatous polyposis.

[0115] Any of the above-mentioned colorectal cancers is familial colorectal cancer.

[0116] Porcine APC gene information: Encodes the tumor suppressor protein APC; Located on chromosome 2; Gene ID is 100517932, Sus scrofa.

[0117] The amino acid sequence of the protein encoded by the porcine APC gene is as shown in SEQ ID NO: 8.

[0118] The porcine APC gene has the DNA segment shown in SEQ ID NO: 9.

[0119] Any of the above-mentioned mutations is a deletion and / or insertion and / or substitution of one or more nucleotides.

[0120] Any of the above-mentioned mutations is a deletion of one or more nucleotides.

[0121] Any of the above-mentioned mutations is an insertion of one or more nucleotides.

[0122] Any of the above-mentioned mutations is a deletion and insertion of one or more nucleotides.

[0123] Any of the above mutations is a non - multiple - of - 3 mutation.

[0124] A non - multiple - of - 3 mutation refers to a deletion mutation and / or an insertion mutation occurring, and the number of nucleotides deleted and / or inserted is not a multiple of 3.

[0125] Compared with the prior art, the present invention has at least the following beneficial effects:

[0126] (1) The research object of the present invention (pig) has better applicability than other animals (mice, rats, and primates).

[0127] Rodents such as mice and rats are very different from humans in terms of body size, organ size, physiology, pathology, etc., and cannot truly simulate the normal physiological and pathological states of humans. Research shows that more than 95% of the drugs that are effective in mice and rats are ineffective in human clinical trials. As for large animals, primates are the animals with the closest genetic relationship to humans, but they are small in size, have a late sexual maturity (starting to mate at 6 - 7 years old), are single - offspring animals, have an extremely slow population expansion rate, and have a very high breeding cost. In addition, the cloning efficiency of primates is low, the difficulty is great, and the cost is high.

[0128] Pigs, as model animals, do not have the above - mentioned disadvantages. Pigs are the animals with the closest genetic relationship to humans except for primates. Their body size, weight, organ size, etc. are similar to those of humans, and they are extremely similar to humans in terms of anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis, etc. At the same time, pigs have an early sexual maturity (4 - 6 months), high fertility, multiple offspring per litter, and can form a relatively large population within 2 - 3 years. In addition, the cloning technology of pigs is very mature, and the cloning and breeding costs are much lower than those of primates. Therefore, pigs are very suitable as animals for human disease models.

[0129] (2) The vector constructed in the present invention uses the strong promoter T7-lac capable of highly expressing the target protein to express the target protein, and uses the signal peptide of the bacterial periplasmic protein alkaline phosphatase (phoA) to direct the secretory expression of the target protein into the bacterial periplasmic cavity, so as to separate it from the bacterial intracellular protein, and the target protein secreted into the bacterial periplasmic cavity is expressed in a soluble form. At the same time, thioredoxin TrxA is also used for fusion expression with the Cas9 protein. TrxA can help the co-expressed target protein form disulfide bonds, improve the stability and folding correctness of the protein, and increase the solubility and activity of the target protein. For the convenience of purifying the target protein, a His tag is designed, and the target protein can be purified by one-step Ni column affinity chromatography, greatly simplifying the purification process of the target protein. At the same time, an enterokinase cleavage site is designed after the His tag to facilitate the excision of the fused TrxA-His polypeptide fragment to obtain the Cas9 protein in its natural form. After cleaving the fusion protein with enterokinase with a His tag, the TrxA-His polypeptide fragment and the enterokinase with a His tag can be removed by one affinity chromatography to obtain the Cas9 protein in its natural form, avoiding the damage and loss of the target protein caused by multiple purification and dialysis. At the same time, the present invention also designs an NLS site at the N-terminus and C-terminus of Cas9 respectively, so that Cas9 can enter the nucleus more effectively for gene editing. In addition, the present invention selects the E. coli BL21(DE3) strain as the expression strain of the target protein. This strain can highly express foreign genes cloned into an expression vector containing a phage T7 promoter (such as pET-32a). At the same time, for the codons of the Cas9 protein, the present invention has carried out codon optimization to make it fully adapt to the codon preference of the expression strain, thereby improving the expression level of the target protein. In addition, the present invention induces the expression of the target protein with IPTG at a low temperature after the bacteria grow to a certain number, which can avoid the influence of premature expression of the target protein on the growth of the host bacteria, and the expression at a low temperature also significantly improves the solubility of the expressed target protein. Through the above various optimized designs and experimental implementations, the activity of the obtained Cas9 protein has been extremely significantly improved compared with the commercial Cas9 protein.

[0130] (3) The Cas9 high-efficiency protein constructed and expressed by the present invention is combined with the in vitro transcribed gRNA for gene editing, and the optimal dosage ratio of Cas9 and gRNA is optimized. Finally, the ratio of gene-edited single-cell clones is as high as 85.7%, which is much higher than the conventional gene editing efficiency (10 - 30%).

[0131] (4) Using the single-cell clone strain with the target gene knocked out obtained by the present invention for somatic cell nuclear transfer animal cloning can directly obtain cloned pigs with the target gene knocked out, and this gene variation can be stably inherited.

[0132] In the production of mouse models, the method of embryo transfer after microinjecting gene editing materials into fertilized eggs is not very suitable for the production of large animal (such as pigs) models with a long gestation period because the probability of directly obtaining offspring with gene mutations is relatively low and offspring hybridization and breeding are required. Therefore, the present invention adopts the method of primary cell in vitro editing, which is technically difficult and highly challenging, as well as Cas9 protein and dual gRNA cleavage and screening of positive edited single cell clones. Later, the corresponding disease model pigs can be directly obtained through somatic cell nuclear transfer animal cloning technology, which can greatly shorten the production cycle of model pigs and save manpower, material resources and financial resources.

[0133] The present invention uses CRISPR / Cas9 technology combined with dual gRNA editing to knockout the APC gene, simulate the natural genetic characteristics of FAP, and obtain single cell clones with APC gene knockout, laying a foundation for the cultivation of FAP model pigs through somatic cell nuclear transfer animal cloning technology in the later stage. Since APC gene mutations and the resulting FAP are considered the main driving causes of CRC occurrence, some of these cloned pigs also progress to colorectal cancer and can thus be used as colorectal cancer model pigs. The present invention will help to study and reveal the pathogenesis of FAP and CRC caused by abnormal APC gene function, and can also be used for research such as drug screening, efficacy evaluation, gene therapy and cell therapy, and can provide effective experimental data for further clinical applications, and thus provide a powerful experimental means for the successful treatment of human FAP and CRC. The present invention has great application value for the research and development of drugs for FAP and CRC diseases and the revelation of the pathogenesis of this disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0134] Figure 1 Electrophoretogram of PCR amplification using different primer pairs with genomic DNA extracted from the ear tissue of the pig named 1 in Example 1 as a template.

[0135] Figure 2 Electrophoretogram of PCR amplification using the primer pair composed of APC-E15-JDF96 and APC-E15-JDR580 with genomic DNA of 18 pigs as templates respectively in Example 1.

[0136] Figure 3 Electrophoretogram of comparison of editing efficiencies of different target combinations in Example 1.

[0137] Figure 4 Alignment result of forward sequencing of the single cell clone numbered 4 and the wild type sequence.

[0138] Figure 5 Alignment result of forward sequencing of the single cell clone numbered 2 and the wild type sequence.

[0139] Figure 6Alignment result of the forward sequencing of the single-cell clone numbered 1 and the wild-type sequence.

[0140] Figure 7 Alignment result of the forward sequencing of the single-cell clone numbered 6 and the wild-type sequence.

[0141] Figure 8 Schematic diagram of the structure of plasmid pET-32a.

[0142] Figure 9 Schematic diagram of the structure of plasmid pKG-GE4.

[0143] Figure 10 Electrophoretogram of the optimization of the dosage ratio of gRNA and NCN protein in Example 3.

[0144] Figure 11 Electrophoretogram of the comparison of gene editing efficiency between NCN protein and commercial Cas9 protein in Example 3. Detailed implementation manners

[0145] The present invention will be further described in detail below in combination with the detailed implementation manners. The provided examples are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0146] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified. The recombinant plasmids constructed in the examples have all been verified by sequencing. Commercial Cas9-A protein is a commercially available Cas9 protein with good effects. Commercial Cas9-B protein is a commercially available Cas9 protein with good effects. Complete culture medium (the percentage is by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: constant temperature incubator at 37°C, 5% CO2, and 5% O2.

[0147] The porcine primary fibroblasts used in the examples were all prepared from the ear tissues of neonatal Congjiang Xiang pigs. Method for preparing porcine primary fibroblasts: ① Take 0.5 g of porcine ear tissue, remove hair and bone tissue, then soak in 75% alcohol for 30 - 40 s, then wash 5 times with PBS buffer containing 5% (by volume) Penicillin - Streptomycin (Gibco), and then wash once with PBS buffer; ② Cut the tissue into pieces with scissors, use 5 mL of 0.1% collagenase solution (Sigma), digest at 37°C for 1 h, then centrifuge at 500 g for 5 min, and discard the supernatant; ③ Resuspend the precipitate with 1 mL of complete culture medium, then spread it into a 10 - cm - diameter cell culture dish containing 10 mL of complete culture medium and sealed with 0.2% gelatin (VWR), and culture until the cells cover about 60% of the bottom of the dish; ④ After completing step ③, digest and collect the cells with trypsin, and then resuspend them in complete culture medium. For subsequent electroporation experiments.

[0148] Example 1, Screening of Highly Efficient gRNA Target Sites for APC Gene

[0149] Porcine APC gene information: Encodes the tumor suppressor protein APC; Located on chromosome 2; Gene ID is 100517932, Sus scrofa. The amino acid sequence of the protein encoded by the porcine APC gene is shown in SEQ ID NO: 8. In the porcine genomic DNA, the APC gene has 15 exons, and its partial sequence (partial sequence of exon 15) is shown in SEQ ID NO: 9.

[0150] Plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 in Patent Application 202010084343.6. In SEQ ID NO: 2 of Patent Application 202010084343.6, nucleotides 395 - 680 form the CMV enhancer, nucleotides 682 - 890 form the EF1a promoter, nucleotides 986 - 1006 encode the nuclear localization signal (NLS), nucleotides 1016 - 1036 encode the nuclear localization signal (NLS), nucleotides 1037 - 5161 encode the Cas9 protein, nucleotides 5162 - 5209 encode the nuclear localization signal (NLS), nucleotides 5219 - 5266 encode the nuclear localization signal (NLS), nucleotides 5276 - 5332 encode the self-cleaving polypeptide P2A (the amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP", and the cleavage position for self-cleavage is between the first and second amino acid residues starting from the C-terminus), nucleotides 5333 - 6046 encode the EGFP protein, nucleotides 6056 - 6109 encode the self-cleaving polypeptide T2A (the amino acid sequence of the self-cleaving polypeptide T2A is "EGRGSLLTCGDVEENPGP", and the cleavage position for self-cleavage is between the first and second amino acid residues starting from the C-terminus), nucleotides 6110 - 6703 encode the Puromycin protein (abbreviated as Puro protein), nucleotides 6722 - 7310 form the WPRE sequence element, nucleotides 7382 - 7615 form the 3'LTR sequence element, and nucleotides 7647 - 7871 form the bGH poly(A) signal sequence element. In SEQ ID NO: 2 of Patent Application 202010084343.6, nucleotides 911 - 6706 form a fusion gene and express a fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with the Cas9 protein, a protein with the EGFP protein, and a protein with the Puro protein.

[0151] The pKG-U6gRNA vector, namely plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 in Patent Application 202010084343.6. In SEQ ID NO: 3 of Patent Application 202010084343.6, nucleotides 2280 - 2539 form the hU6 promoter, and nucleotides 2558 - 2637 are used for transcribing to form the gRNA backbone. When in use, a DNA molecule of about 20 bp (the target sequence binding region for transcribing to form the gRNA) is inserted into plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in cells to obtain gRNA.

