A method for detecting TLR10 rs11096957 genotype and its application in evaluating transplanted liver function

Abstract

This invention provides a method for detecting the TLR10rs11096957 genotype and its application in assessing transplanted liver function. The method includes the following steps: extracting genomic DNA from whole blood of liver transplant patients, adjusting the concentration, and performing PCR amplification; treating the amplified PCR product with SAP and then performing a single-base extension reaction; purifying the single-base extension reaction product, detecting it using time-of-flight mass spectrometry, and performing genotyping. This invention discovers that TLR10rs11096957 can be used to predict the function of transplanted livers in liver transplant patients, thereby guiding clinical treatment to improve transplant survival rates. Therefore, the method for detecting the TLR10rs11096957 genotype provided by this invention can improve the sensitivity of predicting transplanted liver function in liver transplant patients, providing a strategy for preparing corresponding predictive or assessment products, and has significant social and economic benefits.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a method for detecting TLR10rs11096957 genotype and an application thereof in evaluating transplant liver function. Background Art

[0002] Liver transplantation is currently recognized as the best treatment for various end-stage liver diseases, and can significantly improve the survival time of patients with end-stage liver diseases. Liver function is the main item of follow-up after liver transplantation. The change trend or stability of its core indicators can help medical staff judge the comprehensive prognosis of liver transplantation. Strict monitoring of liver function can timely detect complications that may occur during follow-up (such as acute rejection, drug-induced injury), etc. Total bilirubin (TBil) and direct bilirubin (DBil) are two indicators for evaluating liver function, and their changes over time are recommended means to evaluate the progress of liver function after transplantation. Liver transplant patients need to use immunosuppressants to reduce transplant rejection and improve the survival rate of transplanted livers. Insufficient immunosuppressants may increase the risk of rejection, and excessive immunosuppressants may cause adverse reactions, including hepatotoxicity. These factors will affect the changes in TBil and DBil after transplantation, making liver function after transplantation vary greatly between individuals.

[0003] Genetic factors are one of the important factors causing individual differences in transplanted liver function, and single nucleotide polymorphisms (SNPs) are the most common form of genetic variation, and 90% of individual differences are caused by SNPs.

[0004] Toll-like receptors (TLRs) are an important class of protein molecules involved in innate immunity. They are innate immune receptors that are necessary for warning the immune system after microbial invasion, and play an important role in activating the body's innate immunity in the body's anti-infection immunity. TLRs also play an important bridging role between innate immunity and acquired immunity by regulating the activation of antigen-presenting cells such as monocytes / macrophages and dendritic cells, and the expression of second signals such as CD80. In addition, recent studies have shown that TLRs are also involved in certain autoimmune diseases and the body's transplant immunity. Animal experiments and clinical studies have also reported that TLRs are associated with the degree of allogeneic rejection, and their excessive immune response can trigger graft rejection. Therefore, the study of TLRs signaling pathways involved in transplant immunity has become one of the hot topics in the field of organ transplantation.

[0005] At present, there are 13 human TLRs family members found in mammals and humans, namely TLR1-TLR13. They are widely distributed, mainly in lymphocytes such as monocytes, macrophages, dendritic cells, polymorphonuclear cells, B cells, T cells, basophils and NK cells. TLR10 is an important member of the TLRs family, mainly expressed in immune-related tissues and cells, including spleen, lymph nodes, human B cells, etc. Unlike other TLRs family members, TLR10 has an anti-inflammatory effect and has an inhibitory effect on other TLR signals, the production of inflammatory factors, and the activation of monocytes and B cells.

[0006] Existing literature studies have reported that TLR10 may be associated with some tumors, immune diseases and infectious diseases, such as bladder cancer, IgA liver disease, Crohn's disease, asthma, pulmonary aspergillosis, arthritis, etc. In studies of allogeneic hematopoietic stem cell transplantation patients, TLR10 was found to be associated with the onset of acute graft-versus-host disease. TLR10 gene polymorphism is closely related to the onset of many immune diseases, and the correlation between TLRs and organ transplant immunity has been recognized. TLR10 gene polymorphism is of great significance for evaluating liver function in liver transplant patients.

