A method for constructing a nano-probe with an antenna structure and applications thereof
By constructing nanoprobes with antenna structures on the surface of gold nanorods, and utilizing the synergistic effect of T4 PNK and gold nanospheres, the problem of DNA-encoded nucleic acid probes being easily degraded in complex biological matrices was solved, achieving high signal output and high sensitivity detection results.
Patent Information
- Application Number
- CN202210129894.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-02-11
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2042-02-11
AI Technical Summary
Existing DNA-encoded nucleic acid probes are easily degraded in complex biological matrices, leading to signal leakage and high background, which limits their application in the field of life analysis. How to develop novel DNA-encoded nucleic acid nanoprobes with high specificity, high sensitivity and structural stability is an urgent problem to be solved by researchers.
A nanoprobe with an antenna structure was constructed by performing a one-step RCA reaction on the surface of gold nanorods to form a "tower" structure. Using T4 PNK as a bioactive molecular model, the gold nanorods served as the base of the "signal tower," and the long RCA chains carrying a large number of Cy3 molecules acted as "antennas." A large number of gold nanospheres were connected by Au-S chemical bonds to form a high-density Raman hotspot.
It achieves high signal output in complex biological matrices, significantly enhances Raman signals, and provides a sensitive and specific detection method, offering new ideas for early clinical diagnosis and treatment.
Smart Images

Figure CN115287334B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of nanobiomaterial synthesis, and particularly relates to a construction method of a nano probe with an antenna structure and application thereof. BACKGROUND
[0002] There are many factors in work and life that can cause damage or mutation to genetic material in cells. For example, strong sun exposure or long-term ultraviolet radiation, long-term contact with toxic substances or residues of toxic substances, etc. can cause some parts or organs of the human body to become diseased due to gene mutation. Therefore, due to self-protection mechanisms, there are many substances in the human body that act on genetic material protection or gene repair.
[0003] Studies have shown that bioactive molecules closely related to malignant diseases mainly regulate the expression of pathogenic genes at the levels of epigenetics or transcription. The sensitive detection of bioactive molecules (microRNAs and DNA repair enzyme activities) related to malignant diseases in clinical liquid samples (urine samples, plasma or cell lysates) is of great significance for studying the mechanism of disease occurrence, prevention and drug efficacy monitoring. However, the abundance of these substances in clinical liquid samples is extremely low, and the sensitivity of classical probe detection is not enough. How to develop high-sensitivity and high-specificity functional probes is a bottleneck problem faced by bioactive molecule detection.
[0004] DNA nanocoding technology and the physical and chemical properties of DNA itself provide a new idea for the design of new functional probes. Among them, multifunctional nucleic acid probes based on DNA molecular coding technology have precise base pairing properties, excellent addressable ability and the advantage of carrying multiple functional units, which are beneficial to the flexible design of signal transduction and signal output mode, and show great potential in improving the affinity and signal output strength of biological systems. Traditional DNA molecular coding nucleic acid probes mainly rely on base pairing properties for target molecule detection, and the single recognition mode has low fault tolerance. Moreover, the probe structure is single, which is easily degraded in complex biological substrates, leading to signal leakage and high background, limiting its application in the field of life analysis. Therefore, how to develop new DNA molecular coding nucleic acid nano probes with high specificity, high sensitivity and stable structure to realize high signal output in complex biological matrix is a problem that researchers need to solve at present. SUMMARY
[0005] The purpose of the present application is to overcome the deficiencies of the prior art, and to provide a construction method of a nano probe with an antenna structure and application thereof.
