Intestinal bacteria growth inhibitor
Patent Information
- Application Number
- JP2023210594
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-12-13
- Publication Date
- 2025-06-25
- Estimated Expiration
- 2043-12-13
AI Technical Summary
【0016】 本発明によれば、ルミノコッカス グナバスやフソバクテリウム属などの、ムチン分解に関与しうる腸内細菌の増殖を抑制することができる。これにより、腸内でのNanAの発現を抑制し、あるいは腸内のムチンの分解を抑制し、もって、腸管バリア機能を保全して、宿主の健康の維持や向上に寄与することができる。
Smart Images

Figure 2025094822000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to an inhibitor for suppressing the growth of intestinal bacteria, which contains agarooligosaccharide as an active ingredient. Specifically, the present invention relates to an inhibitor for suppressing the growth of intestinal bacteria that contains agarooligosaccharide as an active ingredient and has an N-acetylneuraminic acid lyase gene consisting of a DNA sequence having a sequence identity of 45.6% or more with SEQ ID NO: 1 in genomic DNA.
Background Art
[0002] Mucin is a high-molecular glycoprotein derived from animals and is the main component of mucus produced in the mucosal epithelium of the digestive tract and respiratory tract, salivary glands, etc. It has a structure in which sugar chains are frequently bound to the core protein and generally has strong viscosity and high water retention. Mucin is classified into a secreted type and a membrane-bound type. In addition to its mucosal protection and lubricating effects as a physical barrier, the membrane-bound type is also involved in information transmission into the cytoplasm. The gene encoding the core protein of mucin is denoted as "MUC" and is numbered in the order of discovery. To date, more than 20 types have been reported in humans.
[0003] The lumen of the digestive tract is covered with a mucus layer, and such a mucus layer acts as a physical, chemical, and biological barrier against external factors such as pathogenic microorganisms, allergens, viruses, and toxins derived from food and drink. Digestive tract mucus is secreted from columnar epithelial cells called goblet cells, and membrane-bound MUC4, secreted MUC2, MUC5B, etc. are involved in the main component mucin, and MUC2 is particularly important (Non-Patent Document 1). MUC2-deficient mice have selectively impaired mucus secretion in the goblet cells of the large intestine, causing spontaneous onset of colitis and exacerbation of dextran sulfate-induced enteritis (Non-Patent Document 2). In addition, in MUC2 gene mutant mice, dysbiosis (a state in which the intestinal flora deviates from a healthy state) was observed at 4 weeks after birth, and spontaneous enteritis was histologically confirmed at 16 weeks (Non-Patent Document 3). From these reports, it can be seen that the intestinal barrier function of the mucus layer mainly composed of mucin is important for maintaining health.
[0004] As a result of feeding a low-fiber diet to gnotobiotic mice colonized with 14 representative human intestinal bacterial species, including four species (Akkarmansia muciniphila, Barnesiella intestinihominis, Bacteroides thetaiotaomicron, Bacteroides caccae) that decompose mucus, a significant reduction in the mucus layer of the large intestine was reported (Non-Patent Document 4). That is, although the human intestinal flora originally feeds on dietary fiber, it has been shown that in an environment lacking dietary fiber, it feeds on mucus secreted by the host, and thereby the intestinal barrier can be eroded (Non-Patent Document 1).
[0005] In addition to the above four species, Ruminococcus gnavus has been reported as an intestinal bacterium that decomposes mucin. Ruminococcus gnavus grows using sialic acid of mucin as a nutrient source. It has been reported that Ruminococcus gnavus ATCC 29149 strain has a unique sialic acid metabolic pathway in which it cleaves 2,7-anhydro-N-acetylneuraminic acid (not N-acetylneuraminic acid) from the mucin sugar chain, transports it into the cell, converts it to N-acetylneuraminic acid, and then decomposes and metabolizes it into N-acetylmannosamine and pyruvic acid by N-acetylneuraminic acid lyase (NanA) (Non-Patent Document 5).