[0152] 1. Analysis of the conservation of the preset deletion region of the APC gene and the adjacent genomic sequences

[0153] Eighteen newly born Congjiang Xiang pigs, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 respectively) and 8 males (named A, B, C, D, E, F, G, H respectively).

[0154] APC-E15-JDF51: AGAAGCAGAATTAGACGCCCAGC;

[0155] APC-E15-JDR537: CAGTGCATTCCTCTCATCTGTCC;

[0156] APC-E15-JDF96: TATTGACAATTTAAGTCCCAAGG;

[0157] APC-E15-JDR580: GTTGTACGTGTTTGCGTGTGAGT.

[0158] Extract genomic DNA from the ear tissue of the pig named 1 as the template, perform PCR amplification with different primer pairs, and then perform 1% agarose gel electrophoresis. The electrophoresis pattern is shown in Figure 1 . Figure 1 In the figure: Group 1: Use the primer pair composed of APC-E15-JDF51 and APC-E15-JDR537; Group 2: Use the primer pair composed of APC-E15-JDF51 and APC-E15-JDR580; Group 3: Use the primer pair composed of APC-E15-JDF96 and APC-E15-JDR537; Group 4: Use the primer pair composed of APC-E15-JDF96 and APC-E15-JDR580. The results show that it is preferably to use the primer pair composed of APC-E15-JDF96 and APC-E15-JDR580 for amplifying the target fragment.

[0159] Respectively use the genomic DNA of 18 pigs as the template, perform PCR amplification with the primer pair composed of APC-E15-JDF96 and APC-E15-JDR580, and then perform 1% agarose gel electrophoresis. The electrophoresis pattern is shown in Figure 2 . Recover the PCR amplification products and perform sequencing, and compare and analyze the sequencing results with the APC gene sequences in the public database. Select the conserved regions shared by the 18 pigs for the design of gRNA targets.

[0160] 2. Screening of target sites

[0161] Several targets were initially screened by filtering NGG (avoiding possible mutation sites), and 6 targets were further screened from them through preliminary experiments.

[0162] The 6 targets are as follows:

[0163] APC-E15-gRNA1: CCCCTTGATGAAGAGGAGCT;

[0164] APC-E15-gRNA2: CCCAGCTCCTCTTCATCAAG;

[0165] APC-E15-gRNA3: TTCTGAGAAAGACAGAAGTT;

[0166] APC-E15-gRNA4: AGAAGTTTGGAGAGAGAACG;

[0167] APC-E15-gRNA5: AGAGAACGAGGTATTAGCAT;

[0168] APC-E15-gRNA6: CCAGGAACCTCTTCAAAGCG.

[0169] III. Preparation of gRNA

[0170] Take the plasmid pKG-U6gRNA and digest it with the restriction enzyme BbsI, and recover the vector backbone (a linear large fragment of about 3 kb).

[0171] Synthesize APC-E15-gRNA1-S and APC-E15-gRNA1-A respectively, then mix and anneal them to obtain a double-stranded DNA molecule with sticky ends. Connect the double-stranded DNA molecule with sticky ends to the vector backbone to obtain the plasmid pKG-U6gRNA(APC-E15-gRNA1). The plasmid pKG-U6gRNA(APC-E15-gRNA1) expresses the sgRNA shown in SEQ ID NO: 10 APC-E15-gRNA1 .

[0172] sgRNA APC-E15-gRNA1 (SEQ ID NO: 10):

[0173] CCCCUUGAUGAAGAGGAGCUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0174] APC-E15-gRNA2-S and APC-E15-gRNA2-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was ligated to the vector backbone to obtain plasmid pKG-U6gRNA(APC-E15-gRNA2). Plasmid pKG-U6gRNA(APC-E15-gRNA2) expresses the sgRNA shown in SEQ ID NO: 11 APC-E15-gRNA2 .

[0175] sgRNA APC-E15-gRNA2 (SEQ ID NO: 11):

[0176] CCCAGCUCCUCUUCAUCAAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0177] APC-E15-gRNA3-S and APC-E15-gRNA3-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was ligated to the vector backbone to obtain plasmid pKG-U6gRNA(APC-E15-gRNA3). Plasmid pKG-U6gRNA(APC-E15-gRNA3) expresses the sgRNA shown in SEQ ID NO: 12 APC-E15-gRNA3 .

[0178] sgRNA APC-E15-gRNA3 (SEQ ID NO: 12):

[0179] UUCUGAGAAAGACAGAAGUUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0180] APC-E15-gRNA4-S and APC-E15-gRNA4-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was ligated to the vector backbone to obtain plasmid pKG-U6gRNA(APC-E15-gRNA4). Plasmid pKG-U6gRNA(APC-E15-gRNA4) expresses the sgRNA shown in SEQ ID NO: 13 APC-E15-gRNA4 .

[0181] sgRNA APC-E15-gRNA4(SEQ ID NO: 13):

[0182] AGAAGUUUGGAGAGAGAACGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0183] Synthesize APC-E15-gRNA5-S and APC-E15-gRNA5-A separately, then mix and anneal them to obtain a double-stranded DNA molecule with sticky ends. Connect the double-stranded DNA molecule with sticky ends to the vector backbone to obtain plasmid pKG-U6gRNA(APC-E15-gRNA5). Plasmid pKG-U6gRNA(APC-E15-gRNA5) expresses the sgRNA shown in SEQ ID NO: 14 APC-E15-gRNA5 .

[0184] sgRNA APC-E15-gRNA5 (SEQ ID NO: 14):

[0185] AGAGAACGAGGUAUUAGCAUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0186] Synthesize APC-E15-gRNA6-S and APC-E15-gRNA6-A separately, then mix and anneal them to obtain a double-stranded DNA molecule with sticky ends. Connect the double-stranded DNA molecule with sticky ends to the vector backbone to obtain plasmid pKG-U6gRNA(APC-E15-gRNA6). Plasmid pKG-U6gRNA(APC-E15-gRNA6) expresses the sgRNA shown in SEQ ID NO: 15 APC-E15-gRNA6 .

[0187] sgRNA APC-E15-gRNA6 (SEQ ID NO: 15):

[0188] CCAGGAACCUCUUCAAAGCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0189] APC-E15-gRNA1-S: caccgCCCCTTGATGAAGAGGAGCT;

[0190] APC-E15-gRNA1-A: aaacAGCTCCTCTTCATCAAGGGGc。

[0191] APC-E15-gRNA2-S: caccgCCCAGCTCCTCTTCATCAAG;

[0192] APC-E15-gRNA2-A: aaacCTTGATGAAGAGGAGCTGGGc。

[0193] APC-E15-gRNA3-S: caccgTTCTGAGAAAGACAGAAGTT;

[0194] APC-E15-gRNA3-A: aaacAACTTCTGTCTTTCTCAGAAc。

[0195] APC-E15-gRNA4-S: caccgAGAAGTTTGGAGAGAGAACG;

[0196] APC-E15-gRNA4-A: aaacCGTTCTCTCTCCAAACTTCTc。

[0197] APC-E15-gRNA5-S: caccgAGAGAACGAGGTATTAGCAT;

[0198] APC-E15-gRNA5-A: aaacATGCTAATACCTCGTTCTCTc。

[0199] APC-E15-gRNA6-S: caccgCCAGGAACCTCTTCAAAGCG;

[0200] APC-E15-gRNA6-A: aaacCGCTTTGAAGAGGTTCCTGGc。

[0201] APC-E15-gRNA1-S, APC-E15-gRNA1-A, APC-E15-gRNA2-S, APC-E15-gRNA2-A, APC-E15-gRNA3-S, APC-E15-gRNA3-A, APC-E15-gRNA4-S, APC-E15-gRNA4-A, APC-E15-gRNA5-S, APC-E15-gRNA5-A, APC-E15-gRNA6-S, APC-E15-gRNA6-A are all single-stranded DNA molecules.

[0202] IV. Comparison of Editing Efficiencies of Different Target Combinations

[0203] 1. Co-transfection

[0204] Group 1: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA(APC-E15-gRNA1) and plasmid pKG-GE3. Ratio: Approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA(APC-E15-gRNA1): 1.08 μg plasmid pKG-GE3.

[0205] Group 2: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA(APC-E15-gRNA2) and plasmid pKG-GE3. Ratio: Approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA(APC-E15-gRNA2): 1.08 μg plasmid pKG-GE3.

[0206] Group 3: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA(APC-E15-gRNA3) and plasmid pKG-GE3. Ratio: Approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA(APC-E15-gRNA3): 1.08 μg plasmid pKG-GE3.

[0207] Group 4: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA(APC-E15-gRNA4) and plasmid pKG-GE3. Ratio: Approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA(APC-E15-gRNA4): 1.08 μg plasmid pKG-GE3.

[0208] Group 5: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA(APC-E15-gRNA5) and plasmid pKG-GE3. Ratio: Approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA(APC-E15-gRNA5): 1.08 μg plasmid pKG-GE3.

[0209] Group 6: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA(APC-E15-gRNA6) and plasmid pKG-GE3. Ratio: Approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA(APC-E15-gRNA6): 1.08 μg plasmid pKG-GE3.

[0210] Group 7: Porcine primary fibroblasts, perform electroporation operation with the same electroporation parameters without adding plasmids.

[0211] Co-transfection was carried out by electroporation transfection, using a mammalian nucleofection kit (Neon kit, Thermofisher) and a Neon TM transfection system electroporator (parameter settings: 1450V, 10ms, 3 pulses).

[0212] 2. After completing step 1, culture in complete medium for 12 - 18 hours, then replace with fresh complete medium for culture. The total culture time after electroporation is 48 hours.

[0213] 3. After completing step 2, digest and collect cells with trypsin, lyse the cells, extract genomic DNA, perform PCR amplification using a primer pair composed of APC-E15-JDF96 and APC-E15-JDR580, and then perform 1% agarose gel electrophoresis. Detect the target gene mutation situation of the cells. The electrophoresis pattern is shown in Figure 3 .

[0214] After cutting and recovering the target product, send it to a sequencing company for sequencing, and then analyze the sequencing peak map using the web version of the Synthego ICE tool to obtain the gene editing efficiency of different targets. The gene editing efficiencies of the first group to the sixth group are 14%, 33%, 18%, 0, 47%, and 55% in sequence, and no gene editing occurred in the seventh group. The results show that APC-E15-gRNA5 and APC-E15-gRNA6 have higher editing efficiencies.

[0215] Example 2. Preparation of single-cell clones of Congjiang Xiang pigs with APC gene knockout

[0216] Select two highly efficient gRNA targets (APC-E15-gRNA5 and APC-E15-gRNA6) screened in Example 4.

[0217] I. Preparation of gRNA

[0218] 1. Preparation of APC-T7-gRNA5 transcription template and APC-T7-gRNA6 transcription template

[0219] The APC-T7-gRNA5 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 16.

[0220] The APC-T7-gRNA6 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 17.

[0221] 2. Obtain gRNA by in vitro transcription

[0222] Take the APC-T7-gRNA5 transcription template and perform in vitro transcription using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then use MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) for recovery and purification to obtain APC-gRNA5. APC-gRNA5 is single-stranded RNA as shown in SEQ ID NO: 18.

[0223] Take the APC-T7-gRNA6 transcription template and perform in vitro transcription using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then use MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) for recovery and purification to obtain APC-gRNA6. APC-gRNA6 is single-stranded RNA as shown in SEQ ID NO: 19.