[0006] The first purpose of the present application is to provide a construction method of a nano probe with an antenna structure, comprising the following steps:
[0007] S1, the 5' end thiol-modified DNA short primer probe P1 solution and the 5' end hydroxylated padlock probe P-circle solution are respectively placed at 95°C, heated for 5 min, and then slowly cooled to room temperature to obtain the short chain probe P1 solution and the circular structure probe P-circle solution;
[0008] S2, the gold nanorod solution and the short chain probe solution obtained in step S1 are added to a buffer solution containing 1×T4 DNA ligase, mixed thoroughly for 4 h to obtain the gold nanorod-P1 probe;
[0009] S3, 10 mM ATP, 5 U PNK and 5×T4 PNK buffer solution are added to the circular structure probe P-circle solution obtained in step S1, mixed uniformly, and placed at 37°C for shaking incubation for 1 h to obtain the modified probe P-circle;
[0010] S4, the gold nanorod-P1 probe obtained in step S2 is mixed with the modified probe P-circle obtained in step S3, and placed at 37°C for shaking incubation for 1 h to obtain the composite probe;
[0011] S5, 10 U Phi29 DNA polymerase, 50 ng BSA and 25 mM dNTPs are added to a buffer solution containing 1×Phi29 DNA polymerase to obtain a composite buffer solution, the composite probe obtained in step S4 is mixed with a buffer solution containing 10 U T4 DNA ligase, and incubated at 37°C for 1 h, then the composite buffer solution is added, and incubated at 37°C for 1.5 h, 1 μM of the two-end modified primer probe P2 is added, and incubated at 37°C for 2 h, and then 0.25 mg / mL gold nanosphere particles are added, and incubated at room temperature for 8 h, followed by centrifugation, washing, collection of the lower solution, and resuspension to obtain the nano probe with an antenna structure.
[0012] Preferably, in step S1, the concentration of the DNA short primer probe P1 solution and the padlock probe P-circle solution is 1 μM, and the molar ratio of the short chain probe P1 in the short chain probe P1 solution to the circular structure probe P-circle in the circular structure probe P-circle solution is 1:1.
[0013] Preferably, in steps S2 and S5, the buffer solution comprises 50 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT and 1 mM ATP, and the pH of the buffer solution is 7.5.
[0014] Preferably, in step S3, the T4 PNK buffer solution comprises 70 mM Tris-HCl, 10 mM MgCl2 and 5 mM DTT, and the pH of the T4 PNK buffer solution is 7.60.
[0015] Preferably, in step S5, the buffer solution comprises 330 mM Tris-acetate, 100 mM Mg-acetate, 660 mM K-acetate, 1% Tween 20, and 10 mM DTT.
[0016] A second object of the present application is to provide a nano-probe prepared by the method for constructing the nano-probe with the antenna structure.
[0017] A third object of the present application is to provide an application of the nano-probe with the antenna structure in T4 PNK detection.
[0018] Compared with the prior art, the present application has the following beneficial effects:
[0019] (1) The present application takes T4 PNK as a model of bioactive molecules, and completes the construction of the "tower" by one-step RCA reaction on the surface of gold nanorods. The rich base coding sites on the long chain serve as the hook of the nucleic acid functional monomer. The short chain of DNA with thiol and fluorescent dye Cy3 at the end is riveted to the long chain of RCA-DNA, forming a functional hybrid double-stranded fragment. After adding gold nanospheres, a large number of gold nanospheres and Raman labels Cy3 are arranged along the long chain of RCA due to the stable and firm Au-S chemical bond formed by thiol and gold, forming a "wireless signal tower" type composite nano-probe.
[0020] (2) The gold nanorods in the system of the present application serve as the base of the "signal tower", and the long chain of RCA carrying a large number of Cy3 serves as the "antenna". A large number of gold nanosphere particles are stuck on the "antenna" due to the rich SH sites of the long chain of RCA, locally forming a high-density Raman hot spot.