Prior Art Documents
Patent Documents
[0006]
Non-Patent Document 1
Non-Patent Document 2
Non-Patent Document 3
Non-Patent Document 4
Non-Patent Document 5
Summary of the Invention
Problems to be Solved by the Invention
[0007] Therefore, the inventors of the present invention considered that if the number of bacteria involved in mucin degradation in the intestine is suppressed, the degradation of mucin in the intestine can be suppressed, the intestinal barrier function can be preserved, and it can contribute to the maintenance and improvement of the health of the host (human or animal). That is, an object of the present invention is to provide a technique for suppressing the number of bacteria involved in mucin degradation in the intestine.
[0008] As a result of intensive research, the inventors of the present invention found that agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having 3,6-anhydro-L-galactose at the reducing end can suppress the number of bacteria of Lachnococcus gnavus and Bacteroidetes, which are mucin-degrading bacteria. Furthermore, they found that they can suppress the number of intestinal bacteria that possess a homolog of the gene (SEQ ID NO: 1) of NanA, which is a sialic acid-metabolizing enzyme of Lachnococcus gnavus, in genomic DNA. Based on these findings, the following inventions were completed.
[0009] (1) A first aspect of the agent according to the present invention (sometimes referred to as "this agent") is a growth inhibitor (composition for growth inhibition) of intestinal bacteria that possess, in genomic DNA, a NanA gene consisting of a DNA sequence having a sequence identity of 45.6% or more with SEQ ID NO: 1 (the NanA gene of Lachnococcus gnavus), and contains agarooligosaccharide as an active ingredient.
[0010] (2) This agent may be used for suppressing the expression of NanA in the intestine. That is, this agent may be an expression inhibitor (composition for expression inhibition) of NanA in the intestine.
[0011] (3) This agent may be used for suppressing the degradation of intestinal mucin. That is, this agent may be a degradation inhibitor (composition for degradation inhibition) of intestinal mucin.
[0012] (4) This agent may be used for preserving the intestinal barrier function. That is, this agent may be a preservative (composition for preservation) of the intestinal barrier function.
[0013] (5) In the present invention, the intestinal bacterium may be of the genus Ruminococcus, Fusobacterium, Blautia, or Bacteroides.
[0014] (6) In the present invention, the agarooligosaccharide may contain agarobiose.
[0015] (7) The second aspect of the present agent is an inhibitor for the growth of intestinal bacteria (composition for growth inhibition) that retains a NanA gene consisting of a DNA sequence having a sequence identity of 45.6% or more with SEQ ID NO: 1 in genomic DNA, and contains 3,6-anhydro-L-galactose or an oligosaccharide having the same at the reducing end as an active ingredient.
Effects of the Invention
[0016] According to the present invention, it is possible to suppress the growth of intestinal bacteria that may be involved in mucin degradation, such as Ruminococcus gnavus and the genus Fusobacterium. Thereby, the expression of NanA in the intestine can be suppressed, or the degradation of mucin in the intestine can be suppressed, thereby preserving the intestinal barrier function and contributing to the maintenance and improvement of the host's health.
[0017] In addition, the agarooligosaccharide used as an active ingredient in the present invention is an oligosaccharide made from agar, which has been ingested as a food since ancient times, and its safety is extremely high. Therefore, according to the present invention, it is possible to suppress the growth of intestinal bacteria that may be involved in mucin degradation without any concerns about safety or side effects.
Brief Description of the Drawings
[0018]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Mode for Carrying Out the Invention
[0019] Hereinafter, the present invention will be further described. This agent contains agarooligosaccharide as an active ingredient.
[0020] Agarooligosaccharide is an oligosaccharide of an even sugar composed of repeating units of agarobiose, a disaccharide consisting of D-galactose and 3,6-anhydro-L-galactose. Examples of agarooligosaccharide include agarobiose, which is the smallest unit and a disaccharide; agarotetraose, a tetrasaccharide; agarohexaose, a hexasaccharide; agarooctaose, an octasaccharide; agarodecaose, a decasaccharide, and the like. In the present invention, agarooligosaccharide contains at least one of these oligosaccharides, and may consist of one kind or may contain two or more kinds.