[0224] APC-gRNA5 (SEQ ID NO: 18):

[0225] GGAGAGAACGAGGUAUUAGCAUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

[0226] APC-gRNA6 (SEQ ID NO: 19):

[0227] GGCCAGGAACCUCUUCAAAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

[0228] II. Transfect porcine primary fibroblasts

[0229] 1. Co-transfect porcine primary fibroblasts with APC-gRNA5, APC-gRNA6 and NCN protein. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg APC-gRNA5: 1 μg APC-gRNA6: 4 μg NCN protein. The co-transfection is carried out by electroporation using a mammalian nucleofection kit (Neon kit, Thermofisher) and a Neon TM transfection system (parameters set as: 1450 V, 10 ms, 3 pulses). The NCN protein is prepared in Example 3.

[0230] 2. After completing step 1, culture with complete medium for 16 - 18 hours, and then replace with fresh complete medium for culture. The total culture time after electroporation is 48 hours.

[0231] 3. After completing step 2, digest and collect the cells with trypsin, then wash with complete medium, then resuspend with complete medium, and then pick individual monoclonal cells and transfer them to a 96-well plate (1 cell per well, each well containing 100 μl of complete medium), and culture for 2 weeks (replace with fresh complete medium every 2 - 3 days).

[0232] 4. After completing step 3, digest and collect the cells with trypsin (for the cells obtained from each well, approximately 2 / 3 are inoculated into a 6-well plate containing complete medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).

[0233] 5. Take the 6-well plate in step 4, culture until the cells reach 80% confluence, digest and collect the cells with trypsin, and cryopreserve the cells using a cell cryopreservation solution (90% complete medium + 10% DMSO, by volume).

[0234] 6. Take the centrifuge tube in step 4, take the cells, perform cell lysis and extract genomic DNA, perform PCR amplification using a primer pair composed of APC-E15-JDF96 and APC-E15-JDR580, and then perform electrophoresis. Use porcine primary fibroblasts as the wild-type control (WT).

[0235] 7. After completing step 6, recover the PCR amplification product and sequence it.

[0236] There is only one sequencing result for porcine primary fibroblasts, and its genotype is wild type (also known as homozygous wild type). If there are two sequencing results for a single-cell clone, one is consistent with the sequencing result of porcine primary fibroblasts, and the other has a mutation compared with the sequencing result of porcine primary fibroblasts (the mutation includes the deletion, insertion or substitution of one or more nucleotides), the genotype of this single-cell clone is heterozygous; if there are two sequencing results for a single-cell clone, both have mutations compared with the sequencing result of porcine primary fibroblasts (the mutation includes the deletion, insertion or substitution of one or more nucleotides), the genotype of this single-cell clone is biallelic different mutant type; if there is one sequencing result for a single-cell clone, and it has a mutation compared with the sequencing result of porcine primary fibroblasts (the mutation includes the deletion, insertion or substitution of one or more nucleotides), the genotype of this single-cell clone is biallelic same mutant type; if there is one sequencing result for a single-cell clone, and it is consistent with the sequencing result of porcine primary fibroblasts, the genotype of this single-cell clone is wild type (also known as homozygous wild type).

[0237] The results are shown in Table 1. The genotypes of single-cell clones numbered 4, 11, 16, 18, 24, and 31 are wild type. The genotypes of single-cell clones numbered 2, 3, 7, 10, 14, 20, 23, 27, 29, 32, 35, 36, 39, and 42 are heterozygous. The genotypes of single-cell clones numbered 1, 5, 8, 12, 13, 15, 19, 22, 26, 28, 30, 33, 34, 37, 38, and 40 are biallelic different mutant type. The genotypes of single-cell clones numbered 6, 9, 17, 21, 25, and 41 are biallelic same mutant type. The ratio of obtaining APC gene-edited single-cell clones is 85.7%.

[0238] Exemplary sequencing alignment results are as Figures 4 to 7 . Figure 4 is the alignment result of the forward sequencing of single-cell clone numbered 4 and the wild-type sequence, and it is determined to be wild type. Figure 5 is the alignment result of the forward sequencing of single-cell clone numbered 2 and the wild-type sequence, and it is determined to be heterozygous. Figure 6 is the alignment result of both the forward and reverse sequencing of single-cell clone numbered 1 and the wild-type sequence, which is biallelic different mutant type. Figure 7 is the alignment result of the forward sequencing of single-cell clone numbered 6 and the wild-type sequence, which is biallelic same mutant type.

[0239] Table 1 Genotype determination results of APC gene-edited single-cell clones

[0240]

[0241]

[0242]

[0243] The above-mentioned heterozygous single-cell clones with non-multiples-of-3 mutations (homozygous cells are lethal to embryonic development) can be used for subsequent production of cloned pigs. Using the cells as nuclear transfer donor cells for somatic cell cloning, cloned pigs can be obtained, which are adenomatous polyposis model pigs. Since the APC gene mutation and the resulting FAP are considered the main driving causes of CRC development, some of these cloned pigs also progress to colorectal cancer pigs and can thus be used as colorectal cancer model pigs. Non-multiples-of-3 mutations refer to deletion mutations and / or insertion mutations, and the number of nucleotides deleted and / or inserted is not a multiple of 3.

[0244] Example 3: Preparation, purification and properties of NCN protein

[0245] I. Construction of a prokaryotic Cas9 high-expression vector

[0246] The structural schematic diagram of plasmid pET-32a is shown in Figure 8 .

[0247] Plasmid pKG-GE4 was obtained by modifying plasmid pET-32a as the starting plasmid. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (abbreviated as plasmid pKG-GE4), as shown in SEQ ID NO: 1, is a circular plasmid, and the structural schematic diagram is shown in Figure 9 .

[0248] In SEQ ID NO: 1, nucleotides 5121-5139 form the T7 promoter, nucleotides 5140-5164 encode the Lac operator, nucleotides 5178-5201 form the ribosome binding site (RBS), nucleotides 5209-5271 encode the phoA signal peptide, nucleotides 5272-5598 encode the TrxA protein, nucleotides 5620-5637 encode the His-Tag (also known as the His6 tag), nucleotides 5638-5652 encode the enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode the nuclear localization signal, nucleotides 5701-9801 encode the spCas9 protein, nucleotides 9802-9849 encode the nuclear localization signal, and nucleotides 9902-9949 form the T7 terminator. The nucleotides encoding the spCas9 protein have been codon-optimized for the Escherichia coli BL21(DE3) strain.

[0249] The main modifications of plasmid pKG-GE4 are as follows: ① The coding region of TrxA protein is retained. The TrxA protein can help the expressed target protein form disulfide bonds, increase the solubility and activity of the target protein; the coding sequence of the alkaline phosphatase signal peptide is added before the coding region of the TrxA protein. The alkaline phosphatase signal peptide can direct the expressed target protein to be secreted into the periplasmic cavity of bacteria and can be cleaved by prokaryotic periplasmic signal peptidase; ② The coding sequence of His-Tag is added after the coding sequence of the TrxA protein. His-Tag can be used for the enrichment of the expressed target protein; ③ The coding sequence of the enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) is added downstream of the coding sequence of His-Tag. The purified protein will remove His-Tag and the upstream-fused TrxA protein under the action of enterokinase; ④ The codon-optimized Cas9 gene suitable for expression in Escherichia coli BL21(DE3) strain is inserted. At the same time, the coding sequences of nuclear localization signals are added upstream and downstream of this gene to increase the nuclear localization ability of the later-purified Cas9 protein.

[0250] The fusion gene in plasmid pKG-GE4 is shown as nucleotides 5209-9852 in SEQ ID NO: 1 and encodes the fusion protein shown in SEQ ID NO: 2 (the fusion protein TrxA-His-EK-NLS-spCas9-NLS, simply referred to as the PRONCN protein). Due to the presence of the alkaline phosphatase signal peptide and the enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form the protein shown in SEQ ID NO: 3, and the protein shown in SEQ ID NO: 3 is named the NCN protein.

[0251] II. Induced expression

[0252] 1. Introduce plasmid pKG-GE4 into Escherichia coli BL21(DE3) to obtain a recombinant bacterium.

[0253] 2. Inoculate the recombinant bacterium obtained in step 1 into a liquid LB medium containing 100 μg / ml ampicillin and culture it overnight at 37 °C with shaking at 200 rpm.

[0254] 3. Inoculate the bacterial liquid obtained in step 2 into a liquid LB medium and culture it at 30 °C with shaking at 230 rpm until the OD 600nm value = 1.0. Then add isopropyl β-D-thiogalactoside (IPTG) and make its concentration in the system 0.5 mM. Then culture it at 25 °C with shaking at 230 rpm for 12 hours. Then centrifuge at 4 °C and 10,000 g for 15 minutes to collect the bacterial cells.

[0255] 4. Take the bacterial cells obtained in step 3 and wash them with PBS buffer.

[0256] III. Purification of the fusion protein TrxA-His-EK-NLS-spCas9-NLS

[0257] 1. Take the bacterial cells obtained in Step 2, add the crude extraction buffer and suspend the bacterial cells, then use a homogenizer to break the bacterial cells (1000 par for three cycles), then centrifuge at 4°C and 15,000 g for 30 min, collect the supernatant, filter the supernatant through a 0.22 μm pore size filter membrane, and collect the filtrate. In this step, 10 ml of the crude extraction buffer is formulated per g of wet weight of the bacterial cells.

[0258] Crude extraction buffer: containing 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, 1 mM PMSF, and the balance is ddH2O.

[0259] 2. Purify the fusion protein by affinity chromatography.

[0260] First, equilibrate the Ni-NTA agarose column with 5 column volumes of the equilibration solution (flow rate: 1 ml / min); then load 50 ml of the filtrate obtained in Step 1 (flow rate: 0.5 - 1 ml / min); then wash the column with 5 column volumes of the equilibration solution (flow rate: 1 ml / min); then wash the column with 5 column volumes of the buffer solution (flow rate: 1 ml / min) to remove the impurity proteins; then elute with 10 column volumes of the elution solution at a flow rate of 0.5 - 1 ml / min, and collect the solution after passing through the column (90 - 100 ml).

[0261] Ni-NTA agarose column: GenScript, L00250 / L00250-C, with a packing volume of 10 ml.

[0262] Equilibration solution: containing 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, and the balance is ddH2O.

[0263] Buffer solution: containing 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, and the balance is ddH2O.

[0264] Elution solution: containing 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and the balance is ddH2O.

[0265] IV. Digestion of the fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of the NCN protein

[0266] 1. Take 15 ml of the solution after column chromatography collected in Step 3, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, with a capacity of 15 ml), and then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). Six ultrafiltration tubes are used to obtain a total of 6 ml.

[0267] 2. Add commercially sourced recombinant bovine enterokinase with His6 tag (Sangon Biotech, C620031, recombinant bovine enterokinase light chain, with His6 tag, Recombinant Bovine Enterokinase Light Chain, His) to the solution obtained in Step 1 (about 6 ml), and perform enzymatic digestion at 25 °C for 16 hours. Add 2 units of enterokinase per 50 μg of protein.

[0268] 3. Take the solution (about 6 ml) after completing Step 2, mix it with 480 μl of Ni-NTA resin (GenScript, L00250 / L00250-C), rotate and mix at room temperature for 15 min, then centrifuge at 7000 g for 3 min, and collect the supernatant (4 - 5.5 ml).

[0269] 4. Take the supernatant obtained in Step 3, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, with a capacity of 15 ml), and then add it to the enzyme storage solution to adjust the protein concentration to 5 mg / ml, which is the NCN protein solution.

[0270] Sequencing shows that for the protein in the NCN protein solution, the first 15 amino acid residues at the N-terminus are as shown in positions 1 to 15 of SEQ ID NO: 3, namely the NCN protein.

[0271] The NCN protein used in Example 2 is provided by the NCN protein solution.

[0272] Enzyme storage solution (pH 7.4): containing 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (by volume) glycerol, and the balance is ddH2O.

[0273] V. Performance of NCN Protein

[0274] Select 2 gRNA targets targeting the TTN gene as follows:

[0275] TTN-gRNA1: AGAGCACAGTCAGCCTGGCG;

[0276] TTN-gRNA2: CTTCCAGAATTGGATCTCCG.