[0007] Currently, there is no reliable method to predict the function of the transplanted liver in liver transplant patients. However, given its impact on the survival rate of the transplanted liver, its prediction undoubtedly has great clinical and economic value. Summary of the invention

[0008] In order to overcome the defects in the prior art, the present invention provides a method for detecting the TLR10 rs11096957 genotype, thereby providing a strategy for preparing products for evaluating the transplanted liver function of liver transplant patients and evaluating whether patients need to focus on monitoring liver pathological changes and adjusting treatment plans after liver transplantation. The present invention is based on the time-of-flight mass spectrometry (MALDI-TOF) technology to detect the TLR10 rs11096957 genotype. The technical principle of the method is as follows: first, the genomic fragment containing the SNP is amplified by PCR, and then a single base extension is achieved by sequence-specific primers. Subsequently, the sample analyte is co-crystallized with the chip matrix and subjected to an instantaneous nanosecond (10 -9 s) Strong laser excitation; the nucleic acid molecules are desorbed to become singly charged ions. Since the flight time of ions in the electric field is inversely proportional to the ion mass, the precise molecular weight of the sample analyte is obtained by detecting the flight time of the nucleic acid molecules in the vacuum tube, thereby detecting the SNP site information.

[0009] To achieve the above object, the present invention adopts the following technical solution:

[0010] The first aspect of the present invention is to provide a method for detecting the TLR10 rs11096957 genotype, comprising the following steps:

[0011] Step 1: extract genomic DNA from whole blood of liver transplant patients and perform PCR amplification after adjusting the concentration;

[0012] Step 2: After the amplified PCR product is treated with SAP, a single base extension reaction is performed;

[0013] Step three, purify the single base extension reaction product, detect it with a time-of-flight mass spectrometer, and perform genotyping.

[0014] Furthermore, the concentration of genomic DNA was adjusted to 20-50 ng / μl.

[0015] Furthermore, the sequences of the primers used for PCR amplification in step 1 are SEQ ID No.: 1 and SEQ ID No.: 2.

[0016] Furthermore, the sequence of the single base extension primer used in the single base extension reaction in step 2 is SEQ ID No.: 3.

[0017] The second aspect of the present invention is to provide the use of the reagent used in the above method in the preparation of a product for evaluating the transplanted liver function of a liver transplant patient. The product includes the reagent used in the above method and instructions for use.

[0018] Furthermore, the above instruction manual includes the following instructions:

[0019] a. TLR10 rs11096957 genotype was detected using the above method;

[0020] b. Evaluate the patient's liver function based on the typing test result according to the evaluation criteria; the typing test result is selected from one of TG type, TT type and GG type; the evaluation criteria are: the recovery of liver function after transplantation in liver transplant patients with TG / TT type is slower than that in patients with GG type.

[0021] Furthermore, the above product is a test kit.

[0022] The third aspect of the present invention is to provide the use of the reagent used in the above method in the preparation of a product for evaluating whether liver transplant patients need to focus on monitoring liver pathological changes after transplantation. The product includes the reagent used in the above method and instructions for use.

[0023] Furthermore, the above instruction manual includes the following instructions:

[0024] a. TLR10 rs11096957 genotype was detected using the above method;

[0025] b. Based on the typing test results and the evaluation criteria, whether the liver transplant patients need to focus on monitoring liver pathological changes after transplantation is evaluated; the typing test result is selected from one of the TG type, TT type and GG type; the evaluation criteria are: patients with TG / TT type need to focus on monitoring liver pathological changes and adjust the treatment plan; patients with GG type do not need to focus on monitoring liver pathological changes and adjust the treatment plan.

[0026] Furthermore, the above product is a test kit.

[0027] The fourth aspect of the present invention is to provide a kit for evaluating the transplanted liver function of a liver transplant patient and evaluating whether the patient needs to focus on monitoring liver pathological changes after liver transplantation, including the reagents used in the above method, preferably including primers with sequences of SEQ ID No.: 1 to SEQ ID No.: 3.

