SARS-CoV-2 RBD-specific monoclonal antibodies and their applications

Abstract

The present invention belongs to the technical field of monoclonal antibodies, and specifically discloses a novel coronavirus RBD-specific monoclonal antibody, wherein the heavy chain amino acid sequence is shown in SEQ ID NO: 1; and the light chain amino acid sequence is shown in SEQ ID NO: 2. The present invention also provides the application of the novel coronavirus RBD-specific monoclonal antibody. The present invention has important scientific significance and application prospects for the prevention, clinical treatment and development of diagnostic reagents for diseases caused by the novel coronavirus SARS-CoV-2.

Description

Technical Field

[0001] The present invention belongs to the field of monoclonal antibody technology, and in particular relates to novel coronavirus RBD-specific monoclonal antibodies and applications. Background Art

[0002] Antibodies are immunoglobulin molecules composed of four polypeptide chains, including two heavy chains (H chains) and two light chains (L chains). The H chain consists of a heavy chain variable region (VH) and a heavy chain constant region, which consists of three regions: CH1, CH2, and CH3. The L chain consists of an L chain variable region (VL) and a light chain constant region, which consists of a CL region. VH and VL can be further divided into hypervariable regions called complementarity determining regions (CDRs) and alternately distributed conserved regions called framework regions (FRs).

[0003] Current research has found that the new coronavirus (SARS-CoV-2) has four main structural proteins, namely spike protein (S protein), nucleocapsid protein (N protein), membrane protein (M protein) and envelope protein (E protein). The S protein has two subunits: S1 and S2. The receptor binding site (RBD) is located on the S1 subunit. Its main function is to recognize host cell surface receptors and mediate fusion with host cells.

[0004] The Chinese invention patent application with application publication number CN111303280A discloses a fully human monoclonal antibody with high neutralizing activity against SARS-CoV-2. The above patent provides a fully human monoclonal antibody whose recognition region is the S1 non-RBD region. However, since the new coronavirus invades host cells by binding to the host cell's ACE2 through RBD, the fully human monoclonal antibody obtained in the above patent has limited blocking effect on the virus. In addition, the above patent obtains antibody cDNA by labeling plasma cells, but compared with plasma cells, memory B cells respond quickly after activation, so memory B cells can induce a faster and stronger humoral immune response than the primary reaction, while the humoral immune response induced by plasma cells is limited. Summary of the invention

[0005] In order to achieve the above-mentioned object, the present invention provides a novel coronavirus RBD-specific monoclonal antibody, specifically, the heavy chain variable region amino acid sequence of the antibody is shown in SEQ ID NO: 21; the light chain variable region amino acid sequence is shown in SEQ ID NO: 22 (monoclonal antibody 11-CQT202). The heavy chain variable region amino acid sequence can also be shown in SEQ ID NO: 23; the light chain variable region amino acid sequence can also be shown in SEQ ID NO: 24 (monoclonal antibody 12-CQT203). The heavy chain variable region amino acid sequence can also be shown in SEQ ID NO: 25; the light chain variable region amino acid sequence can also be shown in SEQ ID NO: 26 (monoclonal antibody 13-CQT206). The heavy chain variable region amino acid sequence can also be shown in SEQ ID NO: 27; the light chain variable region amino acid sequence can also be shown in SEQ ID NO: 28 (monoclonal antibody 14-CQT209). The heavy chain variable region amino acid sequence can also be shown in SEQ ID NO: 29; the light chain variable region amino acid sequence can also be shown in SEQ ID NO: 30 (monoclonal antibody 15-CQT210). The heavy chain variable region amino acid sequence may also be shown as SEQ ID NO:31; the light chain variable region amino acid sequence may also be shown as SEQ ID NO:32 (monoclonal antibody 16-CQT212). The heavy chain variable region amino acid sequence may also be shown as SEQ ID NO:33; the light chain variable region amino acid sequence may also be shown as SEQ ID NO:34 (monoclonal antibody 17-CQT215). The heavy chain variable region amino acid sequence may also be shown as SEQ ID NO:35; the light chain variable region amino acid sequence may also be shown as SEQ ID NO:36 (monoclonal antibody 18-CQT216). The heavy chain variable region amino acid sequence may also be shown as SEQ ID NO:37; the light chain variable region amino acid sequence may also be shown as SEQ ID NO:38 (monoclonal antibody 19-CQT217). The heavy chain variable region amino acid sequence may also be shown as SEQ ID NO:39; the light chain variable region amino acid sequence may also be shown as SEQ ID NO:40 (monoclonal antibody 20-CQT218).

[0006] The present invention also provides the above-mentioned novel coronavirus RBD-specific monoclonal antibody, and its use in the preparation of a reagent, vaccine or drug for detecting or diagnosing SARS-CoV-2; it also provides a nucleic acid molecule encoding the above-mentioned novel coronavirus RBD-specific monoclonal antibody; it also provides an expression cassette, a recombinant vector, a recombinant bacterium or a transgenic cell line containing the above-mentioned nucleic acid molecule; it also provides the use of the above-mentioned expression cassette, recombinant vector, recombinant bacterium or transgenic cell line in the preparation of a product.

[0007] The present invention also provides a product, including the above-mentioned novel coronavirus RBD-specific monoclonal antibody; the product has any of the following uses (b1)-(b4): (b1) binding to the novel coronavirus SARS-CoV-2; (b2) detecting binding to the novel coronavirus SARS-CoV-2; (b3) binding to the S protein of the novel coronavirus SARS-CoV-2; (b4) detecting the S protein of the novel coronavirus SARS-CoV-2

[0008] The present invention also provides a pharmaceutical composition, comprising the above-mentioned novel coronavirus RBD-specific monoclonal antibody and a pharmaceutically acceptable excipient, diluent or carrier.

[0009] Preferably, the above-mentioned novel coronavirus RBD-specific monoclonal antibody is obtained by sorting specific memory B cells and amplifying the antibody variable region cDNA using RT-PCR.

[0010] The principles and beneficial effects of the present invention are:

[0011] (1) The monoclonal antibody provided by the present invention has RBD specificity. Compared with the monoclonal antibody targeting the non-RBD region of S1, the monoclonal antibody provided by the present invention binds to RBD, providing a wider application value for antibody drug screening, diagnosis, prevention and treatment of new coronary pneumonia.