[0021] As shown in the examples described below, among agarooligosaccharides, agarobiose exhibits a particularly high growth inhibitory effect on intestinal bacteria carrying the NanA gene homolog of Luminococcus gnavus. Therefore, it is preferable that the agarooligosaccharide contains agarobiose. In this case, the agarooligosaccharide may consist only of agarobiose, or may contain agarooligosaccharides other than agarobiose. Examples of the content ratio of agarobiose in the agarooligosaccharide in this case include 1 to 100% by mass, 10 to 100% by mass, 20 to 100% by mass, 30 to 100% by mass, 40 to 100% by mass, 50 to 100% by mass, and the like.
[0022] Agarooligosaccharide is an oligosaccharide having 3,6-anhydro-L-galactose at the reducing end. Therefore, the active ingredient of this agent may be 3,6-anhydro-L-galactose or an oligosaccharide having this at the reducing end. Examples of the number of sugars of the oligosaccharide in this case include 2 to 8 sugars, 2 to 10 sugars, 2 to 12 sugars, and the like.
[0023] As the agarooligosaccharide, commercially available agarooligosaccharide (agar oligosaccharide) can be used, or it can also be produced and used according to a conventional method. As a general production method of agarooligosaccharide, for example, a method of hydrolyzing agar can be exemplified. Hydrolysis includes a method using an acid and a method using an enzyme.
[0024] Examples of the acid decomposition method include using a solid acid described in Japanese Patent No. 4796697, using a mineral acid such as sulfuric acid or hydrochloric acid, or using an organic acid such as acetic acid or citric acid, and any method may be used. According to acid decomposition, an even-numbered sugar having 3,6-anhydro-L-galactopyranose at the reducing end can be obtained.
[0025] In addition, examples of the enzymatic decomposition method include decomposition by α-agarase and decomposition by β-agarase. According to α-agarase, in the same manner as in the case of acid decomposition, even-numbered sugars having 3,6-anhydro-L-galactopyranose at the reducing end can be obtained. The decomposition by α-agarase can be carried out, for example, by the method described in Japanese Patent Application Laid-Open No. H2-65789.
[0026] The hydrolyzate of agar may be used as it is as an agarooligosaccharide, or may be used after purification or pH adjustment. Examples of the purification method include filtration using filter paper, activated carbon, etc. Further, the agarooligosaccharide solution obtained by the hydrolysis treatment may be used in a liquid state, or may be used in a powder state by vacuum freeze-drying or the like as necessary.
[0027] Incidentally, agar is a dehydrated and dried viscous substance extracted from red algal seaweeds such as tengusa and ogonori, and contains polysaccharides agarose and agaropectin as main components. As raw materials for producing agarooligosaccharides, in addition to agar, substances containing agarose or agaropectin as components can also be used. Specific examples of such substances include solutions obtained by hot water extraction of red algae such as the tengusa family, ogonori family, and igisu family, which are raw materials for agar. Examples of red algae of the tengusa family include macsa, onigusa, obusa, hirakusa, obakusa, yuikiri, etc., examples of red algae of the ogonori family include ogonori, oogonori, etc., and examples of red algae of the igisu family include igisu, egonori, etc. These red algae can be used alone or in combination of two or more.
[0028] As shown in the examples described later, the sugar composition of the agarooligosaccharide can be confirmed by liquid chromatography including high performance liquid chromatography. Further, by this, agarooligosaccharides having a desired number of sugars, such as only agarobiose, only agarotetraose, and only agarohexaose, can be fractionated and separated, and the sugar composition of the agarooligosaccharide can be adjusted and used.
[0029] 3,6-Anhydro-L-galactose can be obtained by using commercially available products such as reagents, or can also be produced by conventional methods. Examples of such production methods include the method described in Japanese Patent No. 4007760. That is, 50 μl of 10-fold concentrated phosphate buffered saline and 50 μl of β-galactosidase phosphate buffered saline solution at 10 units / μl are added to 450 μl of a 100 mM aqueous solution of agarobiose and mixed, and the mixture is reacted at 37°C for 1 hour. After adding 5 ml of a 1-butanol:ethanol = 1:1 mixture to this reaction solution, the insoluble matter is precipitated by centrifugation, and the obtained supernatant is subjected to column chromatography using a silica gel column. Using 1-butanol:ethanol:water = 5:5:1 as the eluent, it is pressurized to 0.3 kg / cm 2 and separated. By fractionating so that each fraction is 7 ml, a liquid containing high-purity 3,6-anhydro-L-galactose can be obtained, for example, in fractions from the 14th to the 17th. By collecting these fractions and drying them under reduced pressure, 3,6-anhydro-L-galactose can be obtained.