[0277] The primers for identifying the target fragment containing the gRNA in the TTN gene are as follows:

[0278] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;

[0279] TTN-R560: CAAAGTTAACTCTCTGTGTCT.

[0280] 1. Preparation of gRNA

[0281] (1) Preparation of TTN-T7-gRNA1 transcription template and TTN-T7-gRNA2 transcription template

[0282] The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.

[0283] The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.

[0284] (2) In vitro transcription to obtain gRNA

[0285] Take the TTN-T7-gRNA1 transcription template and perform in vitro transcription using Transcript Aid T7 High Yield TranscriptionKit (Fermentas, K0441), and then use MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) for recovery and purification to obtain TTN-gRNA1. TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 6.

[0286] Take the TTN-T7-gRNA2 transcription template and perform in vitro transcription using Transcript Aid T7 High Yield TranscriptionKit (Fermentas, K0441), and then use MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) for recovery and purification to obtain TTN-gRNA2. TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 7.

[0287] 2. Optimization of the dosage ratio of gRNA to NCN protein

[0288] (1) Co-transfection of porcine primary fibroblasts

[0289] Group 1: Co-transfect primary porcine fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN protein. Ratio: Approximately 100,000 primary porcine fibroblasts: 0.5 μg TTN-gRNA1: 0.5 μg TTN-gRNA2: 4 μg NCN protein.

[0290] Group 2: Co-transfect primary porcine fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN protein. Ratio: Approximately 100,000 primary porcine fibroblasts: 0.75 μg TTN-gRNA1: 0.75 μg TTN-gRNA2: 4 μg NCN protein.

[0291] Group 3: Co-transfect primary porcine fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN protein. Ratio: Approximately 100,000 primary porcine fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.

[0292] Group 4: Co-transfect primary porcine fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN protein. Ratio: Approximately 100,000 primary porcine fibroblasts: 1.25 μg TTN-gRNA1: 1.25 μg TTN-gRNA2: 4 μg NCN protein.

[0293] Group 5: Co-transfect primary porcine fibroblasts with TTN-gRNA1 and TTN-gRNA2. Ratio: Approximately 100,000 primary porcine fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0294] Co-transfection is carried out by electroporation using a mammalian nucleofection kit (Neon kit, Thermofisher) and a Neon TM transfection system electroporator (parameter settings: 1450V, 10ms, 3pulse).

[0295] (2) After completing step (1), culture in complete culture medium for 12 - 18 hours, then replace with fresh complete culture medium for further culture. The total culture time after electroporation is 48 hours.

[0296] (3) After completing step (2), digest and collect the cells with trypsin, extract genomic DNA, perform PCR amplification using the primer pair composed of TTN-F55 and TTN-R560, and then carry out 1% agarose gel electrophoresis.

[0297] The electrophoresis diagram is shown in Figure 10The 505bp band is the wild-type band (WT), and the band around 254bp (the theoretical deletion of 251bp from the 505bp wild-type band) is the deletion mutant band (MT).

[0298] Gene deletion mutation efficiency = (MT gray value / MT band bp number) / (WT gray value / WT band bp number + MT gray value / MT band bp number) × 100%. The gene deletion mutation efficiency of the first group was 19.9%, the second group was 39.9%, the third group was 79.9%, and the fourth group was 44.3%. No mutation occurred in the fifth group.

[0299] The results showed that when the mass ratio of the two gRNAs to the NCN protein was 1:1:4 and the actual usage was 1μg:1μg:4μg, the gene editing efficiency was the highest. Therefore, the optimal dosage of the two gRNAs and the NCN protein was determined to be 1μg:1μg:4μg.

[0300] 3. Comparison of gene editing efficiency between NCN protein and commercial Cas9 protein

[0301] (1) Co-transfect porcine primary fibroblasts

[0302] Cas9-A group: Co-transfect porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and commercial Cas9-A protein. Ratio: Approximately 100,000 porcine primary fibroblasts: 1μg TTN-gRNA1: 1μg TTN-gRNA2: 4μg Cas9-A protein.

[0303] pKG-GE4 group: Co-transfect porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN protein. Ratio: Approximately 100,000 porcine primary fibroblasts: 1μg TTN-gRNA1: 1μg TTN-gRNA2: 4μg NCN protein.

[0304] Cas9-B group: Co-transfect porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and commercial Cas9-B protein. Ratio: Approximately 100,000 porcine primary fibroblasts: 1μg TTN-gRNA1: 1μg TTN-gRNA2: 4μg Cas9-B protein.

[0305] Control group: Co-transfect porcine primary fibroblasts with TTN-gRNA1 and TTN-gRNA2. Ratio: Approximately 100,000 porcine primary fibroblasts: 1μg TTN-gRNA1: 1μg TTN-gRNA2.

[0306] Co - transfection was performed by electroporation using a mammalian nucleofection kit (Neon kit, Thermofisher) and a Neon TM transfection system electroporator (parameters set as: 1450V, 10ms, 3 pulses).

[0307] (2) After completing step (1), the cells were cultured in complete medium for 12 - 18 hours, and then the medium was replaced with fresh complete medium for further culture. The total culture time after electroporation was 48 hours.

[0308] (3) After completing step (2), the cells were digested with trypsin and collected, genomic DNA was extracted, PCR amplification was performed using a primer pair consisting of TTN - F55 and TTN - R560, and then 1% agarose gel electrophoresis was carried out.

[0309] The electrophoresis pattern is shown in Figure 11 . The gene deletion mutation efficiency of the commercial Cas9 - A protein was 28.5%, the gene deletion mutation efficiency of the NCN protein was 85.6%, and the gene deletion mutation efficiency of the commercial Cas9 - B protein was 16.6%.

[0310] The results showed that compared with the commercial Cas9 protein, the NCN protein prepared by the present invention significantly improved the gene editing efficiency.