[0012] (2) The monoclonal antibody provided by the present invention is obtained by sorting RBD-specific memory B cells. Compared with the prior art by sorting plasma cells, the monoclonal antibody prepared by the present invention can induce a stronger humoral immune response. In addition, the present invention only conducts subsequent RT-PCR, nested PCR and antibody function analysis on RBD-specific memory B cells, which greatly improves the specific binding ability of monoclonal antibodies to RBD. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Figure 2 shows the cell sorting of memory B cells analyzed by flow cytometry.

[0014] Figure 2 Figure 2 shows the cell sorting of RBD-specific memory B cells analyzed by flow cytometry.

[0015] Figure 3 This is the gel electrophoresis diagram of the PCR product of single cell antibody gene;

[0016] Figure 4 It is the agarose gel electrophoresis image after PCR amplification of the antibody gene expression cassette containing CMV promoter, WPRE-γ or WPRE-κ element;

[0017] Figure 5 This is a graph showing the RBD-specific detection results. DETAILED DESCRIPTION

[0018] The following will be combined with the accompanying drawings of the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0019] Example 1

[0020] This embodiment provides a novel coronavirus RBD-specific monoclonal antibody, the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO: 21; the amino acid sequence of the light chain variable region is shown in SEQ ID NO: 22.

[0021] This embodiment also provides the use of the above-mentioned novel coronavirus RBD-specific monoclonal antibody in the preparation of reagents or drugs for detecting or diagnosing SARS-CoV-2.

[0022] In actual production, the RBD-specific monoclonal antibody obtained in this embodiment can be used to prepare a nucleic acid molecule, or to prepare an expression cassette, a recombinant vector, a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule, or to prepare a pharmaceutical composition, which includes the above-mentioned novel coronavirus RBD-specific monoclonal antibody and a pharmaceutically acceptable excipient, diluent or carrier.

[0023] When used, the related products prepared by the RBD-specific monoclonal antibody obtained in this embodiment can have any of the following uses (b1)-(b4): (b1) binding to the new coronavirus SARS-CoV-2; (b2) detecting the binding to the new coronavirus SARS-CoV-2; (b3) binding to the S protein of the new coronavirus SARS-CoV-2; (b4) detecting the S protein of the new coronavirus SARS-CoV-2.

[0024] Embodiment 2-10

[0025] The difference between Example 2-10 and Example 1 is that the amino acid sequences of the variable regions of the RBD-specific monoclonal antibodies are different. The amino acid sequences of the variable regions of Example 2-10 are shown in the following table:

[0026]

[0027]

[0028] The RBD-specific monoclonal antibodies provided in the above Examples 1-10 were all obtained by the following method: first, single RBD-specific memory B cells were sorted from the peripheral blood of recovered patients with COVID-19, and then the mRNA of RBD-specific memory B cells was obtained. Then, an antibody variable region gene expression cassette was constructed by RT-PCR and nested PCR, and then the antibody variable region gene expression cassette was transduced into 293T cells to express antibodies and the supernatant was collected. The RBD specificity of the supernatant was detected by ELISA to screen for RBD-specific monoclonal antibodies.

[0029] The specific steps include:

[0030] S1. Collect peripheral blood from several recovered COVID-19 patients, separate PBMCs, and freeze them in a -80℃ refrigerator for later use.

[0031] S2. First, use Dead Dye to remove dead cells from the PBMC obtained in S1, and then use CD19, mIg-G, mIg-D and S-RBD to stain and mark the live RBD-specific and highly binding memory B cells in the PBMC to screen out RBD-specific memory B cells; use a flow cytometer to sort the specific memory B cells into a 96-well plate, with one specific memory B cell in each well, and freeze them in a -80°C refrigerator for later use.

[0032] Specifically, the preferred Dead Dye staining concentration range of this embodiment is 1-2μg / mL, and the preferred Dead Dye staining concentration of this embodiment is 1.5μg / mL; CD19 is a B cell marker produced by Biolegend, and the concentration range of staining is 1-2μg / mL, and the preferred CD19 staining concentration in this embodiment is 1.5μg / mL. mIg-G is a B cell surface receptor produced by Biolegend, and the concentration range of staining is 1-2μg / mL, and the preferred mIg-G staining concentration in this embodiment is 1.5μg / mL; mIg-D is a B cell surface receptor produced by Biolegend, and the concentration range of staining is 1-2μg / mL, and the preferred mIg-D staining concentration in this embodiment is 1.5μg / mL; S-RBD is a protein receptor domain of the new coronavirus produced by sinobiological, and the concentration range of staining is 1-2μg / mL, and the preferred S-RBD staining concentration in this embodiment is 1.5μg / mL.

[0033] RBD-specific memory B cells were sorted by flow cytometry, and PBMCs were sorted by CD19, mIg-G, mIg-D, and S-RBD to obtain S-RBD-specific memory B cells. Figure 1 and Figure 2As shown, Figure 2 Batch ID 0428, 0505, 0522, 0528 in the example are screening batches. The principle of using CD19, mIg-G, mIg-D and S-RBD to screen out RBD-specific memory B cells is as follows: PBMCs are stained with dead cell dye (Dead Dye), B cell marker CD19, memory B cell marker mIg-G positive and mIg-D negative, and RBD-specific IgG-expressing memory B cells, and then the CD19 cell population is separated from the cell population using a flow cytometer, and then the mIg-G positive cell population is separated from the CD19 positive cell population. + mIg-D - Cell population, then from mIg-G + mIg-D - The cell population is divided into RBD-positive memory B cells, and then the RBD-positive memory B cells are sorted by flow cytometry.

[0034] S3. Sorting and obtaining the mRNA of a single RBD-specific memory B cell, and using RT-PCR amplification to obtain the antibody variable region cDNA. Specifically, when using RT-PCR to amplify the antibody variable region cDNA, the primers designed in this embodiment are designed with a universal leader at the front end (see Primer Sequence Table 1 and Primer Sequence Table 2), which effectively improves the amplification rate of the antibody gene. The experimental results are as follows: Figure 3 shown.

[0035] S4. Amplify the antibody variable region cDNA obtained from S1-S3 using nested PCR to construct an antibody variable region gene expression cassette.

[0036] S3 and S4 are carried out in total through the following six parts: (1) extraction of RBD-specific memory B cell mRNA; (2) reverse transcription (RT) of single cell mRNA; (3) addition of G tail (TDT); (4) first round of PCR (1st PCR); (5) second round of PCR (2nd PCR); (6) BCR-ORF PCR amplification to construct a gene expression cassette; (7) CMV, WPRE-γ / κ / l fragment amplification and pre-ligation of CMV, BCR-Vγ / κ / l (product of (6)), WPRE-γ / κ / l overlap PCR (Overlap PCR); (8) BCR-γORF, BCR-κORF, and BCR-l PCR amplification.