[0028] The present invention adopts the above technical solution, and has the following technical effects compared with the prior art:

[0029] The present invention finds that TLR10 rs11096957 can be used to predict the transplanted liver function of liver transplant patients, thereby being used to guide clinical treatment to improve the survival rate of transplanted livers. Therefore, the method for detecting TLR10 rs11096957 genotype provided by the present invention can improve the sensitivity of predicting the transplanted liver function of liver transplant patients, provide a strategy for preparing corresponding prediction or evaluation products, and have great social and economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the TT type typing diagram of the TLR10 rs11096957 locus, in which the peak value of T is 9.9 and the peak value of G is 2.0;

[0031] Figure 2 This is the TG typing diagram of the TLR10 rs11096957 locus, in which the peak of T is 4.8 and the peak of G is 4.3;

[0032] Figure 3 This is the GG typing diagram of TLR10 rs11096957 locus, where the peak value of T is 0.5 and the peak value of G is 4.1;

[0033] Figure 4 It is a line graph of the effect of TLR10 rs11096957 gene polymorphism on liver function after transplantation, wherein Figure A and Figure B respectively show the effect of TLR10 rs11096957 gene polymorphism on TBil and DBil after transplantation. DETAILED DESCRIPTION

[0034] The present invention provides a method for detecting the TLR10 rs11096957 genotype, thereby providing a strategy for preparing a product for evaluating the transplanted liver function of a liver transplant patient and evaluating whether the patient needs to focus on monitoring liver pathological changes and adjusting the treatment plan after liver transplantation. The present invention is described in detail and specifically through specific examples and drawings to better understand the present invention, but the following examples do not limit the scope of the present invention.

[0035] The methods in the examples are conventional methods unless otherwise specified, and the reagents used are conventional commercial reagents or reagents prepared according to conventional methods unless otherwise specified.

[0036] Example 1

[0037] This example investigates the effect of TLR10 rs11096957 gene polymorphism on the level of liver function decline in liver transplant patients within 1 year after transplantation. The specific experimental steps and results are as follows:

[0038] 1. Inclusion and exclusion criteria for liver transplantation patients

[0039] A total of 145 Chinese Han liver transplant patients were selected and underwent allogeneic liver transplantation at Huashan Hospital Affiliated to Fudan University from September 2018 to September 2019. The inclusion and exclusion criteria were as follows:

[0040] Inclusion criteria: Han Chinese patients undergoing first allogeneic liver transplantation; aged 18-65 years; weight greater than 40 kg, height greater than 150 cm; receiving tacrolimus-based triple immunosuppressive therapy; preoperative group reactive antibody class I and class II antibodies were negative, and lymphocyte cytotoxicity cross-test was less than 10%; survival after transplantation was greater than 1 year, and complete follow-up data were available; able to fully understand the purpose of this study and understand possible adverse reactions, voluntarily participate in the experiment and sign the informed consent.

[0041] Exclusion criteria: patients who do not meet the standard dosing regimen; patients who are not undergoing first liver transplantation or combined organ transplantation; patients with malignant tumors or a history of malignant tumors; and patients with postoperative follow-up time of less than 1 year.

[0042] 2. Immunosuppression regimen

[0043] All patients were treated with a triple maintenance immunosuppression regimen, namely, calcineurin inhibitor (CNI), mycophenolic acid (MPA), and glucocorticoids. The calcineurin inhibitor was tacrolimus (TAC, Prograf, Astellas, Ireland), mycophenolic acid including mycophenolate mofetil (MMF, Cellcept, Roche, Shangha, China) and mycophenolate sodium (MPS, Mifu, Novartis, Basel, Switzerland), and the glucocorticoids were prednisone or methylprednisolone.

[0044] The starting dose of TAC is 0.1-0.15 mg / kg / d, taken orally once in the morning and evening. After that, TDM and dose adjustment are used to maintain the TAC trough concentration at 8-10 ng / mL in the first month, 6-8 ng / mL in the first to third months, and 4-6 ng / mL thereafter. In special cases, individual target concentration values ​​can be adjusted according to clinical needs.

[0045] MMF or MPS was administered from the first day after surgery, twice a day. The MMF dosage was adjusted according to the body weight gradient. For patients with a body weight of <50 kg, 50-70 kg, and >70 kg, the initial doses were 1.0 g / day, 1.5 g / day, and 2.0 g / day, respectively, and were reduced to 0.75 g / day, 1.0 g / day, and 1.5 g / day, respectively, after 1 month. The MPS dosage was calculated as 0.18 g MPS = 0.25 g MMF.

[0046] Glucocorticoids were started on the day of surgery. On the day of surgery, 1 g of methylprednisolone was injected intravenously, followed by 500 mg intravenously every day for 3 consecutive days. On the fourth day after surgery, 80 mg of prednisone was taken orally, and the dosage was gradually reduced from 10 mg / day to 20 mg (on the 10th day), and then reduced again to 10 mg / day after 3 months.