[0311] The above details the present invention. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although the present invention gives specific embodiments, it should be understood that the present invention can be further improved. In general, according to the principle of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including changes made using conventional techniques known in the art that are outside the scope disclosed in this application. Some basic features can be applied according to the scope of the following appended claims. Sequence Listing <110> Nanjing Qizhen Genetic Engineering Co., Ltd. <120> Gene Editing System for Constructing Adenomatous Polyposis Model Pigs and Colorectal Cancer Model Pigs and Its Application <130> GNCYX213459 <160> 19 <170> SIPOSequenceListing 1.0 <210> 1 <211> 9974 <212> DNA <213> Artificial Sequence <400> 1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480 tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540 tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 600 gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 660 ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 720 agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 780 agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 840 tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 900 tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 960 cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1020 aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga 1080 tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1140 tgcagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1200 ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 1260 ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1320 cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 1380 gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 1440 actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 1500 aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 1560 caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1620 aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1680 accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1740 aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1800 ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1860 agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1920 accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 1980 gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 2040 tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2100 cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2160 cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 2220 cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2280 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2340 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2400 gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatatgg 2460 tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagtatac actccgctat 2520 cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct 2580 gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 2640 gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct 2700 catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt 2760 tgagtttctc cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg 2820 ttttttcctg tttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa 2880 tgataccgat gaaacgagag aggatgctca cgatacgggt tactgatgat gaacatgccc 2940 ggttactgga acgttgtgag ggtaaacaac tggcggtatg gatgcggcgg gaccagagaa 3000 aaatcactca gggtcaatgc cagcgcttcg ttaatacaga tgtaggtgtt ccacagggta 3060 gccagcagca tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg 3120 tttccagact ttacgaaaca cggaaaccga agaccattca tgttgttgct caggtcgcag 3180 acgttttgca gcagcagtcg cttcacgttc gctcgcgtat cggtgattca ttctgctaac 3240 cagtaaggca accccgccag cctagccggg tcctcaacga caggagcacg atcatgcgca 3300 cccgtggggc cgccatgccg gcgataatgg cctgcttctc gccgaaacgt ttggtggcgg 3360 gaccagtgac gaaggcttga gcgagggcgt gcaagattcc gaataccgca agcgacaggc 3420 cgatcatcgt cgcgctccag cgaaagcggt cctcgccgaa aatgacccag agcgctgccg 3480 gcacctgtcc tacgagttgc atgataaaga agacagtcat aagtgcggcg acgatagtca 3540 tgccccgcgc ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcgag 3600 atcccggtgc ctaatgagtg agctaactta cattaattgc gttgcgctca ctgcccgctt 3660 tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 3720 gcggtttgcg tattgggcgc cagggtggtt tttcttttca ccagtgagac gggcaacagc 3780 tgattgccct tcaccgcctg gccctgagag agttgcagca agcggtccac gctggtttgc 3840 cccagcaggc gaaaatcctg tttgatggtg gttaacggcg ggatataaca tgagctgtct 3900 tcggtatcgt cgtatcccac taccgagatg tccgcaccaa cgcgcagccc ggactcggta 3960 atggcgcgca ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg 4020 atgccctcat tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct 4080 tcccgttccg ctatcggctg aatttgattg cgagtgagat atttatgcca gccagccaga 4140 cgcagacgcg ccgagacaga acttaatggg cccgctaaca gcgcgatttg ctggtgaccc 4200 aatgcgacca gatgctccac gcccagtcgc gtaccgtctt catgggagaa aataatactg 4260 ttgatgggtg tctggtcaga gacatcaaga aataacgccg gaacattagt gcaggcagct 4320 tccacagcaa tggcatcctg gtcatccagc ggatagttaa tgatcagccc actgacgcgt 4380 tgcgcgagaa gattgtgcac cgccgcttta caggcttcga cgccgcttcg ttctaccatc 4440 gacaccacca cgctggcacc cagttgatcg gcgcgagatt taatcgccgc gacaatttgc 4500 gacggcgcgt gcagggccag actggaggtg gcaacgccaa tcagcaacga ctgtttgccc 4560 gccagttgtt gtgccacgcg gttgggaatg taattcagct ccgccatcgc cgcttccact 4620 ttttcccgcg ttttcgcaga aacgtggctg gcctggttca ccacgcggga aacggtctga 4680 taagagacac cggcatactc tgcgacatcg tataacgtta ctggtttcac attcaccacc 4740 ctgaattgac tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcgccattcg 4800 atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga agcagcccag 4860 tagtaggttg aggccgttga gcaccgccgc cgcaaggaat ggtgcatgca aggagatggc 4920 gcccaacagt cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat 4980 gagcccgaag tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc 5040 aaccgcacct gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatcgagat 5100 cgatctcgat cccgcgaaat taatacgact cactataggg gaattgtgag cggataacaa 5160 ttcccctcta gaaataattt tgtttaactt taagaaggag atatacatat gaaacaaagc 5220 actattgcac tggcactctt accgttactg tttacccctg tgacaaaagc catgagcgat 5280 aaaattattc acctgactga cgacagtttt gacacggatg tactcaaagc ggacggggcg 5340 atcctcgtcg atttctgggc agagtggtgc ggtccgtgca aaatgatcgc cccgattctg 5400 gatgaaatcg ctgacgaata tcagggcaaa ctgaccgttg caaaactgaa catcgatcaa 5460 aaccctggca ctgcgccgaa atatggcatc cgtggtatcc cgactctgct gctgttcaaa 5520 aacggtgaag tggcggcaac caaagtgggt gcactgtcta aaggtcagtt gaaagagttc 5580 ctcgacgcta acctggccgg ttctggttct ggccatatgc accatcatca tcatcatgac 5640 gatgacgata agatgcccaa aaagaaacga aaggtgggta tccacggagt cccagcagcc 5700 gacaaaaaat atagcatcgg cctggacatc ggtaccaaca gcgttggctg ggcagtgatc 5760 actgatgaat acaaagttcc atccaaaaaa tttaaagtac tgggcaacac cgaccgtcac 5820 tctatcaaaa aaaacctgat tggtgctctg ctgtttgaca gcggcgaaac tgctgaggct 5880 acccgtctga aacgtacggc tcgccgtcgc tacactcgtc gtaaaaaccg catctgttat 5940 ctgcaggaaa ttttctctaa cgaaatggca aaagttgatg atagcttctt tcatcgtctg 6000 gaagagagct tcctggtgga agaagataaa aaacacgaac gtcacccgat tttcggtaac 6060 attgtggatg aggttgccta ccacgagaaa tatccgacca tctaccatct gcgtaaaaaa 6120 ctggttgata gcactgacaa agcggatctg cgtctgatct acctggctct ggcacacatg 6180 atcaaattcc gtggtcactt cctgatcgaa ggtgatctga accctgataa ctccgacgtg 6240 gacaaactgt tcattcagct ggttcagacc tataaccagc tgttcgaaga aaacccgatc 6300 aacgcgtccg gtgtagacgc taaggcaatt ctgtctgcgc gtctgtctaa gtctcgtcgt 6360 ctggaaaacc tgattgcgca actgccaggt gaaaagaaaa acggcctgtt cggcaatctg 6420 atcgccctgt ccctgggtct gactccgaac tttaaatcca actttgacct ggcggaagat 6480 gccaagctgc agctgagcaa agatacctat gacgatgacc tggataacct gctggcacag 6540 atcggtgatc agtatgccga tctgttcctg gccgcgaaaa acctgtctga tgcgattctg 6600 ctgtctgata tcctgcgcgt taacactgaa attactaaag cgccgctgag cgcatccatg 6660 attaaacgtt acgatgaaca ccaccaggat ctgaccctgc tgaaagcgct ggtgcgtcag 6720 cagctgccgg aaaaatacaa ggagatcttc ttcgaccaga gcaaaaacgg ttacgcgggc 6780 tacattgatg gtggtgcatc tcaggaggaa ttctacaaat tcattaaacc gatcctggaa 6840 aaaatggatg gtactgaaga gctgctggtt aaactgaatc gtgaagatct gctgcgcaaa 6900 cagcgtacct tcgataacgg ttccatcccg catcagattc atctgggcga actgcacgct 6960 atcctgcgcc gtcaggaaga cttttatccg ttcctgaaag acaaccgtga gaaaattgaa 7020 aaaatcctga ccttccgtat tccgtactat gtaggtccgc tggcgcgtgg taactcccgt 7080 ttcgcttgga tgacccgcaa aagcgaagaa accatcaccc cgtggaattt cgaagaagtc 7140 gttgacaaag gcgcgtccgc gcagtctttc atcgaacgca tgacgaactt cgacaaaaac 7200 ctgccgaacg agaaagtgct gccgaaacac tctctgctgt acgagtactt cactgtgtac 7260 aacgaactga ccaaagtgaa atacgtcacc gaaggtatgc gtaaaccggc attcctgtcc 7320 ggtgagcaaa aaaaagcaat cgtggatctg ctgttcaaaa ccaaccgtaa agtaaccgtg 7380 aaacagctga aggaagacta tttcaagaaa atcgaatgtt ttgattctgt tgaaatctcc 7440 ggcgtggaag atcgcttcaa tgcgtccctg ggtacgtatc acgacctgct gaaaattatc 7500 aaagacaaag attttctgga caacgaggaa aacgaagaca tcctggagga tattgtactg 7560 accctgaccc tgttcgaaga ccgtgagatg atcgaagaac gcctgaaaac ctacgcccac 7620 ctgttcgatg acaaggtaat gaagcagctg aaacgtcgtc gttataccgg ctggggtcgt 7680 ctgtcccgta aactgatcaa tggcatccgt gataaacagt ctggcaaaac catcctggac 7740 ttcctgaaat ccgacggttt cgcgaatcgt aacttcatgc aactgattca tgacgattct 7800 ctgactttca aagaagacat ccagaaagca caggtttccg gccagggtga ctctctgcac 7860 gagcacattg ccaatctggc tggttctccg gctattaaaa agggtattct gcagactgtg 7920 aaagtagttg atgagctggt caaagtaatg ggccgtcaca agccggaaaa cattgtgatc 7980 gaaatggcac gtgaaaacca gacgacccag aaaggtcaga aaaactctcg tgaacgcatg 8040 aaacgtatcg aagaaggcat caaagaactg ggctctcaga tcctgaagga acaccctgta 8100 gaaaataccc agctgcagaa cgaaaagctg tatctgtatt acctgcagaa cggccgcgat 8160 atgtatgtgg accaggaact ggatatcaac cgcctgtccg attacgatgt agatcacatc 8220 gtgccgcaaa gcttcctgaa agacgacagc attgacaaca aagtactgac ccgttctgat 8280 aagaaccgtg gcaaatccga taacgtcccg tctgaagaag ttgttaaaaa aatgaaaaac 8340 tattggcgtc agctgctgaa cgcgaaactg atcacccagc gtaagttcga caatctgact 8400 aaagctgagc gcggtggtct gtccgaactg gataaagcgg gttttatcaa acgccagctg 8460 gttgaaaccc gtcagatcac gaagcacgtt gcgcagattc tggactctcg tatgaacacc 8520 aaatacgacg aaaacgacaa actgatccgc gaggttaagg ttatcaccct gaaaagcaaa 8580 ctggtatccg attttcgtaa agactttcag ttctacaaag tgcgcgaaat taacaactat 8640 caccacgctc acgatgcata tctgaatgca gttgttggca cggcgctgat caaaaagtat 8700 ccgaaactgg aatctgaatt cgtatacggc gattacaaag tgtatgacgt tcgtaagatg 8760 atcgcaaaat ccgagcagga aattggtaag gcgacggcga aatacttctt ttattccaat 8820 attatgaact ttttcaaaac cgaaatcacc ctggcgaatg gtgaaattcg taaacgcccg 8880 ctgatcgaaa ccaacggtga aactggtgaa atcgtttggg acaaaggccg cgacttcgcg 8940 accgtgcgta aagttctgtc tatgccgcaa gtgaacatcg tcaagaagac cgaagtacaa 9000 accggcggtt ttagcaaaga gagcattctg ccaaaacgta actccgacaa actgatcgcg 9060 cgcaagaaag actgggatcc gaaaaaatac ggtggtttcg attctccaac cgttgcttat 9120 tccgttctgg tggtagccaa agttgagaaa ggtaaaagca aaaaactgaa atccgtaaag 9180 gaactgctgg gtattactat catggagcgt agctccttcg aaaaaaaccc gatcgatttt 9240 ctggaagcga aaggctataa agaagtcaaa aaggacctga tcatcaaact gccaaaatac 9300 agcctgttcg agctggaaaa cggccgtaaa cgtatgctgg catctgcggg cgaactgcag 9360 aaaggcaacg agctggctct gccgtccaaa tacgtgaact ttctgtacct ggcctctcac 9420 tacgaaaaac tgaaaggttc cccggaagac aacgaacaga aacagctgtt cgtagagcag 9480 cacaaacact acctggacga gatcatcgaa cagatttctg aattttctaa acgtgtgatt 9540 ctggctgatg cgaatctgga taaagttctg tctgcctata acaagcatcg tgacaaaccg 9600 atccgcgaac aggctgagaa catcatccac ctgttcactc tgactaacct gggcgcgcca 9660 gcggctttca agtactttga taccaccatt gaccgcaagc gttacacctc cactaaagaa 9720 gtgctggacg cgactctgat ccaccagtcc atcaccggtc tgtacgagac ccgtatcgat 9780 ctgagccagc tgggcggtga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 9840 aagaaaaagt gacaaagccc gaaaggaagc tgagttggct gctgccaccg ctgagcaata 9900 actagcataa ccccttgggg cctctaaacg ggtcttgagg ggttttttgc tgaaaggagg 9960 aactatatcc ggat 9974 <210> 2 <211> 1547 <212> PRT <213> Artificial Sequence <400> 2 Met Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr 1 5 10 15 Pro Val Thr Lys Ala Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp 20 25 30 Ser Phe Asp Thr Asp Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp 35 40 45 Phe Trp Ala Glu Trp Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu 50 55 60 Asp Glu Ile Ala Asp Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu 65 70 75 80 Asn Ile Asp Gln Asn Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly 85 90 95 Ile Pro Thr Leu Leu Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys 100 105 110 Val Gly Ala Leu Ser Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn 115 120 125 Leu Ala Gly Ser Gly Ser Gly His Met His His His His His His Asp 130 135 140 Asp Asp Asp Lys Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly 145 150 155 160 Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr 165 170 175 Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser 180 185 190 Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys 195 200 205 Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala 210 215 220 Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn 225 230 235 240 Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val 245 250 255 Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu 260 265 270 Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu 275 280 285 Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys 290 295 300 Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala 305 310 315 320 Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp 325 330 335 Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val 340 345 350 Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly 355 360 365 Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg 370 375 380 Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu 385 390 395 400 Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys 405 410 415 Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp 420 425 430 Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln 435 440 445 Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu 450 455 460 Leucine, Serine, Aspartic acid, Isoleucine, Leucine, Arginine, Valine, Asparagine, Threonine, Glutamic acid, Isoleucine, Threonine, Lysine, Alanine, Proline, Leucine 465 470 475 480 Serine, Alanine, Serine, Methionine, Isoleucine, Lysine, Arginine, Tyrosine, Aspartic acid, Glutamic acid, Histidine, Histidine, Glutamine, Aspartic acid, Leucine, Threonine 485 490 495 Leucine, Leucine, Lysine, Alanine, Leucine, Valine, Arginine, Glutamine, Glutamine, Leucine, Proline, Glutamic acid, Lysine, Tyrosine, Lysine, Glutamic