[0030] This agent is an agent that suppresses the growth of intestinal bacteria that possess the NanA gene consisting of a DNA sequence having a sequence identity of 45.6% or more with SEQ ID NO: 1 in genomic DNA. In the present invention, with respect to intestinal bacteria, suppressing growth and suppressing the number of bacteria are synonymous.
[0031] In the present invention, intestinal bacteria refer to bacteria that inhabit the intestine or bacteria detected from specimens that reflect the intestinal environment such as feces, cecal contents, and intestinal lavage fluid.
[0032] Whether or not the growth of specific intestinal bacteria can be suppressed can be confirmed according to conventional methods. For example, as shown in the examples described later, if specific intestinal bacteria are in an isolated state, the active ingredient of this agent can be added to the medium for culturing them, and the degree of growth can be confirmed by a turbidity method or the like in comparison with cases where it is not added. Further, for specimens reflecting the intestinal environment, the number of bacteria can be confirmed by quantitative PCR using primers specific to the bacteria. That is, the degree of growth inhibition can be confirmed by comparing the number of bacteria by quantitative PCR between the case where the active ingredient of this agent is ingested and the case where it is not ingested.
[0033] SEQ ID NO: 1 (948 residues) is the DNA sequence of the gene encoding NanA of Luminococcus gnavus. [SEQ ID NO: 1] ATGGCTTTTATGAAGCAAAGGAGCAAAACTATGAGAAATCTTGAGAAGTATAAAGGTGTGATTCCGGCATTTTATGCTTGCTATGACAAAGAAGGAAACATTAGTCCAGAAGGTGTACAGGGACTGACAAAATATTTTGTAAAAAAAGGGGTAAAAGGTGTCTATGTAAACGGTTCTTCCGGAGAATGTATTTATCAGAGTGTGGAGGACCGTAAGATTGTACTTGAGAATGTTATGAAAGTAGCGGAAGGTAAACTTACAGTTATTGCCCATGTGGCCTGCAATAACACGAAGGACAGTCAGGAGCTTGCCAGACATGCAGAAGGGCTGGGGGTAGATGCAATCGCTGCAATTCCTCCCATCTATTTTCACTTACCGGAATATGCTATTGCGCAGTATTGGAATGCCATTAGTGCAGCGGCACCGAACACAGACTTTGTAATTTATAACATACCTCAGCTTGCTGGTGTTGCACTTACACAGAATTTATTTGTAGAGATGAGGAAAAATCCCAACGTCATTGGTGTCAAGAATTCCTCTATGCCGGTACAGGATATCCAAATGTTTAAGCAGGCTGCAGGAGCTGAGTACATTATCTTTAATGGTCCTGATGAGCAGTTTATGAGCGGACGTGTTATCGGGGCAGAGGGTGCAATTGGGGGAACCTATGGTGCTATGCCTGAATTATACTTAAAGTTGGATGAGTGTATAAATGCAGGAAAGATGACAGAGGCAAGAAAAATCCAGTATGCTTGTAATGAGATAATTTACAAAATGTGTTCAGCGCATGGAAATATGTATGCAGTTATTAAAGCAATTCTAAAGATTAATGAAGGACTGGAACTTGGTGCAGTAAGAGAGCCTCTTCCAGCATTGGTAGATGAGGACATGGAGATTGTAAAAGAAGCTGCACAGATGATCTGTGATGCGAAGAAGAAATTTCTATAA
[0034] N-acetylneuraminate lyase (NanA) is an enzyme that has the activity to decompose N-acetylneuraminate, a kind of sialic acid, into N-acetylmannosamine and pyruvic acid. The activity of NanA can be confirmed by, for example, the method described in the literature <Jay Prakash Kumar et.al., Crystal structures and kinetics of N-acetylneuraminate lyase from Fusobacterium nucleatum, Acta Cryst. (2018). F74, 725?732>. That is, the pyruvic acid produced by NanA is quantified by a standard binding assay <Zhu, A., Romero, R. & Petty, H. R. (2010). Anal. Biochem. 396, 146?151.>. Specifically, the pyruvic acid produced by the decomposition of N-acetylneuraminate is oxidized by pyruvate oxidase in the presence of phosphate and oxygen to produce acetyl phosphate, carbon dioxide and hydrogen peroxide. The oxidation of the fluorescent probe by hydrogen peroxide is catalyzed by horseradish peroxidase, and the hydrogen peroxide produced using the fluorescent generating substrate may be detected <Sugahara, K., Sugimoto, K., Nomura, O. & Usui, T. (1980). Clin. Chim. Acta, 108, 493?498.>.