[0021] (3) The synergistic effect of the gold nanorods and nanospheres in the present application leads to significantly enhanced Raman signals. This strategy provides a new strategy for using the long chain of RCA to encode multiple nanoparticles to enhance Raman signals, and provides a new idea for early diagnosis and treatment in clinic. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 The design of the nano-probe with the antenna structure provided in Example 1 of the present application and the schematic diagram of sensitive detection of T4 PNK;
[0023] Figure 2 The Raman spectra under different conditions;
[0024] Among them: Figure 2 (a) is the Raman spectrum obtained after the nano-probe with the antenna structure provided in Example 1 of the present application recognizes the target molecule T4 PNK; Figure 2(b) Raman spectrum of the detection system in the absence of target T4 PNK; Figure 2 (c) Raman spectrum of the detection system in the presence of buffer solution only;
[0025] Figure 3 Agarose gel electrophoresis chart of each stage product of the nano-probe with antenna structure provided by the embodiment of the present application;
[0026] Wherein: each lane is M: DNA Marker, 1-4 represent P-circle, P1+P-circle, RCA reaction product and RCA reaction product+P2 respectively;
[0027] Figure 4 Graph of the influence of different parameters on Raman intensity;
[0028] Wherein: Figure 4 (a) is the graph of the influence of the concentration of Cy3 (P2) on Raman intensity; Figure 4 (b) is the graph of the influence of the concentration of gold nanospheres on Raman intensity; Figure 4 (c) is the graph of the influence of the incubation time of gold nanospheres on Raman intensity; Figure 4 (d) is the graph of the influence of the RCA reaction time on Raman intensity;
[0029] Figure 5 Raman spectrum of the nano-probe provided by the embodiment 1 of the present application in response to different concentrations of T4 PNK and the linear relationship graph between Raman intensity and target T4 PNK concentration;
[0030] Wherein: Figure 5 (a) is the Raman spectrum in response to different concentrations of T4 PNK; Figure 5 (b) is the linear relationship graph between Raman intensity and target T4 PNK concentration;
[0031] Figure 6 Investigation graph of the selectivity of the nano-probe provided by the embodiment 1 of the present application to different substances;
[0032] Figure 7 Stability test graph of the nano-probe provided by the embodiment 1 of the present application under the same condition (repeated experiment times N=10). DETAILED DESCRIPTION
[0033] In order to make the purpose, technical scheme and advantages of the present application more clear, the present application is further described in detail below in combination with the drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application, and are not used to limit the present application.
[0034] The DNA oligonucleotides in the embodiments of the application are purchased from Shengong Bioengineering Co., Ltd. (China, Shanghai), and the sequences are shown in Table 1 as follows:
[0035]
[0036] Example 1
[0037] The embodiment of the application provides a construction method of a nano probe with an antenna structure, and specifically comprises the following steps:
[0038] S1, 5' thiol-modified DNA short primer probe P1 and 5' hydroxylated padlock probe P-circle are respectively prepared into 1 mu m DNA short primer probe P1 solution and 5' hydroxylated padlock probe P-circle solution with a concentration of 1 mu m by using 1 x T4 DNA ligase buffer solution, then 10 mu L of 5' thiol-modified DNA short primer probe P1 solution with a concentration of 1 mu m and 10 mu L of 5' hydroxylated padlock probe P-circle solution with a concentration of 1 mu m are respectively placed at 95 DEG C, heated for 5 min, and then slowly cooled to room temperature to obtain short chain probe P1 solution and circular structure probe P-circle solution with a connecting gap;
[0039] S2, 100 mu L of gold nanorods (100 nm) with a concentration of 0.05 mg / mL and 10 mu L of short chain probe solution obtained in step S1 are added into a buffer solution (50 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT, 1 mM ATP, pH 7.5) containing 1 x T4 DNA ligase, and are mixed for 4 h, so that P1 is closely arranged on the surface of the gold nanorods by using Au-S bond to obtain gold nanorod-P1 probe;
[0040] S3, 10 mu L of circular structure probe P-circle solution obtained in step S1 is added into 10 mu L of ATP with a concentration of 10 mM, 60 mu L of PNK with a concentration of 5 U / mu L and 5 mu L of 5 x T4 PNK buffer solution (70 mM Tris-HCl, 10 mM MgCl2, 5 mM DTT, pH 7.60), and is mixed uniformly and placed at 37 DEG C for oscillation incubation for 1 h, so that T4 PNK is used for phosphorylation reaction on the 5' end of the padlock probe to obtain modified probe P-circle;
[0041] S4, the gold nanorod-P1 probe obtained in step S2 is mixed with the modified probe P-circle obtained in step S3, and is placed at 37 DEG C for oscillation incubation for 1 h to obtain a composite probe;
[0042] S5, 10 U Phi29 DNA polymerase, 50 ng BSA, 25 mM dNTPs are added into 1x Phi29 DNA polymerase buffer solution (330 mM Tris-acetate, 100 mM Mg-acetate, 660 mM K-acetate, 1% (v / v) Tween 20, 10 mM DTT) to obtain a complex buffer solution, the complex probe obtained in step S4 is mixed with a buffer solution containing 10 U T4 DNA ligase, and incubated at 37°C for 1 h to promote the ligation reaction of the padlock probe P-circle, then the complex buffer solution is added, and incubated at 37°C for 1.5 h to promote the rolling circle amplification reaction on the surface of the gold rod, 30 μL of two-end modified primer probe P2 (Cy3-P2-SH) with a concentration of μM is added, and incubated at 37°C for 2 h, and then 60 μL of gold nanosphere particle (13 nm) solution with a concentration of 0.25 mg / mL is added, and incubated at room temperature for 8 h to promote the arrayed arrangement of the gold nanosphere particles on the surface of the gold rod, and then centrifuged at 10000 rpm for 30 min, washed, and the lower solution is collected and resuspended to obtain the nano probe with the antenna structure, and the Raman spectrum is scanned under 633 nm laser.