acid 500 505 510 Isoleucine, Phenylalanine, Phenylalanine, Aspartic acid, Glutamine, Serine, Lysine, Asparagine, Glycine, Tyrosine, Alanine, Glycine, Tyrosine, Isoleucine, Aspartic acid, Glycine 515 520 525 Glycine, Alanine, Serine, Glutamine, Glutamic acid, Glutamic acid, Phenylalanine, Tyrosine, Lysine, Phenylalanine, Isoleucine, Lysine, Proline, Isoleucine, Leucine, Glutamic acid 530 535 540 Lysine, Methionine, Aspartic acid, Glycine, Threonine, Glutamic acid, Glutamic acid, Leucine, Leucine, Valine, Lysine, Leucine, Asparagine, Arginine, Glutamic acid, Aspartic acid 545 550 555 560 Leucine, Leucine, Arginine, Lysine, Glutamine, Arginine, Threonine, Phenylalanine, Aspartic acid, Asparagine, Glycine, Serine, Isoleucine, Proline, Histidine, Glutamine 565 570 575 Isoleucine, Histidine, Leucine, Glycine, Glutamic acid, Leucine, Histidine, Alanine, Isoleucine, Leucine, Arginine, Arginine, Glutamine, Glutamic acid, Aspartic acid, Phenylalanine 580 585 590 Tyrosine, Proline, Phenylalanine, Leucine, Lysine, Aspartic acid, Asparagine, Arginine, Glutamic acid, Lysine, Isoleucine, Glutamic acid, Lysine, Isoleucine, Leucine, Threonine 595 600 605 Phenylalanine, Arginine, Isoleucine, Proline, Tyrosine, Tyrosine, Valine, Glycine, Proline, Leucine, Alanine, Arginine, Glycine, Asparagine, Serine, Arginine 610 615 620 Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn 625 630 635 640 Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu 645 650 655 Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro 660 665 670 Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr 675 680 685 Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser 690 695 700 Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg 705 710 715 720 Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu 725 730 735 Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala 740 745 750 Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp 755 760 765 Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu 770 775 780 Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys 785 790 795 800 Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg 805 810 815 Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly 820 825 830 Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser 835 840 845 Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser 850 855 860 Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly 865 870 875 880 Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile 885 890 895 Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys 900 905 910 Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg 915 920 925 Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met 930 935 940 Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys 945 950 955 960 Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu 965 970 975 Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp 980 985 990 Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser 995 1000 1005 Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp 1010 1015 1020 Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys 1025 1030 1035 1040 Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr 1045 1050 1055 Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser 1060 1065 1070 Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg 1075 1080 1085 Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr 1090 1095 1100 Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr 1105 1110 1115 1120 Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr 1125 1130 1135 Lys Val Arg Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu 1140 1145 1150 Asn Ala Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu 1155 1160 1165 Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1170 1175 1180 Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1185 1190 1195 1200 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1205 1210 1215 Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr 1220 1225 1230 Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys 1235 1240 1245 Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln 1250 1255 1260 Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp 1265 1270 1275 1280 Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly 1285 1290 1295 Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val 1300 1305 1310 Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly 1315 1320 1325 Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe 1330 1335 1340 Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys 1345 1350 1355 1360 Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met 1365 1370 1375 Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro 1380 1385 1390 Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu 1395 1400 1405 Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln 1410 1415 1420 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser 1425 1430 1435 1440 Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1445 1450 1455 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile 1460 1465 1470 Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys 1475 1480 1485 Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu 1490 1495 1500 Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu 1505 1510 1515 1520 Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala 1525 1530 1535 Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys 1540 1545 <210> 3 <211> 1399 <212> PRT <213> Artificial Sequence <400> 3 Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala Ala 1 5 10 15 Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val Gly 20 25 30 Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys 35 40 45 Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly 50 55 60 Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys 65 70 75 80 Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr 85 90 95 Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe 100 105 110 Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His 115 120 125 Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His 130 135 140 Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser 145 150 155 160 Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met 165 170 175 Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp 180 185 190 Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn 195 200 205 Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys 210 215 220 Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu 225 230 235 240 Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu 245 250 255 Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp 260 265 270 Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp 275 280 285 Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu 290 295 300 Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile 305 310 315 320 Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met 325 330 335 Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala 340 345 350 Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp 355 360 365 Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln 370 375 380 Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly 385 390 395 400 Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys 405 410 415 Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly 420 425 430 Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu 435 440 445 Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro 450 455 460 Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met 465 470 475 480 Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val 485 490 495 Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn 500 505 510 Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu 515 520 525 Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr 530 535 540 Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys 545 550 555 560 Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val 565 570 575 Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser 580 585 590 Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr 595 600 605 Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn 610 615 620 Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu 625 630 635 640 Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His 645 650 655 Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr 660 665 670 Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys 675 680 685 Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala 690 695 700 Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys 705 710 715 720 Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His 725 730 735 Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile 740 745 750 Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg 755 760 765 His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr 770 775 780 Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu 785 790 795 800 Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 805 810 815 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln 820 825 830 Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu 835 840 845 Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp 850 855 860 Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly 865 870 875 880 Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn 885 890 895 Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe 900 905 910 Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys 915 920 925 Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr Lys 930 935 940 His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu 945 950 955 960 Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser Lys 965 970 975 Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu 980 985 990 Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val Val 995 1000 1005 Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val 1010 1015 1020 Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser 1025 1030 1035 1040 Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1045 1050 1055 Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile 1060 1065 1070 Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val 1075 1080 1085 Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met 1090 1095 1100 Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe 1105 1110 1115 1120 Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala 1125 1130 1135 Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro 1140 1145 1150 Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys 1155 1160 1165 Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met 1170 1175 1180 Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys 1185 1190 1195 1200 Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1205 1210 1215 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1235 1240 1245 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro 1250 1255 1260 Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr 1265 1270 1275 1280 Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile 1285 1290 1295 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His 1300 1305 1310 Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe 1315 1320 1325 Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr 1330 1335 1340 Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala 1345 1350 1355 1360 Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp 1365 1370 1375 Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala 1380 1385 1390 Gly Gln Ala Lys Lys Lys Lys 1395 <210> 4 <211> 225 <212> DNA <213> Artificial Sequence <400> 4 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggagagc acagtcagcc tggcggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 5 <211> 225 <212> DNA <213> Artificial Sequence <400> 5 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggcttcc agaattggat ctccggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 6 <211> 102 <212> RNA <213> Artificial Sequence <400> 6 ggagagcaca gucagccugg cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 7 <211> 102 <212> RNA <213> Artificial Sequence <400> 7 ggcuuccaga auuggaucuc cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 8 <211> 2847 <212> PRT <213> Sus scrofa <400> 8 Met Ala Ala Ala Ser Tyr Asp Gln Leu Leu Lys Gln Val Glu Ala Leu 1 5 10 15 Lys Met Glu Asn Ser Asn Leu Arg Gln Glu Leu Glu Asp Asn Ser Asn 20 25 30 His Leu Thr Lys Leu Glu Thr Glu Ala Ser Asn Met Lys Glu Val Leu 35 40 45 Lys Gln Leu Gln Gly Ser Ile Glu Asp Glu Ala Met Ala Ser Ser Gly 50 55 60 Gln Ile Asp Leu Leu Glu Arg Leu Lys Glu Leu Asn Leu Asp Ser Ser 65 70 75 80 Asn Phe Pro Gly Val Lys Leu Arg Ser Lys Met Ser Leu Arg Ser Tyr 85 90 95 Gly Ser Arg Glu Gly Ser Val Ser Ser Arg Ser Gly Glu Cys Ser Pro 100 105 110 Val Pro Met Gly Ser Phe Pro Arg Arg Gly Phe Val Asn Gly Ser Arg 115 120 125 Glu Asn Thr Ser Tyr Leu Glu Glu Leu Glu Lys Glu Arg Ser Leu Leu 130 135 140 Leu Ala Asp Leu Asp Lys Glu Glu Lys Glu Lys Asp Trp Tyr Tyr Ala 145 150 155 160 Gln Leu Gln Asn Leu Thr Lys Arg Ile Asp Ser Leu Pro Leu Thr Glu 165 170 175 Asn Phe Ser Leu Gln Thr Asp Met Thr Arg Arg Gln Leu Glu Tyr Glu 180 185 190 Ala Arg Gln Ile Arg Val Ala Met Glu Glu Gln Leu Gly Thr Cys Gln 195 200 205 Asp Met Glu Lys Arg Ala Gln Arg Arg Ile Thr Arg Ile Gln Gln Ile 210 215 220 Glu Lys Asp Ile Leu Arg Ile Arg Gln Leu Leu Gln Ser Gln Ala Thr 225 230 235 240 Glu Ala Glu Arg Ser Ser Gln Ser Lys His Glu Ala Gly Ser Tyr Glu 245 250 255 Ala Glu Arg Gln Asn Glu Gly Gln Gly Val Ala Glu Ile Ser Met Ala 260 265 270 Thr Ser Gly Asn Gly Gln Gly Ser Ser Thr Arg Val Asp His Glu Thr 275 280 285 Ala Ser Val Leu Ser Ser Ser Ser Thr His Ser Ala Pro Arg Arg Leu 290 295 300 Thr Ser His Leu Gly Thr Lys Val Glu Met Val Tyr Ser Leu Leu Ser 305 310 315 320 Met Leu Gly Thr His Asp Lys Asp Asp Met Ser Arg Thr Leu Leu Ala 325 330 335 Met Ser Ser Ser Gln Asp Ser Cys Ile Ser Met Arg Gln Ser Gly Cys 340 345 350 Leu Pro Leu Leu Ile Gln Leu Leu His Gly Asn Asp Lys Asp Ser Val 355 360 365 Leu Leu Gly Asn Ser Arg Gly Ser Lys Glu Ala Arg Ala Arg Ala Ser 370 375 380 Ala Ala Leu His Asn Ile Ile His Ser Gln Pro Asp Asp Lys Arg Gly 385 390 395 400 Arg Arg Glu Ile Arg Val Leu His Leu Leu Glu Gln Ile Arg Ala Tyr 405 410 415 Cys Glu Thr Cys Trp Glu Trp Gln Glu Ala His Glu Gln Gly Met Asp 420 425 430 Gln Asp Lys Asn Pro Met Pro Ala Pro Val Glu His Gln Ile Cys Pro 435 440 445 Ala Val Cys Val Leu Met Lys Leu Ser Phe Asp Glu Glu His Arg His 450 455 460 Ala Met Asn Glu Leu Gly Gly Leu Gln Ala Ile Ala Glu Leu Leu Gln 465 470 475 480 Val Asp Cys Glu