[0037] The preparation of each reaction solution and the reaction conditions are as follows:

[0038] (1) Using Dynabeads TM mRNA DIRECT TMPurification Kit (Thermo Fisher Scientific) was used to extract single-cell mRNA, which specifically included the following steps:

[0039] ① Centrifugation: After taking out the 96-well plate with single RBD-specific memory B cells from the -80°C refrigerator, centrifuge at 600×g for 30 seconds to centrifuge the cells to the bottom of the well;

[0040] ② Washing: Take out the Dynabeads oligo(dT)25 microsphere bottle and vortex to mix, aspirate enough microspheres at 2μl / well, place on the magnet block, let stand for 30s, discard the supernatant, and resuspend with 500μl Lysis Buffer;

[0041] ③ Preparation: Add 9 μl / well Lysis Buffer into a 50 mL centrifuge tube, add the above 500 μl microsphere suspension, and blow evenly with a gun;

[0042] ④ Packaging: Use eight tubes to pack the microspheres, and then use a spray gun to add them into the cell plate at 9μl / well;

[0043] ⑤ Rinse: Apply the film to the 96-well plate, then rinse the tube wall for 2 cycles;

[0044] ⑥ Incubation: Let stand at room temperature for 5 minutes to allow the mRNA of RBD-specific memory B cells to be fully released and bound to the microspheres. After the incubation, centrifuge at 600×g to centrifuge the microspheres to the bottom of the wells. Place the 96-well plate on the DynaMag TM - On the 96sideMagnet magnetic plate, discard the supernatant with a pipette;

[0045] ⑦Wash A: Add 8 μl / well of Washing Buffer A, move the plate back and forth 7-8 times to fully wash the microspheres, and discard the supernatant;

[0046] ⑧ Wash B: Add 8 μl / well of Washing Buffer B, and wash the microspheres back and forth 7-8 times. Discard the supernatant, and then add 10 μl / well of the pre-prepared reverse transcription (RT) reaction solution. The reagent preparation and reaction conditions are described in (2) below.

[0047] (2) Reverse transcription (RT) (10 μl system)

[0048] The reagents required for preparation are shown in Table 1 below:

[0049]

[0050]

[0051] Reaction conditions: 42°C for 60 min (mixing every 20 min);

[0052] After the reaction, the 96-well plate was centrifuged at 600 × g and then placed on the DynaMag TM -96 sideMagnet magnetic plate, discard the supernatant with a pipette, and then add the pre-prepared TDT reaction solution at 10 μl / well. The reagent preparation and reaction conditions are as described below (3).

[0053] (3) Add G-tail (TDT) (10 μl system)

[0054] The reagents required for preparation are shown in Table 2 below:

[0055] Reagent Name Volume <![CDATA[H 2 The]]> 6.4 μl 5×TdT buffer 2.0 μl 10 mM dGTP 0.5 μl 0.1% BSA 1.0 μl Sample beads TdT 0.1 μl Total Volume 10 μl

[0056] Reaction conditions: 37°C for 40 min (mixing every 20 min).

[0057] After the reaction, the 96-well plate was centrifuged at 600 × g and then placed on the DynaMag TM -96 side Magnet plate, discard the supernatant with a pipette, and then add the pre-prepared first round PCR (1st PCR) reaction solution at 10 μl / well. The reagent preparation and reaction conditions are as described below (4).

[0058] (4) 1st PCR (10 μl system) (For primer sequences, see the primer sequence table)

[0059] The reagents required for preparation are shown in Table 3 below:

[0060]

[0061]

[0062] Based on the PCR principle, the experimental reaction conditions of the 1st PCR are: ① pre-denaturation at 95°C for 3 min; ② denaturation at 95°C for 15 sec, annealing at 60°C for 5 sec, extension at 72°C for 1 min, 30-35 cycles, 30 cycles are preferred in this embodiment; ③ cyclic extension at 72°C for 5 min, and storage at 4°C.

[0063] (5) Second round of PCR (2nd PCR) (10 μl system) (For primer sequences, see Primer Sequence Table 1 and Primer Sequence Table 2)

[0064] The reagents required for preparation are shown in Table 4 below:

[0065] Reagent Name Volume <![CDATA[H 2 The]]> 1.5 μl 2×GC Buffer 5 μl 2.5 mM dNTP 1 μl FP: MAC-AP3 / AP3 (10 μM) 0.5 μl RP: Cg-nest / K20 / CI-nest (10 μM) 0.5 μl PrimesTAR 0.5 μl sample 1 μl Total Volume 10 μl

[0066] Based on the PCR principle, the experimental reaction conditions of 2nd PCR are: ① pre-denaturation at 95°C for 3 min; ② denaturation at 95°C for 15 sec, annealing at 60°C for 5 s, extension at 72°C for 1 min, 30-35 cycles, 35 cycles are preferred in this embodiment; 72°C external extension for 5 min, and storage at 4°C.

[0067] After PCR, 4 μl of each well was taken for 1.5% agarose gel electrophoresis. The wells with the Gamma chain paired with the Kappa chain or Lamada chain were sent for sequencing.

[0068] (6) Amplification and construction of antibody expression cassette (BCR-ORF)

[0069] PCR amplification of the promoter region (CMV promoter), WPRE-γ (antibody gamma chain) and WPRE-κ (antibody kappa chain), the PCR amplification system is shown in Table 5 below:

[0070]

[0071] PCR amplification conditions were as follows: ① pre-denaturation at 95°C for 3 min; ② denaturation at 95°C for 15 sec, annealing at 56°C for 15 sec, extension at 72°C for 1 min, 30 cycles; ③ cyclic extension at 72°C for 5 min, storage at 12°C.

[0072] (7) Amplification of CMV and WPRE-γ / κ / l fragments and pre-ligation of CMV, BCR-Vγ / κ / l, and WPRE-γ / κ / l by Overlap PCR

[0073] The experimental system is shown in Table 6 below:

[0074]

[0075] PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 50°C for 15 sec, extension at 72°C for 1.5 min, 10 cycles; extra-cyclic extension at 72°C for 5 min, and storage at 12°C.

[0076] (8) PCR amplification of BCR-γORF, BCR-κORF, and BCR-1

[0077] The experimental system is shown in Table 7 below:

[0078]

[0079]

[0080] PCR amplification program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 1.5 min, 30 cycles; extra-cyclic extension at 72°C for 5 min, storage at 12°C.