[0043] The periodic fragment of the nano probe with the antenna structure in the embodiment 1 of the present application is: the complementary structure of TAGGACTGCTGAGAAACTGCTGTAAGACTGAGCCAGAGATACGACATTGAGAAACTGCTGTAAGACTGAGGTACGA and CTC AGT CTTACA GCA GTT TCT CA.
[0044] The structure and performance of the nano probe with the antenna structure prepared in the embodiment 1 of the present application are analyzed as follows.
[0045] The design of the nano probe with the antenna structure provided in the embodiment 1 of the present application and the specific principle of sensitive detection of T4 PNK are shown in the following Figure 1 Figure 1 It can be seen that the padlock probe P-circle end sequence can hybridize with the 5' thiol-modified DNA short primer probe P1 and has multifunctionality, and its complementary sequence can recognize the dual-labeled probe P2. First, the 5' thiol-modified DNA short primer probe P1 is incubated with the gold nanorod, and the P1 is closely arranged on the surface of the gold nanorod. In the presence of the target T4 PNK, the 5' end hydroxyl group of the padlock probe P-circle is phosphorylated, and then hybridizes with P1 to form a stable partially double-stranded probe with a connected gap ring structure. Under the action of T4 DNA ligase, a closed loop P-circle is obtained. Subsequently, under the action of phi29 DNA polymerase, linear RCA is carried out to form a long repeated P-circle copy. After adding the primer probe P2, P2 can form multiple double-stranded fragments along the RCA product on the surface of the gold nanorod. Then, gold nanosphere particles are added to the above system, and due to the stable and firm Au-S chemical bond formed by thiol and gold, a large number of gold nanosphere particles and Raman labels Cy3 are arranged along the double-stranded fragments of RCA, forming a "wireless signal tower" type nano probe. Among them, the gold rod serves as the "tower" base, and the RCA long chain carrying a large number of Cy3 serves as the "antenna". Benefiting from the rich SH sites of the RCA long chain, a large number of gold nanosphere particles are stuck to the "antenna", locally forming a high-density Raman hot spot. The synergistic effect of the nanorod and the nanosphere also significantly enhances the Raman signal. When there is no T4 PNK in the system, the 5' end hydroxyl group of the padlock probe P-circle cannot be phosphorylated, and then hybridizes with P1 to form a stable partially double-stranded probe with a connected gap ring structure. Under the action of T4 DNA ligase, a closed loop P-circle cannot be obtained. Therefore, the hybridization formed complex probe cannot trigger the subsequent rolling circle amplification reaction, and thus cannot produce a long double-stranded fragment capable of hybridizing with P2, resulting in that after the addition of gold nanosphere, it is still separated from the gold nanorod, and the distance between them is too long to realize Raman enhancement. Therefore, by measuring the Raman signal of the system, the sensitive and accurate analysis of the activity of T4 PNK can be realized.
[0046] In order to verify the feasibility of the nano probe provided in Embodiment 1 of the present application, the Raman spectrum signal of the nano probe provided in Embodiment 1 of the present application was collected under different conditions. As shown in FIG. 2, the Raman spectrum signal of the nano probe provided in Embodiment 1 of the present application was collected under different conditions. Figure 2As shown, when T4 PNK exists in the system to be detected, enhanced Raman response can be detected. The reason is that T4 PNK can regulate phosphorylation reaction to phosphorylate the 5' end of the amplification template. The template that has been phosphorylated and assembled on the gold rod can be sequentially subjected to RCA under the action of T4 DNA ligase and Phi29 DNA polymerase, and the product can be loaded with abundant P2 and gold nanosphere particles, and then assembled into a Raman enhancement tower containing a large number of "Hot Spots", so that the enhanced Raman response can be detected. When T4 PNK does not exist in the system to be detected, the 5' hydroxylated template cannot normally perform RCA, so that the system cannot normally operate, and the enhanced Raman signal cannot be detected.