Met Tyr Gly Leu Thr Asn Asp His Tyr Ser Ile Thr 485 490 495 Leu Arg Arg Tyr Ala Gly Met Ala Leu Thr Asn Leu Thr Phe Gly Asp 500 505 510 Val Ala Asn Lys Ala Thr Leu Cys Ser Met Lys Gly Cys Met Arg Ala 515 520 525 Leu Val Ala Gln Leu Lys Ser Glu Ser Glu Asp Leu Gln Gln Val Ile 530 535 540 Ala Ser Val Leu Arg Asn Leu Ser Trp Arg Ala Asp Val Asn Ser Lys 545 550 555 560 Lys Thr Leu Arg Glu Val Gly Ser Val Lys Ala Leu Met Glu Cys Ala 565 570 575 Leu Glu Val Lys Lys Glu Ser Thr Leu Lys Ser Val Leu Ser Ala Leu 580 585 590 Trp Asn Leu Ser Ala His Cys Thr Glu Asn Lys Ala Asp Ile Cys Ala 595 600 605 Val Asp Gly Ala Leu Ala Phe Leu Val Gly Thr Leu Thr Tyr Arg Ser 610 615 620 Gln Thr Asn Thr Leu Ala Ile Ile Glu Ser Gly Gly Gly Ile Leu Arg 625 630 635 640 Asn Val Ser Ser Leu Ile Ala Thr Asn Glu Glu His Arg Gln Ile Leu 645 650 655 Arg Glu Asn Asn Cys Leu Gln Thr Leu Leu Gln His Leu Lys Ser His 660 665 670 Ser Leu Thr Ile Val Ser Asn Ala Cys Gly Thr Leu Trp Asn Leu Ser 675 680 685 Ala Arg Asn Pro Lys Asp Gln Glu Ala Leu Trp Asp Met Gly Ala Val 690 695 700 Ser Met Leu Lys Asn Leu Ile His Ser Lys His Lys Met Ile Ala Met 705 710 715 720 Gly Ser Ala Ala Ala Leu Arg Asn Leu Met Ala Asn Arg Pro Ala Lys 725 730 735 Tyr Lys Asp Ala Asn Ile Met Ser Pro Gly Ser Ser Leu Pro Ser Leu 740 745 750 His Val Arg Lys Gln Lys Ala Leu Glu Ala Glu Leu Asp Ala Gln His 755 760 765 Leu Ser Glu Thr Phe Asp Asn Ile Asp Asn Leu Ser Pro Lys Ala Ser 770 775 780 His Arg Ser Lys Gln Arg His Lys Gln Asn Leu Tyr Gly Asp Tyr Ala 785 790 795 800 Phe Asp Ala Asn Arg His Asp Asp Asn Arg Ser Asp Asn Phe Asn Thr 805 810 815 Gly Asn Met Thr Val Leu Ser Pro Tyr Leu Asn Thr Thr Val Leu Pro 820 825 830 Ser Ser Ser Ser Ser Arg Gly Ser Leu Asp Ser Ser Arg Ser Glu Lys 835 840 845 Asp Arg Ser Leu Glu Arg Glu Arg Gly Ile Ser Ile Gly Asn Tyr His 850 855 860 Pro Ala Thr Glu Asn Pro Gly Thr Ser Ser Lys Arg Gly Leu Gln Ile 865 870 875 880 Ser Thr Thr Ala Ala Gln Ile Ala Lys Val Met Glu Glu Val Ser Ala 885 890 895 Ile His Pro Ser Gln Glu Asp Arg Asn Ser Gly Ser Thr Thr Glu Leu 900 905 910 His Cys Gly Thr Asp Glu Arg Asn Ala Leu Arg Arg Ser Ser Thr Ala 915 920 925 His Ser His Ala Asn Thr Tyr Asn Phe Thr Lys Ser Glu Asn Ser Asn 930 935 940 Arg Thr Cys Pro Met Pro Tyr Ala Lys Val Glu Tyr Lys Arg Ser Ser 945 950 955 960 Asn Asp Ser Leu Asn Ser Val Ser Ser Ser Asp Gly Tyr Gly Lys Arg 965 970 975 Gly Gln Met Lys Pro Ser Ile Glu Ser Tyr Ser Glu Asp Asp Glu Ser 980 985 990 Lys Phe Cys Ser Tyr Gly Gln Tyr Pro Ala Asp Leu Ala His Lys Ile 995 1000 1005 His Ser Ala Asn His Met Asp Asp Asn Asp Gly Glu Leu Asp Thr Pro 1010 1015 1020 Ile Asn Tyr Ser Leu Lys Tyr Ser Asp Glu Gln Leu Asn Ser Gly Arg 1025 1030 1035 1040 Gln Ser Pro Ser Gln Asn Glu Arg Trp Ala Arg Pro Lys His Ile Ile 1045 1050 1055 Glu Asp Glu Ile Lys Gln Asn Glu Gln Arg Gln Ser Arg Ser Gln Ser 1060 1065 1070 Thr Thr Tyr Pro Val Tyr Pro Glu Ser Thr Asp Asp Lys His Leu Lys 1075 1080 1085 Phe Gln Pro His Phe Gly Gln Gln Glu Cys Val Ser Pro Tyr Arg Ser 1090 1095 1100 Arg Ala Ala Asn Gly Ser Glu Ala Asn Arg Val Gly Ser Asn His Gly 1105 1110 1115 1120 Ile Asn Gln Asn Val Asn Gln Ser Leu Cys Gln Glu Asp Asp Tyr Glu 1125 1130 1135 Asp Asp Lys Pro Thr Asn Tyr Ser Glu Arg Tyr Ser Glu Glu Glu Gln 1140 1145 1150 His Glu Glu Glu Glu Arg Pro Thr Asn Tyr Ser Ile Lys Tyr Asn Glu 1155 1160 1165 Glu Lys His His Val Asp Gln Pro Ile Asp Tyr Ser Leu Lys Tyr Ala 1170 1175 1180 Thr Asp Ile Pro Ser Ser Gln Lys Pro Ala Phe Ser Phe Ser Lys Asn 1185 1190 1195 1200 Ser Ser Gly Gln Ser Thr Lys Thr Glu Arg Ile Ser Pro Ser Gly Glu 1205 1210 1215 Asn Thr Ser Thr Pro Ser Ser Asn Ala Lys Arg Gln Ser Gln Leu His 1220 1225 1230 Pro Ser Ser Ala Gln Ser Arg Ser Gly Gln Thr Pro Lys Ala Thr Ser 1235 1240 1245 Ser Ser Cys Lys Val Pro Ser Ile Asn Gln Glu Thr Ile Gln Thr Tyr 1250 1255 1260 Cys Val Glu Asp Thr Pro Ile Cys Phe Ser Arg Cys Ser Ser Leu Ser 1265 1270 1275 1280 Ser Leu Ser Ser Ala Glu Asp Glu Ile Gly Cys Asp Gln Gln Thr Gln 1285 1290 1295 Glu Thr Asp Ser Ala Asn Thr Leu Gln Ile Ala Glu Ile Lys Glu Asn 1300 1305 1310 Ser Gly Thr Arg Ser Thr Glu Glu Ser Val Ser Glu Val Pro Thr Val 1315 1320 1325 Pro Gln His Ile Arg Thr Lys Ser Ser Arg Leu Gln Ala Ser Gly Leu 1330 1335 1340 Ser Ser Glu Ser Thr Arg His Lys Ala Val Glu Phe Ser Ser Gly Ala 1345 1350 1355 1360 Lys Ser Pro Ser Lys Ser Gly Ala Gln Thr Pro Lys Ser Pro Pro Glu 1365 1370 1375 His Tyr Val Gln Glu Thr Pro Leu Met Phe Ser Arg Cys Thr Ser Val 1380 1385 1390 Ser Ser Leu Asp Ser Phe Glu Ser Arg Ser Ile Ala Ser Ser Val Gln 1395 1400 1405 Ser Glu Pro Cys Ser Gly Met Val Ser Gly Ile Ile Ser Pro Ser Asp 1410 1415 1420 Leu Pro Asp Ser Pro Gly Gln Thr Met Pro Pro Ser Arg Ser Lys Thr 1425 1430 1435 1440 Pro Pro Pro Pro Pro Pro Gln Thr Ser Gln Thr Lys Gln Glu Val Pro 1445 1450 1455 Lys Ser Lys Ala Pro Ser Ala Glu Lys Arg Glu Ser Gly Pro Lys Gln 1460 1465 1470 Ala Ala Val Asn Ala Ala Val Gln Arg Val Gln Val Leu Pro Asp Ala 1475 1480 1485 Asp Thr Leu Leu His Phe Ala Thr Glu Ser Thr Pro Asp Gly Phe Ser 1490 1495 1500 Cys Ser Ser Ser Leu Ser Ala Leu Ser Leu Asp Glu Pro Phe Ile Gln 1505 1510 1515 1520 Lys Asp Val Glu Leu Arg Ile Met Pro Pro Val Gln Glu Asn Asp Asn 1525 1530 1535 Gly Asn Glu Thr Glu Asn Glu Gln Pro Glu Lys Ser Asn Glu Asn Gln 1540 1545 1550 Glu Lys Glu Ala Glu Lys Pro Thr Asp Ser Glu Lys Asp Leu Leu Asp 1555 1560 1565 Asp Ser Asp Asp Asp Asp Ile Glu Ile Leu Glu Glu Cys Ile Ile Ser 1570 1575 1580 Ala Met Pro Thr Lys Ser Ser Arg Lys Ala Lys Lys Pro Ala Gln Thr 1585 1590 1595 1600 Ala Ser Lys Leu Pro Pro Pro Val Ala Arg Lys Pro Ser Gln Leu Pro 1605 1610 1615 Val Tyr Lys Leu Leu Pro Ser Gln Asn Arg Leu Gln Ala Gln Lys His 1620 1625 1630 Val Ser Phe Thr Pro Gly Asp Asp Val Pro Arg Val Tyr Cys Val Glu 1635 1640 1645 Gly Thr Pro Ile Asn Phe Ser Thr Ala Thr Ser Leu Ser Asp Leu Thr 1650 1655 1660 Ile Glu Ser Pro Pro Asn Glu Leu Ala Ala Gly Glu Gly Ala Arg Ala 1665 1670 1675 1680 Gly Ala Gln Ser Gly Glu Phe Glu Lys Arg Asp Thr Ile Pro Thr Glu 1685 1690 1695 Gly Arg Ser Thr Asp Glu Ala Gln Arg Gly Lys Ser Thr Ser Val Ala 1700 1705 1710 Ile Pro Glu Leu Asp Asp Asn Lys Thr Glu Glu Gly Asp Ile Leu Ala 1715 1720 1725 Glu Cys Ile Asn Ser Ala Met Pro Lys Gly Lys Ser His Lys Pro Phe 1730 1735 1740 Arg Val Lys Lys Ile Met Asp Gln Val Gln Gln Ala Ser Met Ser Ser 1745 1750 1755 1760 Ser Gly Ala Asn Lys Asn Gln Leu Asp Gly Lys Lys Lys Lys Pro Thr 1765 1770 1775 Ser Pro Val Lys Pro Ile Pro Gln Asn Ala Glu Tyr Arg Thr Arg Val 1780 1785 1790 Arg Lys Asn Thr Asp Thr Lys Asn Asn Leu Asn Ala Glu Arg Ala Phe 1795 1800 1805 Ser Asp Asn Lys Asp Ser Lys Lys Gln Ser Leu Lys Asn Asn Ser Lys 1810 1815 1820 Asp Phe Asn Asp Lys Leu Pro Asn Asn Glu Asp Arg Val Arg Gly Ser 1825 1830 1835 1840 Phe Thr Phe Asp Ser Pro His His Tyr Thr Pro Ile Glu Gly Thr Pro 1845 1850 1855 Tyr Cys Phe Ser Arg Asn Asp Ser Leu Ser Ser Leu Asp Phe Asp Asp 1860 1865 1870 Asp Asp Val Asp Leu Ser Arg Glu Lys Ala Glu Leu Arg Lys Gly Lys 1875 1880 1885 Glu Asn Lys Glu Ser Glu Ala Lys Val Ser Asn His Thr Glu Leu Ala 1890 1895 1900 Ser Asn Gln Gln Ser Ala Lys Thr Thr Gln Ala Val Thr Lys His Pro 1905 1910 1915 1920 Ile Asn Arg Gly Pro Ser Lys Pro Met Leu Gln Lys Gln Ser Thr Phe 1925 1930 1935 Pro Gln Ser Ser Lys Asp Ile Pro Asp Arg Gly Ala Ala Thr Asp Glu 1940 1945 1950 Lys Leu Gln Asn Phe Ala Ile Glu Asn Thr Pro Val Cys Phe Ser Arg 1955 1960 1965 Asn Ser Ser Leu Ser Ser Leu Ser Asp Ile Asp Gln Glu Asn Asn Asn 1970 1975 1980 Asn Lys Glu Ser Glu Pro Ile Lys Glu Thr Glu Pro Pro His Ser Gln 1985 1990 1995 2000 Gly Glu Pro Ser Lys Pro Gln Ala Ser Gly Tyr Ala Pro Lys Ser Phe 2005 2010 2015 His Val Glu Asp Thr Pro Val Cys Phe Ser Arg Asn Ser Ser Leu Ser 2020 2025 2030 Ser Leu Ser Ile Asp Ser Glu Asp Asp Leu Leu Gln Glu Cys Ile Ser 2035 2040 2045 Ser Ala Met Pro Lys Lys Lys Lys Pro Ser Arg Leu Lys Gly Asp Asn 2050 2055 2060 Glu Lys His Ser Pro Arg Asn Met Ser Gly Ile Leu Ala Glu Asp Leu 2065 2070 2075 2080 Thr Leu Asp Leu Lys Asp Ile Gln Arg Pro Asp Ser Glu His Gly Leu 2085 2090 2095 Ser Pro Asp Ser Glu Asn Phe Asp Trp Lys Ala Ile Gln Glu Gly Ala 2100 2105 2110 Asn Ser Ile Val Ser Ser Leu His Gln Ala Ala Ala Ala Ala Cys Leu 2115 2120 2125 Ser Arg Gln Ala Ser Ser Asp Ser Asp Ser Ile Leu Ser Leu Lys Ser 2130 2135 2140 Gly Ile Ser Leu Gly Ser Pro Phe His Leu Thr Pro Asp Gln Glu Glu 2145 2150 2155 2160 Lys Pro Phe Thr Ser Asn Lys Gly Pro Arg Ile Leu Lys Pro Gly Glu 2165 2170 2175 Lys Ser Thr Leu Glu Thr Lys Lys Met Glu Ser Glu Asn Lys Gly Ile 2180 2185 2190 Lys Gly Gly Lys Lys Val Tyr Lys Ser Leu Ile Thr Gly Lys Val Arg 2195 2200 2205 Ser Asn Ser Glu Ile Ser Ser Gln Met Lys Gln Pro Leu Gln Thr Asn 2210 2215 2220 Met Pro Ser Ile Ser Arg Gly Arg Thr Met Ile His Ile Pro Gly Val 2225 2230 2235 2240 Arg Asn Ser Ser Ser Ser Thr Ser Pro Val Ser Lys Lys Gly Pro Pro 2245 2250 2255 Leu Lys Thr Pro Ala Ser Lys Ser Pro Ser Glu Ser Gln Ala Ala Thr 2260 2265 2270 Thr Ser Pro Arg Gly Ala Lys Pro Ser Val Lys Ser Glu Leu Ser Pro 2275 2280 2285 Val Thr Arg Gln Thr Ser Gln Thr Ala Gly Ser Asn Lys Gly Pro Ser 2290 2295 2300 Arg Ser Gly Ser Arg Asp Ser Thr Pro Ser Arg Pro Ala Gln Gln Pro 2305 2310 2315 2320 Leu Ser Arg Pro Met Gln Ser Pro Gly Arg Asn Ser Ile Ser Pro Gly 2325 2330 2335 Arg Asn Gly Ile Ser Pro Pro Asn Lys Leu Ser Gln Leu Pro Arg Thr 2340 2345 2350 Ser Ser Pro Ser Thr Ala Ser Thr Lys Ser Ser Gly Ser Gly Lys Met 2355 2360 2365 Ser Tyr Thr Ser Pro Gly Arg Gln Met Ser Gln Thr Asn Leu Thr Lys 2370 2375 2380 Gln Thr Gly Leu Ser Lys Asn Gly Ser Ser Ile Pro Arg Ser Glu Ser 2385 2390 2395 2400 Ala Ser Lys Gly Leu Asn Gln Met Ser Cys Ser Asn Gly Ser Asn Lys 2405 2410 2415 Lys Val Glu Leu Ser Arg Met Ser Ser Thr Lys Ser Ser Gly Ser Glu 2420 2425 2430 Ser Asp Arg Ser Glu Arg Pro Val Leu Val Arg Gln Ser Thr Phe Ile 2435 2440 2445 Lys Glu Ala Pro Ser Pro Thr Leu Arg Arg Lys Leu Glu Glu Ser Ala 2450 2455 2460 Ser Phe Glu Ser Leu Ser Pro Ser Ser Arg Pro Asp Ser Pro Thr Arg 2465 2470 2475 2480 Ser Gln Ala Gln Thr Pro Val Leu Ser Pro Ser Leu Pro Asp Met Ser 2485 2490 2495 Leu Ser Thr His Ser Ser Val Gln Ala Gly Gly Trp Arg Lys Leu Pro 2500 2505 2510 Pro Asn Leu Ser Pro Thr Ile Glu Tyr Asn Asp Gly Arg Pro Ile Lys 2515 2520 2525 Arg His Asp Ile Ala Arg Ser His Ser Glu Ser Pro Ser Arg Leu Pro 2530 2535 2540 Ile Asn Arg Ser Gly Thr Trp Lys Arg Glu His Ser Lys His Ser Ser 2545 2550 2555 2560 Ser Leu Pro Arg Val Ser Thr Trp Arg Arg Thr Gly Ser Ser Ser Ser 2565 2570 2575 Ile Leu Ser Ala Ser Ser Glu Ser Ser Glu Lys Ala Lys Ser Glu Asp 2580 2585 2590 Glu Lys His Val Asn Ser Ile Ser Gly Thr Lys Gln Thr Lys Glu Ser 2595 2600 2605 Gln Val Ser Thr Lys Gly Thr Trp Arg Lys Ile Lys Glu Ser Glu Ile 2610 2615 2620 Ser Pro Thr Asn Thr Thr Ser Gln Thr Thr Ser Ser Gly Ala Ala Asn 2625 2630 2635 2640 Gly Ala Glu Ser Lys Thr Leu Ile Tyr Gln Met Ala Pro Ala Val Ser 2645 2650 2655 Lys Thr Glu Asp Val Trp Val Arg Ile Glu Asp Cys Pro Ile Asn Asn 2660 2665 2670 Pro Arg Ser Gly Arg Ser Pro Thr Gly Asn Thr Pro Pro Val Ile Asp 2675 2680 2685 Thr Ile Ser Glu Lys Gly Asn Pro Asn Ala Lys Asp Ser Lys Asp Asn 2690 2695 2700 Gln Gly Lys His Asn Val Ser Asn Gly Gly Ala Pro Thr Arg Thr Met 2705 2710 2715 2720 Gly Leu Glu Asn Arg Leu Asn Ser Phe Ile Gln Val Asp Ala Pro Asp 2725 2730 2735 Gln Lys Gly Thr Glu Thr Lys Pro Gly Gln Ser Asn Ser Val Pro Ala 2740 2745 2750 Ser Glu Thr Asn Glu Ser Ser Ile Ala Glu Arg Thr Pro Phe Ser Ser 2755 2760 2765 Ser Ser Ser Ser Lys His Ser Ser Pro Ser Gly Thr Val Ala Ala Arg 2770 2775 2780 Val Thr Pro Phe Asn Tyr Asn Pro Ser Pro Arg Lys Ser Ser Ala Asp 2785 2790 2795 2800 Ser Thr Ser Ala Arg Pro Ser Gln Ile Pro Thr Pro Val Asn Asn Asn 2805 2810 2815 Thr Lys Lys Arg Asp Ser Lys Thr Asp Asn Thr Asp Ser Ser Gly Thr 2820 2825 2830 Gln Ser Pro Lys Arg His Ser Gly Ser Tyr Leu Val Thr Ser Val 2835 2840 2845 <210> 9 <211> 1081 <212> DNA <213> Sus scrofa <400> 9 cttattacaa cacttgaaat ctcacagttt gacaatagtc agtaatgcat gtggaacctt 60 gtggaatctc tcagccagaa atcctaaaga ccaggaagca ttatgggaca tgggggcagt 120 cagcatgctc aagaacctca ttcattcaaa gcacaaaatg attgctatgg ggagcgccgc 180 agctttaagg aatctgatgg caaatagacc tgcaaagtat aaagatgcca atatcatgtc 240 tcctggttca agcttgcctt ctcttcatgt caggaaacaa aaagccctag aagcagaatt 300 agacgcccag catttatcag aaacttttga caatattgac aatttaagtc ccaaggcatc 360 tcatcgtagt aagcaaagac acaagcaaaa tctctacggt gactatgctt ttgatgccaa 420 tcgacatgac gataataggt cagacaattt taatactgga aacatgactg tcctgtcacc 480 atatttaaat actacagtgt tgcccagctc ctcttcatca aggggaagtt tagatagttc 540 tcgttctgag aaagacagaa gtttggagag agaacgaggt attagcatag gcaactacca 600 tccagcaaca gaaaatccag gaacctcttc aaagcgaggt ttgcagattt ccaccactgc 660 agcccagatc gccaaagtca tggaagaagt atcagccatt catccctccc aggaagacag 720 aaattctggg tcaaccacgg agttgcactg tgggacagat gagaggaatg cactgagaag 780 aagctctact gcccactcac acgcaaacac gtacaacttc accaagtcag aaaactcaaa 840 caggacatgt ccaatgccat atgccaaagt agaatataag agatcttcaa atgatagttt 900 aaatagtgtc agtagtagtg atggttatgg taaaagaggc cagatgaaac cttcaattga 960 atcctattct gaagacgatg aaagtaaatt ttgcagctat ggtcagtatc cagctgacct 1020 agcccataaa atacatagtg caaatcatat ggatgataat gatggagaac tagatacacc 1080 a 1081 <210> 10 <211> 100 <212> RNA <213> Artificial Sequence <400> 10 ccccuugaug aagaggagcu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 11 <211> 100 <212> RNA <213> Artificial Sequence <400> 11 cccagcuccu cuucaucaag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 12 <211> 100 <212> RNA <213> Artificial Sequence <400> 12 uucugagaaa gacagaaguu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 13 <211> 100 <212> RNA <213> Artificial Sequence <400> 13 agaaguuugg agagagaacg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 14 <211> 100 <212> RNA <213> Artificial Sequence <400> 14 agagaacgag guauuagcau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 15 <211> 100 <212> RNA <213> Artificial Sequence <400> 15 ccaggaaccu cuucaaagcg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 16 <211> 225 <212> DNA <213> Artificial Sequence <400> 16 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggagaga acgaggtatt agcatgtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 17 <211> 225 <212> DNA <213> Artificial Sequence <400> 17 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggccagg aacctcttca aagcggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 18 <211> 102 <212> RNA <213> Artificial Sequence <400> 18 ggagagaacg agguauuagc auguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 19 <211> 102 <212> RNA <213> Artificial Sequence <400> 19 ggccaggaac cucuucaaag cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102