[0081] After amplification, agarose gel electrophoresis and gel imaging were used to analyze whether the obtained antibody variable region gene size was correct. The experimental results were as follows: Figure 4 As shown, the marker is in the middle and the band is at 5000 bp.

[0082] BCR-γORF and BCR-κ / ORF ethanol precipitation: Take 30μl of the PCR products of BCR-γORF and BCR-κORF respectively and place them in 8-tube series, then add 120μl of anhydrous ethanol and 6μl of sodium acetate solution, mix thoroughly, and let stand at -80℃ for 30min; centrifuge at 10000rpm for 20min, discard the supernatant, rinse once with 200μl of 70% ethanol and anhydrous ethanol respectively, evaporate the ethanol completely at 56℃, add 40μl of sterile water, oscillate to fully dissolve the precipitate, and detect the concentration of the antibody variable region gene.

[0083] The leader primers used in S3 and S4 are shown in the following primer sequence table 1:

[0084]

[0085]

[0086]

[0087] The J-region primers used in S3 and S4 are shown in the following Primer Sequence Table 2:

[0088] primer ID sequence IGHJ_01 GATGGGCCCTTGGTGGAGGGTGAGGAGACGGTGACCAGGGTGCCCTGGCCCCAGT IGHJ_02 GATGGGCCCTTGGTGGAGGGTGAGGAGACAGTGACCAGGGTGCCACGGCCCCAGA IGHJ_03 GATGGGCCCTTGGTGGAGGGTGAAGAGACGGTGACCATTGTCCCTTGGCCCCAGA IGHJ_04 GATGGGCCCTTGGTGGAGGGTGAGGAGACGGTGACCGTGGTCCCTTGCCCCCAGA IGKJ_01 GATGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCC IGKJ_02 GATGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCC IGKJ_03 GATGGTGCAGCCACAGTTCGTTTGATATCCACTTTGGTCCCAGGGCCGAAAGTGA IGKJ_04 GATGGTGCAGCCACAGTTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGTGA IGKJ_05 GATGGTGCAGCCACAGTTCGTTTAATCTCCAGTCGTGTCCCTTGGCCGAAGGTGA IGLJ_01 GGGGCAGCCTTGGGCTGACCTAGGACGGTGACCTTGGTCCCAGTTCCGAAGACAT IGLJ_02 GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCA IGLJ_03 GGGGCAGCCTTGGGCTGACCTAAAATGATCAGCTGGGTTCCTCCACCAAATACAA IGLJ_04 GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTCGGTCCCCTCACCAAACACCC IGLJ_05 GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTCCGTCCCCTCACCAAACACCC IGLJ_06 GGGGCAGCCTTGGGCTGACCGAGGACGGTCACCTTGGTGCCACTGCCGAACACAT IGLJ_07 GGGGCAGCCTTGGGCTGACCGAGGACGGTCAGCTGGGTGCCTCCTCCGAACACAG IGLJ_08 GGGGCAGCCTTGGGCTGACCGAGGGCGGTCAGCTGGGTGCCTCCTCCGAACACAG

[0089] S5. The antibody variable region gene expression cassette obtained in S4 was transduced into 293T cells to express the antibody within 48 hours and the supernatant was collected. The RBD specificity of the supernatant was detected by ELISA to screen for RBD-specific fully human monoclonal antibodies.

[0090] (A) Dilute the antigen with PBS (final concentration 2 μg / mL), 10 μl / well, and coat the 384-well ELISA plate at 4°C overnight or 37°C for 2 hours (preferably at 4°C overnight in this example). NOTE: Centrifuge immediately after addition to ensure that the liquid is at the bottom.

[0091] The experimental system is shown in Table 8 below:

[0092]

[0093] (B) Preparation of PBST (0.05% Tween 20, Cat#TB220): add 0.5 mL of Tween 20 to 1 L of PBS;

[0094] Wash the plate with PBST machine (Thermoscientific wellwash versa) or by hand (the plate after machine washing still needs to be manually tapped / centrifuged for 1 minute using a microplate centrifuge (MPC-P25) to make sure no water or bubbles are visible on the plate).

[0095] Blocking: Add 80 μl of 5% BSA (BioFroxx, Cat. NO: 4240GR100) (prepared in PBST) to the washed plate and place in an incubator at 37°C for 1 hour. Wash the plate with a PBST machine or by hand.

[0096] (C) Sample addition and standard. Standard: 10 μl / well original concentration 1 μg / mL, gradient dilution 250 ng / mL, 125 ng / mL, 62.5 ng / mL, 31.25 ng / mL, 15.63 ng / mL, 7.81 ng / mL, 3.9 ng / mL and 1.95 ng / mL. (Blocking solution dilution); Sample: cell supernatant transfected with antibody gene. Negative control / blank well: blocking solution 10 μl / well.

[0097] Incubate at 37°C for 30 min. Wash the plate in PBST machine or by hand.

[0098] (D) Secondary antibody was added at a concentration of 10 μl / well and then incubated at 37°C for 30 min.

[0099] The experimental system is shown in Table 9 below:

[0100] Name of secondary antibody Catalog number Original concentration Final concentration Dilution ratio goat-anti-human IgG-ALP A18808 1.5mg / ml 0.3μg / ml 1:5000 Goat pab to Hu IgG-ALP Ab98532 0.5mg / ml 0.25μg / ml 1:2000

[0101] Wash the plate with PBST machine or by hand. 10μl / well PNPP (disodium p-nitrophenyl phosphate) was used to detect the OD (450mm) values ​​at 5min, 10min, 15min, 20min, 25min, 30min, 35min, 40min, 45min, 50min, 55min and 60min using (Thermoscientific Muttiskan GO). 50mg PNPP powder (Thermo, Prod#34045) + 40mL ddH 2 O+10mL of Diethanolaminesubstrate Buffer (5X), PNPP was stored at 4℃ in the dark.

[0102] The experimental results are as followsFigure 5 As shown, an OD value greater than 0.1 was considered positive.