[0047] 3. Transplant liver function indicators

[0048] The function of the transplanted liver was evaluated by the changes in TBil and DBil after transplantation. The baseline values ​​after transplantation and the TBil and DBil values ​​at 1-12 months were collected for statistical analysis. The baseline values ​​were defined as the TBil and DBil values ​​at the beginning of transplantation.

[0049] 4. Genotype detection

[0050] From all patients enrolled in liver transplantation, 2 ml of peripheral venous blood was collected, anticoagulated with EDTA, and stored in a -20°C refrigerator for genotype detection.

[0051] The genotyping method for liver transplant patients uses MassARRAY time-of-flight mass spectrometry. Whole blood genomic DNA was extracted using a DNA extraction kit and the concentration was adjusted to 20-50 ng / μl. Probes and primers were synthesized by Shanghai Bioengineering Company. The DNA template was subjected to PCR cycles, and the PCR products were subjected to SAP treatment and extension reactions. After the extension products were purified, the test samples were transferred from the 384-well reaction plate to the MassARRAY SpectroCHIP chip with a matrix on the surface. After the samples were transferred to the SpectroCHIP chip, they could be placed in a mass spectrometer for detection. The experimental results were analyzed by TYPER software to obtain the typing data.

[0052] The specific steps are as follows:

[0053] (1) Multiplex PCR reaction: Search the target gene sequence, design and synthesize PCR primers (ACGTTGGATGGGCAAAAGCCAATTTGTAAG (SEQ ID No.: 1) and ACGTTGGATGAGGTCGTCCCAGAGTAAATC (SEQ ID No.: 2)) for the mutation site, add 1 μl DNA and 4 μl PCR reaction solution to each well of a 384-well plate, seal the plate, centrifuge briefly, place in a PCR instrument, and run the PCR reaction program. The PCR reaction program is: 94°C for 15 min, 45 cycles (94°C for 20 sec, 56°C for 30 sec, 72°C for 1 min), and 72°C for 3 min.

[0054] Table 1 PCR reaction solution components

[0055]

[0056] (2) SAP treatment: Add 2 μl of SAP reaction solution to each well of the 384-well plate, seal the plate, centrifuge, place in a PCR instrument, and run the SAP reaction program. SAP reaction program: 37°C for 40 min, 85°C for 5 min.

[0057] Table 2 SAP reaction system

[0058]

[0059] (3) Extension reaction: Design a single-base extension primer TCTGCAACGAAATCTTAGTTTAGAA (SEQ ID No.: 3); add 2 μl of iPlex reaction solution to each well of a 384-well plate, seal the plate, centrifuge, place in a PCR instrument, and run the extension reaction program. The extension reaction conditions are: 94°C for 30 seconds, 40 cycles (94°C for 5 seconds, 5 small cycles (52°C for 5 seconds, 80°C for 5 seconds)), 72°C for 3 minutes.

[0060] Table 3 Extension reaction system

[0061]

[0062] (4) Product purification: After the reaction, the 384-well plate was centrifuged at 1,000 rpm for 1 min, 25 μl of deionized water was added to each well, and the plate was inverted on the 384-well resin plate. The resin plate was then placed on the 384-well plate and tapped to make the resin fall into the 384-well plate. After sealing the plate, the 384-well plate was turned over for 20 min and centrifuged at 3,500 rpm for 5 min.

[0063] (5) Mass spectrometry detection: The test samples were transferred from the 384-well reaction plate to the MassARRAY SpectroCHIP chip with a matrix on the surface, and then placed in the MassARRAY Analyzer Compact mass spectrometer for detection. The experimental results were analyzed by TYPER software to obtain typing data (the typing diagrams of TT, TG, and GG are shown in Figure 2). Figure 1-3 ).

[0064] 5. Statistical analysis of association studies

[0065] The influence of gene polymorphism on the changing trend of TBil and DBil was analyzed by mixed linear model for repeated measurement data. The data set was reorganized into a mixed analyzable structure, and a complex symmetric structure was selected as the repeated measurement variance structure. Multivariate mixed linear model was used to perform multivariate statistical analysis on SNP, and clinical confounding factors such as age, gender, weight, and induction immunotherapy were included in the model as confounding factors.