[0035] Luminococcus gnavus has NanA, a sialic acid-metabolizing enzyme, and grows using the sialic acid of mucin as a nutrient source. Therefore, enterobacteria that possess a homolog of the NanA gene of Luminococcus gnavus in their genomic DNA may express NanA and be involved in mucin degradation in the intestine. If the number of such bacteria can be suppressed, it may be possible to suppress the expression of NanA in the intestine and suppress mucin degradation in the intestine. The mucus layer in the intestinal lumen is a physical, chemical, and biological barrier (barrier) against various external factors and is mainly composed of mucin. Therefore, by suppressing mucin degradation, the barrier can be preserved. Here, preserving the intestinal barrier function means maintaining the barrier function in a good state, or suppressing the decline of the function, including reducing the degree of decline even if the function has declined.
[0036] The homolog of the NanA gene of Luminococcus gnavus refers to a NanA gene consisting of a DNA sequence having a high sequence identity with SEQ ID NO: 1. Here, examples of the value of the sequence identity include, for example, 45% or more, 45.6% or more, 46% or more, 47% or more, 48% or more, 48.5% or more, 49% or more, 49.5% or more, 50% or more, 51% or more, 52% or more, 53% or more, 54% or more, 55% or more, 56% or more, 57% or more, 58% or more, 59% or more, 60% or more, 61% or more, 62% or more, 63% or more, 64% or more, 65% or more, 66% or more, 67% or more, 68% or more, 69% or more, 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 85% or more, 90% or more, 95% or more, etc., and 100% is also included. Note that "sequence identity" refers to sequence similarity and can be used interchangeably with "identity".
[0037] "A DNA sequence with high sequence identity to SEQ ID NO:1" can also be referred to as "a DNA sequence in which one or more nucleotides are deleted, substituted, inserted or added in SEQ ID NO:1". In this case, the number of nucleotides to be deleted, substituted, inserted or added can be exemplified by, for example, 1 to 521, 1 to 515, 1 to 511, 1 to 502, 1 to 492, 1 to 488, 1 to 483, 1 to 478, 1 to 474, 1 to 464, 1 to 455, 1 to 445, 1 to 436, 1 to 427, 1 to 417, 1 to 408, 1 to 398, 1 to 389, 1 to 379, 1 to 341, 1 to 331, 1 to 312, 1 to 284, 1 to 189, 1 to 94, 1 to 90, 1 to 80, 1 to 70, 1 to 60, 1 to 50.
[0038] The sequence identity between a certain DNA sequence and SEQ ID NO:1 can be confirmed according to conventional methods. For example, it can be confirmed using programs such as FASTA (http: / / www.genome.JP / tools / fasta / ), Basic local alignment search tool (BLAST; http: / / www.ncbi.nlm.nih.gov.), Position-Specific Iterated BLAST (PSI-BLAST; http: / / www.ncbi.nlm.nih.gov.), CLUSTALW (http: / / www.genome.jp / ja / ), MAFFT (http: / / www.genome.jp / ja / ).