[0103] The above description is only a preferred embodiment of the present invention, which is only illustrative and not restrictive of the present invention. A person skilled in the art will understand that many changes, modifications and even equivalent changes may be made to the present invention within the spirit and scope defined by the claims of the present invention, but all of them will fall within the scope of protection of the present invention. <110> Chongqing Medical University, Feng Yulin <120> SARS-CoV-2 RBD-specific monoclonal antibodies and their applications <160> 40 <210> 1 <211> 122 <212> PRT <213> Artificial Sequence <400> 1 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly 1 5 10 15 Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Asp Thr Phe Ser 20 25 30 Ser Tyr Ala Ile Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 40 45 Glu Trp Met Gly Arg Ile Ile Pro Ile Leu Gly Ile Ala Asn Tyr 50 55 60 Ala Gln Lys Phe Gln Gly Arg Val Thr Ile Thr Ala Asp Lys Ser 65 70 75 Thr Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp 80 85 90 Thr Ala Val Tyr Tyr Cys Ala Thr Gly Arg Tyr Thr Tyr Gly Tyr 95 100 105 Gly Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 110 115 120 Ser Ser <210>2 <211>107 <212>PRT <213>Artificial Sequence <400>2 Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro 1 5 10 15 Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser 20 25 30 Ser Ser Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro 35 40 45 Arg Leu Leu Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 Ile Ser Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln 80 85 90 Gln Tyr Gly Ser Ser Arg Thr Phe Gly Gln Gly Thr Lys Leu Glu 95 100 105 Ile Lys <210>3 <211>124 <212>PRT <213> Artificial Sequence <400> 3 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser 1 5 10 15 Gln Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser 20 25 30 Ser Gly Asp Tyr Tyr Trp Ser Trp Ile Arg Gln His Pro Gly Lys 35 40 45 Gly Leu Glu Trp Ile Gly Tyr Ile Phe Tyr Ser Gly Ser Thr Tyr 50 55 60 Tyr Asn Pro Ser Leu Lys Ser Arg Val Ile Ile Ser Val Asp Thr 65 70 75 Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala 80 85 90 Asp Thr Ala Val Tyr Tyr Cys Ala Arg Val Ser Arg Tyr Thr Met 95 100 105 Val Arg Gly Val Ile Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val 110 115 120 Thr Val Ser Ser <210> 4 <211> 111 <212> PRT <213> Artificial Sequence <400> 4 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly 1 5 10 15 Gln Ser Ile Thr Leu Ser Cys Thr Gly Thr Ser Ser Asp Val Gly 20 25 30 Ser Tyr Asp Leu Val Ser Trp Tyr Gln His His Pro Gly Lys Ala 35 40 45 Pro Lys Leu Met Ile Tyr Glu Val Thr Lys Arg Pro Ser Gly Val 50 55 60 Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu 65 70 75 Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys 80 85 90 Cys Leu Tyr Ala Gly His Ser Thr Tyr Val Val Phe Gly Gly Gly 95 100 105 Thr Lys Leu Thr Val Leu 110 <210>5 <211>120 <212>PRT <213>Artificial Sequence <400>5 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser 1 5 10 15 Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Tyr Ser Ile Ser 20 25 30 Ser Gly Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly 35 40 45 Leu Glu Trp Ile Gly Ser Ile Tyr Gln Ser Gly Ser Thr Tyr Tyr 50 55 60 Asn Leu Ser Leu Lys Ser Arg Val Thr Ile Leu Val Asp Thr Ser 65 70 75 Lys Asn Gln Leu Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp 80 85 90 Thr Ala Val Tyr Tyr Cys Ala Arg Val Gly Val Ala Thr Ile Leu 95 100 105 Gly Val Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 110 115 120 <210>6 <211>109 <212>PRT <213>Artificial Sequence <400>6 Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly 1 5 10 15 Lys Thr Val Ile Ile Ser Cys Thr Arg Ser Ser Gly Ser Ile Ala 20 25 30 Ser Asn Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ala Pro 35 40 45 Thr Thr Val Ile Tyr Glu Asp Ser Leu Arg Pro Ser Gly Val Pro 50 55 60 His Arg Phe Ser Gly Ser Ile Asp Ser Ser Ser Asn Ser Ala Ser 65 70 75 Leu Thr Ile Ser Gly Leu Met Thr Glu Asp Glu Ala Asp Tyr Tyr 80 85 90 Cys Gln Ser Tyr Asp Ser Ser Trp Val Phe Gly Gly Gly Thr Lys 95 100 105 Leu Thr Val Leu <210>7 <211>126 <212>PRT <213>Artificial Sequence <400>7 Gln Val Arg Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly 1 5 10 15 Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser 20 25 30 Ser Phe Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45 Glu Trp Val Ala Leu Leu Ser Tyr Asp Gly Thr Asn Lys Tyr Tyr 50 55 60 Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser 65 70 75 Lys Ser Thr Leu Phe Leu Gln Met His Ser Leu Arg Ala Glu 80 85 Asp Thr Ala Val Tyr Phe Cys Ala Lys Gly Gly Gly Tyr Ile Ser 90 95 100 Ala Trp Ser Thr Arg Tyr Tyr Ala Met Asp Val Trp Gly Gln Gly 105 110 115 Thr Thr Val Thr Val Ser Ser 120 125 <210>8 <211>110 <212>PRT <213>Artificial Sequence <400>8 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly 1 5 10 15 Gln Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly 20 25 30 Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Asn Ala 35 40 45 Pro Lys Leu Met Ile Tyr Asp Val Asn Asn Arg Pro Ser Gly Val 50 55 60 Ser Asp Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu 65 70 75 Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys 80 85 90 Ser Ser Tyr Thr Ser Ser Ser Thr Trp Val Phe Gly Gly Gly Thr 95 100 105 Lys Leu Thr Val Leu 110 <210>9 <211>119 <212>PRT <213>Artificial Sequence <400>9 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly 1 5 10 15 Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser 20 25 30 Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45 Glu Trp Val Ser Gly Ile Ser Asp Ser Gly Gly Ser Pro Tyr Tyr 50 55 60 Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser 65 70 75 Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Val Glu 80 85 Asp Thr Ala Val Tyr Tyr Cys Ala Glu Ser Ser Ser Leu Thr Gly 90 95 100 Asn Phe Asn Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 105 110 115 <210>10 <211>105 <212>PRT <213>Artificial Sequence <400>10 Ser Tyr Val Leu Thr Gln Pro Pro Ser Val Ser Val Ala Pro Gly 1 5 10 15 Lys Thr Ala Arg Ile Thr Cys Gly Gly Asn Asn Ile Gly Ser Lys 20 25 30 Ser Val His Trp Tyr Gln Gln Arg Pro Gly Gln Ala Pro Val Leu 35 40 45 Val Val Tyr Asp Asp Ser Asp Arg Pro Ser Gly Ile Pro Glu Arg 50 55 60 Phe