[0047] In order to further verify the performance of the nano probe provided in Example 1 of the present application, gel electrophoresis test was performed on the product of the reaction process of the nano probe provided in Example 1 of the present application, and the results are shown in Figure 3 As shown, high molecular weight reaction products are obtained in lanes 3 and 4, proving that the RCA reaction of the nano probe of Example 1 of the present application is successfully operated. Figure 3 As can be seen, high molecular weight reaction products are obtained in lanes 3 and 4, proving that the RCA reaction of the nano probe of Example 1 of the present application is successfully operated.
[0048] In order to determine the optimal conditions for the operation of the system, the conditions affecting the experiment were screened and optimized. As shown in Figure 4 As shown, when the concentration of Raman tag P2 is kept unchanged, the Raman signal given by the system is gradually enhanced with the increase of the amount of gold nanosphere particles added. However, when the ratio of Raman tag P2 to gold nanosphere particles exceeds a certain limit, the relative concentration decreases, and the signal response decreases with the increase of the ratio of the substrate, so that the optimal amount of gold nanosphere particles added is 60 μL (0.25 mg / mL). At the same time, the effect of incubation time of gold nanosphere particles on the Raman signal of the system was investigated, and it was found that the Raman signal gradually increased with the increase of the incubation time, and reached a platform at about 8 h. Based on this, we also obtained the appropriate concentration of P2 as 1.0 μM. Finally, the effect of incubation time of the rolling circle amplification reaction on the Raman signal of the system was carefully investigated, and it was found that the Raman signal showed a trend of first increasing and then decreasing with the increase of the reaction time of the rolling circle amplification reaction, and the optimal reaction time was about 90 min. The weakening of the signal is due to the cross-linking of the long chains of the amplified nucleic acid or other nucleic acid chains into a group, resulting in the decrease of the Raman response of the system.
[0049] In order to verify the detection sensitivity of the nano probe provided in Example 1 of the present application, the Raman signal response of T4 PNK with different concentrations was recorded under the optimal conditions, and the Raman signal intensity increased with the increase of the concentration, and the detection range was 0.0001-5 U / mL, as shown in Figure 5As shown, the Raman signal intensity of the sensing system exhibits a good linear relationship with the concentration of T4 PNK in the range of 0.0005–1 U / mL. The linear correlation equation is Y = 881.58logC T4PNK +3665.07, correlation coefficient (R) 2 The value is 0.97166, where Y is the Raman signal intensity of the system and C is the concentration of T4 PNK in the system. Based on the three-standard-deviation principle, the detection limit is 0.234 mU / mL, demonstrating a high T4 PNK detection strategy.
[0050] To verify the specificity of the nanoprobe provided in Example 1 of this invention, a buffer solution was used as a control group, and heat-inactivated T4 PNK, uracil DNA glycosylase (UDG), and DNA exonuclease I (Exo I) were used as interfering factors, all at a concentration of 10 U / mL. Specificity experiments were conducted, and the results are as follows. Figure 6 As shown, through Figure 6 It can be seen that a high SERS signal was detected in the presence of T4 PNK, while no obvious SERS signal was detected for heat-inactivated T4 PNK, because inactivated T4 PNK cannot phosphorylate P-circle5', making subsequent experiments impossible. No obvious SERS signal was also found in UDG, Exo I, and the buffer-only control group. These results indicate that the nanoprobe provided in Example 1 of this invention has good selectivity for T4 PNK. Furthermore, to examine the reproducibility and stability of this system, we conducted 10 consecutive repeated experiments under optimal conditions, ensuring as few variables as possible. The results are as follows... Figure 7 As shown, through Figure 7 As can be seen, the reproducibility is good.