[0039] As an intestinal bacterium that possesses in its genomic DNA a NanA gene (a homolog of the NanA gene of Luminococcus gnavus) with high sequence identity to SEQ ID NO:1, specifically, for example, Luminococcus genus bacteria such as Luminococcus gnavus (genome of ATCC 29149 = JCM6515; CP027002.1) (sequence identity; approximately 100%), Fusobacterium mortiferum (genome of ATCC 9817; CP028102.1) (sequence identity; approximately 65%), Fusobacterium nucleatum (genome of JCM8532; AE009951.2) (sequence identity; approximately 50%), Fusobacterium nucleatum (genome of ATCC 23726; CP028109.1) (sequence identity; approximately 53%) and other Fusobacterium genus bacteria, Blautia wexlerae (genome of MCC298; CP102267.1) (sequence identity; approximately 96%), Blautia luti (genome of JCM17040; AP028156.1) (sequence identity; approximately 71%), Blautia producta (genome of ATCC 27340 = DSM 2950 = JCM 1471; CP048626.1) (sequence identity; approximately 71%), Blautia coccoides (genome of strain YL58; CP022713.1) (sequence identity; approximately 73%) and other Blautia genus bacteria, Enterocloster bolteae (genome of ATCC BAA-613; CP022464.2) (sequence identity; approximately 72%), Anaerotruncus colihominis (genome of DSM 17241 = JCM 15631; CP102255.1) (sequence identity; approximately 72%), Lactobacillus oligofermentans (genome of DSM 15707 = LMG 22743 = JCM 16175; LN898144.1) (sequence identity; approximately 71%), Treponema brennaborense (genome of DSM 12168; CP002696.1) (sequence identity; approximately 69%), Marvinbryantia formatexigens (genome of DSM 14469; CP102268.1) (Sequence identity; approximately 68%), Streptococcus parasanguinis (genome of ATCC 15912; CP002843.1) (sequence identity; approximately 64%), Bacteroides acidifaciens (genome of 0.1X-D8-26; RAZM01000002.1) (sequence identity; approximately 48%), Bacteroides caccae (genome of ATCC 43185; AAVM02000005.1) (sequence identity; approximately 48%), Bacteroides acidifaciens (genome of P2318; TFU49045.1) (sequence identity; approximately 46%), etc. can be exemplified.
[0040] Among these, the genus Fusobacterium is a Gram-negative, non-motile, obligately anaerobic, non-spore-forming bacillus belonging to the family Fusobacteriaceae, which is normally present in the oral pharynx, digestive tract, genital organs, etc., and is isolated from suppurative infections of various organs throughout the body. For example, Fusobacterium nucleatum is a normal inhabitant of the human oral cavity and was known as a causative bacterium of periodontal disease. However, in recent years, it has been frequently detected in colorectal cancer tissues and has been shown to be involved in the progression of colorectal cancer. In addition, Fusobacterium varium is a normal inhabitant of the intestine, but its association with ulcerative colitis has been pointed out. Therefore, this agent can be used for the prevention and improvement of various diseases and unhealthy states such as suppurative infections, colorectal cancer, and ulcerative colitis by suppressing the growth of the genus Fusobacterium in the intestine.
[0041] Whether or not a certain intestinal bacterium possesses a homolog of the NanA gene of Lachnococcus gnavus can be confirmed according to a conventional method. For example, if the genomic DNA of the bacterium is sequenced and the sequence information of the genome can be obtained, the presence or absence of the homolog can be confirmed. Also, as shown in the examples described later, PCR may be performed using the genomic DNA of the bacterium as a template and primers capable of amplifying the homolog, and the presence or absence of amplification may be confirmed. If a considerable amount of PCR product is observed, it can be said that the bacterium possesses the homolog.
[0042] In the present invention, intestinal mucin refers to mucin present in the intestine. That is, it is the mucin that forms the mucus layer in the intestinal lumen. Examples of intestinal mucin include, for example, MUC4, MUC2, MUC5B mentioned above, as well as MUC5AC, MUC6, and the like.
[0043] Whether the degradation of intestinal mucin is suppressed can be confirmed according to conventional methods. For example, as described in Non-Patent Document 4, in the case of a large intestine tissue excised from an experimental animal or the like, the amount of MUC2 can be measured by immunostaining using an anti-MUC2 antibody. Therefore, by comparing the abundance of MUC2 when agarooligosaccharide is administered and when it is not administered, the degree of suppression of mucin degradation can be confirmed.