Ser Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser 65 70 75 Arg Val Glu Ala Gly Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp 80 85 90 Asp Thr Ala Trp Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 95 100 105 <210>11 <211>129 <212>PRT <213>Artificial Sequence <400>11 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser 1 5 10 15 Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Val Ser 20 25 30 Ser Gly Ser Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys 35 40 45 Gly Leu Glu Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn 50 55 60 Tyr Asn Pro Ser Leu Thr Ser Arg Val Thr Leu Ser Val Asp Thr 65 70 75 Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala 80 85 90 Asp Thr Ala Val Tyr Tyr Cys Ala Arg Glu Tyr Phe Val Ser Leu 95 100 105 Pro Ala Ala Gln Thr Leu Tyr Tyr Tyr Gly Ile Asp Val Trp Gly 110 115 120 Gln Trp Thr Thr Val Thr Val Ser Ser 125 <210> 12 <211> 108 <212> PRT <213> Artificial Sequence <400> 12 Glu Ile Val Met Thr Gln Ser Pro Val Thr Leu Ser Val Ser Pro 1 5 10 15 Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser 20 25 30 Ser Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Gly Pro Arg 35 40 45 Leu Leu Ile Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Ala 50 55 60 Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile 65 70 75 Ser Ser Leu Gln Ser Glu Asp Phe Ala Val Tyr Phe Cys Gln Gln 80 85 90 Tyr Lys Asn Trp Pro Pro Trp Thr Phe Gly Gln Gly Thr Lys Val 95 100 105 Glu Ile Lys <210>13 <211>126 <212>PRT <213>Artificial Sequence <400>13 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly 1 5 10 15 Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr 20 25 30 Ser Tyr Asp Ile Asn Trp Val Arg Gln Ala Thr Gly Gln Gly Leu 35 40 45 Glu Trp Met Gly Trp Met Asn Pro Lys Ser Val Tyr Thr Gly Tyr 50 55 60 Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Arg Asn Thr 65 70 Ser Ile Arg Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu 75 80 85 Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly Leu Trp Phe Gly 90 95 100 Asp Leu Thr Arg Thr Lys Tyr Asn Trp Phe Asp Pro Trp Gly 105 110 115 Gln Gly Thr Leu Val Thr Val Ser Ser 120 125 <210>14 <211>108 <212>PRT <213>Artificial Sequence <400>14 Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro 1 5 10 15 Gly Glu Arg Ala Ala Leu Ser Cys Arg Ala Ser Gln Gly Val Thr 20 25 30 Ser Thr Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro 35 40 45 Arg Leu Leu Ile Tyr Gly Val Ser Thr Arg Ala Thr Gly Ile Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 Ile Ser Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys His 80 85 90 Gln Tyr Asp Ser Ser Pro Leu Thr Phe Gly Gly Gly Thr Lys Val 95 100 105 Glu Ile Lys <210>15 <211>135 <212>PRT <213>Artificial Sequence <400>15 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly 1 5 10 15 Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly His Thr Phe Thr 20 25 30 Ser Tyr Leu Ile His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 40 45 Glu Trp Met Gly Ile Ile Asn Pro Ser Gly Gly Ser Thr Ser Tyr 50 55 60 Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Arg Asp Thr 65 70 Ser Thr Ser Thr Val Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu 75 80 85 Asp Thr Ala Val Tyr Tyr Cys Ala Arg Asp Pro Pro Ser Gly Asn 90 95 100 Tyr Asp Asn Ile Asp Glu Trp Thr Arg Ser Glu Asn His Tyr Asn 105 110 115 Tyr Gly Met Asp Ala Trp Gly Gln Gly Thr Thr Val Thr Val Leu 120 125 130 Thr 135 <210>16 <211>108 <212>PRT <213>Artificial Sequence <400>16 Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro 1 5 10 15 Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Arg 20 25 30 Ser Phe Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg 35 40 45 Leu Leu Ile Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala 50 55 60 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile 65 70 75 Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln 80 85 90 Arg Ser Asn Trp Pro Tyr Leu Thr Phe Gly Gly Gly Thr Lys Val 95 100 105 Glu Ile Lys <210>17 <211>123 <212>PRT <213>Artificial Sequence <400>17 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly 1 5 10 15 Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser 20 25 30 Asp Tyr Tyr Met Ser Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45 Glu Trp Val Ser Tyr Ile Ser Ser Ser Ser Ser Tyr Thr Asn Tyr 50 55 60 Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala 65 70 75 Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu 80 85 Asp Thr Ala Val Tyr Phe Cys Ala Arg Asp Gly Ser Ala Val Ala 90 95 100 Gly Pro Met Ser Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Pro Val 105 110 115 Thr Val Ser Ser 120 <210>18 <211>107 <212>PRT <213>Artificial Sequence <400>18 Asp Ile Gln Met Thr Gln Pro Pro Ser Ser Leu Ser Ala Ser Val 1 5 10 15 Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser 20 25 30 Asn Ser Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys 35 40 45 Leu Leu Leu Tyr Ala Ala Ser Arg Leu Glu Ser Gly Val Pro Ser 50 55 60 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile 65 70 75 Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 80 85 90 Tyr Tyr Ser Ile Pro Arg Thr Phe Gly Gln Gly Thr Lys Val Glu 95 100 105 Ile Lys <210>19 <211>120 <212>PRT <213>Artificial Sequence <400>19 Gln Val Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr 1 5 10 15 Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser 20 25 30 Thr Ser Gly Met Cys Val Ser Trp Ile Arg Gln Pro Pro Gly Lys 35 40 45 Ala Leu Glu Trp Leu Ala Arg Ile Asp Trp Asp Asp Ala Lys Tyr 50 55 60 Tyr Ser Thr Ser Leu Glu Thr Arg Leu Thr Ile Ser Lys Asp Thr 65 70 75 Ser Asn Asn Gln Val Val Leu Thr Leu Thr Asn Met Asp Pro 80 85 Val Asp Thr Ala Thr Tyr Tyr Cys Ala Arg Glu Val Ala Gly Ala 90 95 100 Val His Leu Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser 105 110 115 Ser 120 <210>20 <211>107 <212>PRT <213>Artificial Sequence <400>20 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Pro Ala Ser Val 1 5 10 15 Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Arg 20 25 30 Arg Tyr Ile Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys 35 40 45 Leu Leu Ile Tyr Val Ala Ser Ser Leu Gln Ser Gly Val Pro Ser 50 55 60 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile 65 70 75 Ser Ser Leu Gln Pro Glu Asp Ser Ala Ile Tyr Tyr Cys Gln Gln 80 85 90 Ser Phe Ser