Claims

1. Use of APC-gRNA5, APC-gRNA6 and NCN protein in preparing a kit; The APC-gRNA5 is an sgRNA, and the target sequence binding region thereof is shown as the nucleotides at positions 3-22 in SEQ ID NO: 18; the APC-gRNA6 is an sgRNA, and the target sequence binding region thereof is shown as the nucleotides at positions 3-22 in SEQ ID NO: 19; the NCN protein is as shown in SEQ ID NO: 3; The use of the kit is: preparing recombinant cells.

2. The use according to claim 1, wherein: The preparation method of the NCN protein comprises the following steps: (1) Introduce plasmid pKG-GE4 into Escherichia coli BL21(DE3) to obtain a recombinant bacterium; (2) Culture the recombinant bacterium in a liquid medium at 30 °C, then add IPTG and induce culture at 25 °C, and then collect the bacterial cells; (3) Break the collected bacterial cells and collect the crude protein solution; (4) Purify the fusion protein with His6 tag from the crude protein solution by affinity chromatography; (5) Digest the fusion protein with His6 tag with enterokinase with His6 tag, and then remove the protein with His6 tag by Ni-NTA resin to obtain the purified NCN protein; The plasmid pKG-GE4 has the fusion gene shown as the nucleotides at positions 5209-9852 in SEQ ID NO:

1.

3. A kit, comprising APC-gRNA5, APC-gRNA6 and NCN protein; The APC-gRNA5 is the APC-gRNA5 described in claim 1; the APC-gRNA6 is the APC-gRNA6 described in claim 1; the NCN protein is the NCN protein described in claim 1; The use of the kit is: preparing recombinant cells.

4. The kit according to claim 3, wherein: The preparation method of the NCN protein comprises the following steps: (1) Introduce plasmid pKG-GE4 into Escherichia coli BL21(DE3) to obtain a recombinant bacterium; (2) Culture the recombinant bacterium in a liquid medium at 30 °C, then add IPTG and induce culture at 25 °C, and then collect the bacterial cells; (3) Break the collected bacterial cells and collect the crude protein solution; (4) Purify the fusion protein with His6 tag from the crude protein solution by affinity chromatography; (5) Digest the fusion protein with His6 tag with enterokinase with His6 tag, and then remove the protein with His6 tag by Ni-NTA resin to obtain the purified NCN protein; The plasmid pKG-GE4 has the fusion gene shown as the nucleotides at positions 5209-9852 in SEQ ID NO:

1.

5. A method for preparing recombinant cells, comprising the following steps: co-transfecting porcine cells with APC-gRNA5, APC-gRNA6 and NCN protein to obtain recombinant cells; APC-gRNA5 is the APC-gRNA5 described in claim 1; APC-gRNA6 is the APC-gRNA6 described in claim 1; NCN protein is the NCN protein described in claim 1.

6. The method according to claim 5, wherein: The method for preparing the NCN protein comprises the following steps: (1) Introduce plasmid pKG-GE4 into Escherichia coli BL21(DE3) to obtain recombinant bacteria; (2) Cultivate the recombinant bacteria in a liquid medium at 30 °C, then add IPTG and induce cultivation at 25 °C, and then collect the bacterial cells; (3) Break the collected bacterial cells and collect the crude protein solution; (4) Purify the fusion protein with His6 tag from the crude protein solution by affinity chromatography; (5) Digest the fusion protein with His6 tag with enterokinase with His6 tag, and then remove the protein with His6 tag using Ni-NTA resin to obtain purified NCN protein; The plasmid pKG-GE4 has a fusion gene shown by the nucleotide positions 5209-9852 in SEQ ID NO: 1.

Images