[0044] This agent can be used as it is in the form of food and drink, supplements, pharmaceuticals, quasi-drugs, etc., or it can be used in combination with other components and formulated in these as a raw material for food and drink, supplements, pharmaceuticals, quasi-drugs, etc. These products can be manufactured by methods known to those skilled in the art using agarooligosaccharide as a raw material.
[0045] The dosage (intake amount) of agarooligosaccharide can be appropriately set according to the administration subject, the form of the product, and the purpose. Specifically, as the dosage, for example, for adults per day, it can be exemplified as 0.0125 mg / kg body weight or more, 0.025 mg / kg body weight or more, 0.05 mg / kg body weight or more, 0.1 mg / kg body weight or more, 1000 mg / kg body weight or less, 800 mg / kg body weight or less, 600 mg / kg body weight or less, 400 mg / kg body weight or less, 200 mg / kg body weight or less.
[0046] The content of agarooligosaccharide in the product can also be appropriately set according to the form and use of the product. Specifically, as the content, for example, 0.0001% by mass or more, 0.001% by mass or more, 0.01% by mass or more, 0.1% by mass or more, 100% by mass or less, 90% by mass or less, 80% by mass or less, 70% by mass or less, 60% by mass or less, 50% by mass or less, 40% by mass or less, 35% by mass or less, 30% by mass or less, 10% by mass or less, 5% by mass or less, etc. can be exemplified.
[0047] Hereinafter, the present invention will be described based on examples. Note that the technical scope of the present invention is not limited to the features shown by these examples.
Examples
[0048] <Test method> (1) Preparation of agarooligosaccharide 50 g of agar (Ultra Agar AX-30, manufactured by Ena Food Industry Co., Ltd.) was added to 1000 g of purified water, heated and dissolved, then 2 g of concentrated sulfuric acid was added, and the mixture was stirred at 90 °C for 3 hours. After adjusting the pH to 3.5 with sodium hydroxide, it was treated with activated carbon and further filtered through filter paper to collect the filtrate. This was further filtered through a filter with a pore size of 0.1 μm to collect the filtrate, which was powdered by vacuum freeze-drying to obtain agarooligosaccharide powder.
[0049] The composition of the prepared agarooligosaccharide was measured using high performance liquid chromatography (Prominence (registered trademark) HPLC system, manufactured by Shimadzu Corporation). The measurement conditions were as follows: two columns (TSKgel (registered trademark) α-2500, manufactured by Tosoh Corporation) were connected in series, the solvent was H2O, the flow rate was 0.3 ml / min, elution was carried out at a temperature of 60 °C, and detection was by RI (differential refraction). The results were as follows (the values are in mass%, the same hereinafter). In this example, a composition containing the following 2-10 sugars is referred to as "agarooligosaccharide". Disaccharide (agarobiose): 31.5 Tetrasaccharide (agarotetraose): 30.1 Hexasaccharide (agaropentaose): 21.2 Octasaccharide (agaroctaose): 11.6 10 - saccharide (agarodecaose): 5.6
[0050] (2) Preparation of disaccharides to octasaccharides The agarooligosaccharides prepared by Test Method (1) were subjected to recycling size - exclusion chromatography to fractionate fractions containing disaccharide, tetrasaccharide, hexasaccharide, and octasaccharide, respectively. The recycling size - exclusion chromatography was carried out under the following conditions. ≪Conditions for recycling size - exclusion chromatography≫ System: LaboACE LC - 7080 Plus (Nippon Bunseki Kogyo) Column: JAIGEL - W252 / W253 (Nippon Bunseki Kogyo) Mobile phase: An aqueous solution containing 0.005% (v / v) acetic acid and 10% (v / v) ethanol Flow rate: 3.5 mL / min The composition of each fraction was confirmed by high - performance liquid chromatography under the conditions described in Test Method (1). Each fraction was dried to obtain agarobiose, agarotetraose, agarohexaose, and agarooctaose. In this example, agarobiose, agarotetraose, agarohexaose, and agarooctaose may be referred to as "disaccharide", "tetrasaccharide", "hexasaccharide", and "octasaccharide", respectively.