Thr Pro Arg Thr Phe Gly Gln Gly Thr Lys Val Glu 95 100 105 Ile Lys <210>21 <211>121 <212>PRT <213>Artificial Sequence <400>21 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly 1 5 10 15 Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser 20 25 30 Ser Tyr Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45 Glu Trp Val Ala Asn Ile Lys Gln Asp Gly Ser Glu Lys Tyr Tyr 50 55 60 Val Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala 65 70 75 Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu 80 85 Asp Thr Ala Val Tyr Tyr Cys Ala Arg Asp Leu Gly Val Leu 90 95 100 Trp Phe Gly Asp Leu Leu Phe Ser Ser Gln Gly Thr Leu Val 105 110 115 Thr Val Ser Ser 120 <210> 22 <211> 108 <212> PRT <213> Artificial Sequence <400> 22 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val 1 5 10 15 Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser 20 25 30 Asn Ser Leu Ala Trp Tyr Gln Gln Lys Pro Gly Thr Ala Pro Lys 35 40 45 Leu Leu Leu Tyr Ala Ala Ser Thr Leu Glu Ser Gly Val Pro Ser 50 55 60 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile 65 70 75 Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 80 85 90 Tyr Tyr Ser Asp Pro Pro Arg Thr Phe Gly Gln Gly Thr Lys Val 95 100 105 Glu Ile Lys <210>23 <211>121 <212>PRT <213>Artificial Sequence <400>23 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser 1 5 10 15 Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Phe Ser 20 25 30 Thr Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu 35 40 45 Glu Trp Ile Gly His Ile Ser Tyr Ser Gly Ser Thr His Tyr Asn 50 55 60 Pro Ser Leu Lys Gly Arg Val Thr Ile Ser Leu Asp Thr Ser Lys 65 70 75 Asn Gln Phe Ser Leu Asn Leu Ser Ser Val Thr Ala Ala Asp Thr 80 85 90 Ala Val Tyr Tyr Cys Ala Arg Gly Gly Tyr Tyr Tyr Gly Pro Pro 95 100 105 Arg Asp Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser 110 115 120 Ser <210>24 <211>109 <212>PRT <213>Artificial Sequence <400>24 Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro 1 5 10 15 Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Gly Val Ser 20 25 30 Ser Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro 35 40 45 Arg Leu Leu Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 Ile Ser Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln 80 85 90 His Tyr Gly Ser Ser Pro Gln Tyr Thr Phe Gly Gln Gly Thr Lys 95 100 105 Leu Glu Ile Arg <210>25 <211>133 <212>PRT <213>Artificial Sequence <400>25 Gln Ile Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys Pro Thr 1 5 10 15 Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser 20 25 30 Thr Ser Gly Val Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys 35 40 45 Pro Leu Glu Trp Leu Ala Leu Ile Tyr Trp Asp Asp Asp Lys Arg 50 55 60 Tyr Ser Pro Ser Leu Lys Ser Arg Leu Thr Ile Thr Lys Asp Thr 65 70 75 Ser Lys Asn Gln Val Val Leu Arg Met Thr Asn Met Asp Pro 80 85 Val Asp Thr Ala Thr Tyr Tyr Cys Ala His Ser Pro Asp His Arg 90 95 100 Tyr Phe Asp Val Leu Thr Gly Tyr Phe Asn Ser Glu Arg Phe Tyr 105 110 115 Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 120 125 130 <210>26 <211>110 <212>PRT <213>Artificial Sequence <400>26 Arg Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly 1 5 10 15 Gln Lys Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly 20 25 30 Asn Asn Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro 35 40 45 Lys Val Leu Ile Tyr Asp Asn Asn Lys Arg Pro Ser Gly Ile Pro 50 55 60 Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly 65 70 75 Ile Thr Gly Leu Gln Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Gly 80 85 90 Thr Trp Asp Ser Ser Leu Ser Ala Gly Val Phe Gly Gly Gly Thr 95 100 105 Lys Leu Thr Val Leu 110 <210>27 <211>126 <212>PRT <213>Artificial Sequence <400>27 Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser 1 5 10 15 Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser 20 25 30 Ser Ser Asn Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Arg 35 40 45 Gly Leu Glu Trp Ile Gly Ser Ile Tyr Tyr Ser Gly Ser Thr Tyr 50 55 60 Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr 65 70 75 Ser Lys Asn Gln Phe Ser Leu Asn Leu Ser Ser Val Thr Ala Ala 80 85 90 Asp Thr Ala Val Tyr Tyr Cys Ala Arg Ile Pro Arg His Leu Gly 95 100 105 Gln Asp His Tyr Tyr Tyr Val Met Asp Val Trp Gly Gln Gly Thr 110 115 120 Thr Val Thr Val Ser Ser 125 <210>28 <211>108 <212>PRT <213>Artificial Sequence <400>28 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly 1 5 10 15 Gln Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly 20 25 30 Ser Tyr Asn Leu Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala 35 40 45 Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg Pro Ser Gly Val 50 55 60 Ser Asp Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu 65 70 75 Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys 80 85 90 Cys Ser Tyr Ala Gly Ile Phe Val Phe Gly Thr Gly Thr Lys Val 95 100 105 Thr Val Leu <210>29 <211>124 <212>PRT <213>Artificial Sequence <400>29 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly 1 5 10 15 Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser 20 25 30 Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45 Glu Trp Val Ala Leu Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr 50 55 60 Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser 65 70 75 Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu 80 85 Asp Thr Ala Val Tyr Tyr Cys Ala Lys Ala Ala Gly Gly Gly Tyr 90 95 100 Ser Tyr Ile Tyr Trp Gly Gly Asp Tyr Trp Gly Gln Gly Thr Leu 105 110 115 Val Thr Ser Pro His 120 <210>30 <211>111 <212>PRT <213>Artificial Sequence <400>30 Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly 1 5 10 15 Lys Thr Val Thr Ile Ser Cys Thr Arg Ser Ser Gly Ser Ile Ala 20 25 30 Ser Asn Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ala Pro 35 40 45 Thr Thr Val Ile Tyr Glu Asp Asn Gln Arg Pro Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Ile Asp Ser Ser Ser Asn Ser Ala Ser 65 70 75 Leu Thr Ile Ser Gly Leu Lys Thr Glu Asp Glu Ala Asp Tyr Tyr 80 85 90 Cys Gln Ser Tyr Asp Ser Ser Asn Leu Trp Val Phe Gly Gly Gly 95 100 105 Thr Lys Leu Thr Val Leu 110 <210>31 <211>120 <212>PRT <213>Artificial Sequence <400>31 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly 1 5 10 15 Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser 20 25 30 Ser Tyr Asp Met His Trp Val