[0066] 6. Statistical results

[0067] In order to investigate the effect of TLR10 rs11096957 gene polymorphism on liver function after transplantation, we used linear mixed model to analyze the relationship between SNP and the trend of TBil and DBil changes in liver transplant patients within 1 year after transplantation. The analysis found that SNP had a significant effect on the trend of TBil and DBil changes. Patients with TG / TT genotype had a slower decline in TBil and DBil than those with GG genotype (TBil: -55.8% vs. -75.0%, P = 0.001, Figure 4 A, Table 4; DBil: -66.4% vs. -87.8%, P = 0.002, Figure 4 B, Table 5).

[0068] Table 4 Effect of TLR10 rs11096957 gene polymorphism on TBil after transplantation

[0069]

[0070] Table 5 Effect of TLR10 rs11096957 gene polymorphism on DBil after transplantation

[0071]

[0072]

[0073] Multivariate analysis included clinical confounding factors such as age, gender, weight, and induction immunotherapy to examine the effect of rs11096957 gene polymorphism on liver function after transplantation. The results are shown in Tables 6-7. The results were consistent with the univariate analysis. The rs11096957 gene polymorphism affected the change trend of TBil and DBil. The TBil and DBil of patients with GG genotype decreased faster than those with TG / TT genotype (TBil: P=0.003; DBil: P=0.005).

[0074] Table 6 Multivariate analysis of the effect of TLR10 rs11096957 gene polymorphism on TBil after transplantation

[0075]

[0076] Table 7 Multivariate analysis of the effect of TLR10 rs11096957 gene polymorphism on DBil after transplantation

[0077]

[0078]

[0079] 7. Conclusion

[0080] The above results show that, taking liver transplant patients as the research subjects, the decrease of TBil and DBil in patients with TG / TT type within 1 year after transplantation is slower than that in patients with GG type.

[0081] Therefore, the liver function of liver transplant patients after transplantation can be predicted by detecting the TLR10 rs11096957 genotype. The liver function of patients with TG / TT genotype recovers slower than that of patients with GG genotype.

[0082] Based on the test results, it can help predict risks. Patients with TG / TT type need to focus on monitoring liver pathological changes and adjust treatment plans; patients with GG type do not need to focus on monitoring liver pathological changes and adjust treatment plans.

[0083] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modification and substitution of the present invention are also within the scope of the present invention. Therefore, the equalization and modification made without departing from the spirit and scope of the present invention should be included in the scope of the present invention. Sequence Listing <110> Huashan Hospital Affiliated to Fudan University <120> A method for detecting TLR10 rs11096957 genotype and its application in evaluating transplanted liver function <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <400> 1 acgttggatg ggcaaaagcc aatttgtaag 30 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <400> 2 acgttggatg aggtcgtccc agagtaaatc 30 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <400> 3 tctgcaacga aatcttagtt tagaa 25

Claims

1. Use of a reagent for detecting TLR10 rs11096957 genotype in the preparation of a product for evaluating liver function of a liver transplant patient, characterized in that: The product includes the reagent and instructions for use.

2. The use according to claim 1, characterized in that: The instructions for use include the following instructions: a. PCR detection of TLR10 rs11096957 genotype; b. Evaluate the liver function of the subject based on the typing test result according to the evaluation criteria; the typing test result is selected from one of TG type, TT type and GG type; the evaluation criteria are: the recovery of liver function after liver transplantation in patients with TG / TT type is slower than that in patients with GG type.

3. Use of a reagent for detecting the TLR10 rs11096957 genotype in the preparation of a product for evaluating whether liver transplant patients need to focus on monitoring liver pathological changes after transplantation, characterized in that: The product includes the reagent and instructions for use.

4. The use according to claim 3, characterized in that: The instructions for use include the following instructions: a. PCR detection of TLR10 rs11096957 genotype; b. Based on the typing test results and the evaluation criteria, whether the liver transplant patients need to focus on monitoring liver pathological changes after transplantation is evaluated; the typing test results are selected from one of TG type, TT type and GG type; the evaluation criteria are: liver transplant patients with TG / TT type need to focus on monitoring liver pathological changes and adjust the treatment plan; liver transplant patients with GG type do not need to focus on monitoring liver pathological changes and adjust the treatment plan.

Images