[0051] In summary, the antenna-structured nanoprobe provided in this embodiment of the invention utilizes the T4 PNK repair function to initiate the RCA reaction and complete the infrastructure of the tower-like gold nanorod. After the upstream amplification reaction is completed, a large number of gold nanospheres and Raman-tagged Cy3 are arranged closely along the long chain products of RCA on the gold rod, forming a "nano-signal tower". The gold rod acts as the base of the "tower", and the long chain of RCA carrying a large amount of Cy3 acts as the "antenna". Thanks to the complementary presence of a large number of SH-modified Raman-tagged Cy3 on the long chain of RCA, a sufficient number of gold nanospheres are anchored by the "antenna", and the hot spots generated by the nanorods / spheres and their synergistic effect produce an enhanced Raman signal.
[0052] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. A method of constructing a nanoprobe having an antenna structure, characterized by, The method comprises the following steps: S1, the 5' end thiol-modified DNA short primer probe P1 solution and the 5' end hydroxylated padlock probe P-circle solution are respectively placed at 90-95 DEG C, heated for 5-10 min, and then slowly cooled to room temperature to obtain the short-chain probe P1 solution and the circular secondary structure probe P-circle solution; S2, the gold nanorod solution and the short-chain probe P1 solution obtained in step S1 are added to a buffer solution containing 1x T4 DNA ligase, mixed thoroughly for 4 h to obtain the gold nanorod-P1 probe; S3, 10 mM ATP, 5 U PNK and 5x T4 PNK buffer solution are added to the circular secondary structure probe P-circle solution obtained in step S1, mixed uniformly, and placed at 37 DEG C for 1 h of shaking incubation to obtain the modified probe P-circle; S4, the gold nanorod-P1 probe obtained in step S2 is mixed with the modified probe P-circle obtained in step S3, and incubated at 37 DEG C for 1 h of shaking to obtain the composite probe; S5, 10 U Phi29 DNA polymerase, 50 ng BSA and 25 mM dNTPs are added to a buffer solution containing 1x Phi29 DNA polymerase to obtain a composite buffer solution, the composite probe obtained in step S4 is mixed with a buffer solution containing 10 U T4 DNA ligase, and incubated at 37 DEG C for 1 h, then the composite buffer solution is added, and incubated at 37 DEG C for 1.5 h, 1 mu M of the two-end modified primer probe P2 is added, and incubated at 37 DEG C for 2 h, the primer probe P2 forms multiple double-stranded fragments along the RCA product on the surface of the gold nanorod, and then 0.25 mg / mL of the gold nanosphere particle solution is added, and incubated at room temperature for 8 h, then centrifuged, washed, the lower solution is collected, resuspended, the thiol forms a stable and firm Au-S chemical bond with gold, and the gold nanosphere particles and the Raman label Cy3 are arranged along the double-stranded fragments of the RCA to form a wireless signal tower type nano probe, that is, the nano probe with an antenna structure is obtained; Wherein, the gold nanorod serves as the base of the wireless signal tower, the RCA long chain carrying a large amount of Cy3 serves as the antenna, and the gold nanosphere particles are tied to the antenna to form a high-density Raman hot spot.
2. The method for constructing a nanoprobe with an antenna structure according to claim 1, characterized in that, In step S1, the concentration of the DNA short primer probe P1 solution and the padlock probe P-circle solution is 1 mu M.
3. The method for constructing a nanoprobe with an antenna structure according to claim 1, characterized in that, In step S1, the molar ratio of the short-chain probe P1 in the short-chain probe P1 solution to the circular structure probe P-circle in the circular secondary structure probe P-circle solution is 1:
1.
4. The method of claim 1, wherein the nano-probe having an antenna structure is constructed by using a material selected from the group consisting of gold, silver, copper, aluminum, platinum, palladium, nickel, and alloys thereof. In steps S2 and S5, the buffer solution comprises 50 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT and 1 mM ATP, and the pH of the buffer solution is 7.
5.
5. The method for constructing a nanoprobe with an antenna structure according to claim 1, characterized in that, The T4 PNK buffer solution in step S3 comprises 70 mM Tris-HCl, 10 mM MgCl2, 5 mM DTT, and has a pH of 7.
60.
6. The method for constructing a nanoprobe with an antenna structure according to claim 1, characterized in that, The buffer solution in step S5 comprises 330 mM Tris-acetate, 100 mM Mg-acetate, 660 mM K-acetate, 1% Tween 20, 10 mM DTT.
7. The nano-probe with antenna structure prepared by the construction method according to any one of claims 1-6.
8. Use of the nano-probe with antenna structure according to claim 7 in preparation of a T4 PNK detection reagent.