Arg Gln Ala Thr Gly Lys Gly Leu 35 40 45 Glu Trp Val Ser Ala Val Gly Thr Ala Gly Asp Thr Tyr Tyr Pro 50 55 60 Gly Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Glu Asn Ala Lys 65 70 75 Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Gly Asp 80 85 Thr Ala Val Tyr Tyr Cys Ala Arg Gly Phe Asp Thr Thr Thr Gly 90 95 100 Phe Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser 105 110 115 Ser 120 <210>32 <211>107 <212>PRT <213>Artificial Sequence <400>32 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val 1 5 10 15 Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Thr 20 25 30 Asn Ser Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys 35 40 45 Leu Leu Leu Tyr Ala Ala Ser Arg Leu Gln Ser Gly Val Pro Ser 50 55 60 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile 65 70 75 Ser Ser Leu Gln Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln 80 85 90 Asp Tyr Asn Phe Pro Trp Thr Phe Gly Gln Gly Thr Lys Val Glu 95 100 105 Ile Lys <210>33 <211>126 <212>PRT <213>Artificial Sequence <400>33 Gln Val His Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly 1 5 10 15 Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser 20 25 30 Ser Tyr Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 40 45 Glu Trp Met Gly Arg Ile Ile Pro Ile Phe Asp Ile Ala Asn Tyr 50 55 60 Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Ala Asp Lys Ser 65 70 75 Thr Thr Thr Ala Tyr Met Glu Leu Thr Ser Leu Arg Ser Glu Asp 80 85 90 Thr Ala Met Tyr Tyr Cys Ala Arg Thr Glu Tyr Ser Tyr Asp Ser 95 100 105 Gly Ser Ser Arg Ala Tyr Ser Met Asp Val Trp Gly Lys Gly Thr 110 115 120 Thr Val Thr Val Ser Ser 125 <210>34 <211>107 <212>PRT <213>Artificial Sequence <400>34 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val 1 5 10 15 Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Thr Ile Ser 20 25 30 Asn Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Glu 35 40 45 Leu Leu Ile Tyr Ala Ala Ser Asn Leu Gln Ser Gly Val Pro Ser 50 55 60 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile 65 70 75 Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 80 85 90 Thr His Ser Thr Pro Arg Thr Phe Gly Gln Gly Thr Lys Val Glu 95 100 105 Ile Lys <210>35 <211>122 <212>PRT <213>Artificial Sequence <400>35 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly 1 5 10 15 Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser 20 25 30 Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45 Glu Trp Val Ala Val Ile Trp Tyr Asp Gly Ser Asn Lys Tyr Tyr 50 55 60 Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser 65 70 75 Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu 80 85 Asp Thr Ala Val Tyr Tyr Cys Ala Lys Gly Gly Trp Tyr Ser Ser 90 95 100 Lys Trp Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr 105 110 115 Val Ser Ser 120 <210> 36 <211> 111 <212> PRT <213> Artificial Sequence <400> 36 Asp Ile Val Met Thr Gln Ser Pro Val Ser Leu Pro Val Thr Pro 1 5 10 15 Gly Glu Pro Ala Ser Met Ser Cys Arg Ser Ser Gln Ser Leu Leu 20 25 30 His Ser Asn Gly Tyr Ile Tyr Leu Asp Trp Tyr Val Gln Lys Pro 35 40 45 Gly Gln Ser Pro Gln Leu Leu Phe Tyr Leu Gly Ser Asn Arg 50 55 Ala Pro Gly Val Pro Val Arg Phe Ser Ala Ser Gly Ser Gly Thr 60 65 70 Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Val Gly 75 80 85 Val Tyr Tyr Cys Met Gln Ala Leu Gln Met Gly Thr Phe Gly 90 95 100 Gln Gly Thr Lys Val Glu Ile Lys 105 110 <210>37 <211>118 <212>PRT <213>Artificial Sequence <400>37 Gln Val Gln Leu Val Gln Ser Gly Ser Glu Leu Lys Lys Pro Gly 1 5 10 15 Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr 20 25 30 Ser Tyr Ala Met Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 40 45 Glu Trp Met Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr 50 55 60 Ala Gln Gly Phe Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser 65 70 75 Ile Ser Thr Ala Tyr Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp 80 85 90 Thr Ala Val Tyr Tyr Cys Ala Arg Val Gly Pro Ser Ser Ser Trp 95 100 105 Pro Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 110 115 <210>38 <211>107 <212>PRT <213>Artificial Sequence <400>38 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val 1 5 10 15 Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser 20 25 30 Thr Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys 35 40 45 Leu Leu Ile Tyr Val Ala Ser Ser Leu Gln Ser Gly Val Pro Ser 50 55 60 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile 65 70 75 Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 80 85 90 Ser Tyr Ser Thr Pro Arg Thr Phe Gly Gln Gly Thr Lys Val Glu 95 100 105 Ile Lys <210>39 <211>120 <212>PRT <213>Artificial Sequence <400>39 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly 1 5 10 15 Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Ser 20 25 30 Ser Tyr Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45 Glu Trp Val Gly Asn Ile Lys Gln Asp Gly Ser Glu Lys Tyr Tyr 50 55 60 Val Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala 65 70 75 Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu 80 85 Asp Thr Ala Val Tyr Tyr Cys Ala Arg Asp Leu Gly Val Leu Trp 90 95 100 Phe Gly Asp Pro Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser 105 110 115 Ser 120 <210>40 <211>107 <212>PRT <213>Artificial Sequence <400>40 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val 1 5 10 15 Gly Asp Gly Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser 20 25 30 Asn Ser Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys 35 40 45 Leu Leu Leu Tyr Ala Ala Ser Thr Val Glu Ser Gly Val Pro Ser 50 55 60 Arg Phe Ser Gly Arg Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile 65 70 75 Ser Ser Leu Leu Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 80 85 90 Tyr Tyr Ser Ala Pro Arg Thr Phe Gly Gln Gly Thr Lys Val Glu 95 100 105 Ile Lys

Claims

1. A monoclonal antibody specific for RBD of the novel coronavirus SARS-COV-2, characterized in that: The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO:21; the amino acid sequence of the light chain variable region is shown in SEQ ID NO:

22.

2. A monoclonal antibody specific for RBD of the novel coronavirus SARS-COV-2, characterized in that: The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO:33; the amino acid sequence of the light chain variable region is shown in SEQ ID NO:34.

Images