[0051] (3) Culture medium The culture medium used was a medium appropriately modified based on the Brain - Heart Infusion medium (※1) described in the literature <G. Le Blay et. al., In vitro inhibition activity of nisin A, nisin Z, pediocin PA - 1, Letters in Applied Microbiology, Volume45, Issue3, September 2007, Pages 252 - 257>. ※1 Composition of Brain-Heart Infusion medium; brain-heart infusion, 5 g / L yeast extract, 5 g K2HPO4, 8 g glucose, 0.5 g L-cysteine hydrochloride, 1 g Tween 80, 0.005 g hemin, 0.002 g vitamin K1, 1 mg resazurin, 50 mL salt solution (※2). ※2 Composition of salt solution (per 1 L); 5 g sodium acetate, 2 g ammonium citrate, 0.2 g MgSO2·7H2O, 0.05 g MnSO4·H2O, pH 6.8.
[0052] <Example 1> Growth inhibitory effect of Ruminococcus gnavus (1) Cultivation in the presence of agarooligosaccharide Ruminococcus gnavus JCM6515 (RIKEN BioResource Center, Microbial Materials Development Laboratory (JCM)) was cultured on sheep blood agar medium (M) (composition per 1 L of purified water: 14.5 g of casein-tryptic digest, 5.0 g of soybean-papain digest, 5.0 g of sodium chloride, 1.5 g of growth factor, 50 mL of defibrinated sheep blood, 14.0 g of agar, pH 7.3) (BD, Japan) to obtain colonies. After inoculating a single colony into 3.0 mL of the culture medium, it was statically cultured anaerobically at 37°C for 3 days using an anaerobic culture kit "AnaeroPack" (Mitsubishi Gas Chemical) and used as a seed mother liquor.
[0053] Agarooligosaccharide was added to the culture medium to a final concentration of 0% by mass, 0.01% by mass, 0.10% by mass, and 0.20% by mass to prepare this culture medium. After dispensing 0.5 mL / well of this culture medium into Deep Well Plates (AxyGen Scientific, CA, USA), 0.25 μL of the seed mother liquor was inoculated into each well, and it was statically cultured anaerobically at 37°C using an anaerobic culture kit "AnaeroPack" (Mitsubishi Gas Chemical).
[0054] (2) Measurement of the number of bacteria by turbidimetry Twenty microliters of the culture broth was collected 24 hours and 48 hours after the start of static culture, and 180 μL of water was added to dilute it 10-fold. The absorbance (OD660) of the diluted culture broth was measured using a microplate reader (Wako SUNRISE Rainbow). The culture medium was also diluted 10-fold and measured in the same manner. After subtracting the measured value of the culture medium from the measured value of the culture broth, the result was multiplied by 10 and taken as the absorbance (OD660) of the culture broth. The results are shown in Figure 1.
[0055] As shown in Figure 1, at both 24 hours and 48 hours, the higher the final concentration of agarooligosaccharide in this culture medium, the smaller the value of absorbance (OD660). That is, agarooligosaccharide inhibited the number of Luminococcus gnavus bacteria in a concentration-dependent manner in this culture medium. From this result, it became clear that agarooligosaccharide can inhibit the growth of the genus Luminococcus.
[0056] (3) Culture in the presence of disaccharides to octasaccharides Agarooligosaccharide was replaced with disaccharide, tetrasaccharide, hexasaccharide or octasaccharide, and Luminococcus gnavus was cultured by the method described in Example 1(1) of this example, and the number of bacteria was measured by the turbidity method described in Example 1(2) of this example. The final concentration in the medium of disaccharides to octasaccharides was 0.2% by mass (2000 μg / mL), and the culture times were 23 hours, 31 hours and 47 hours. As comparative controls, samples with agarooligosaccharide added at the same concentration, and samples without the addition of either agarooligosaccharide or disaccharides to octasaccharides (no addition) were cultured in the same manner and the number of bacteria was measured. The results are shown in Figure 2.
[0057] As shown in Fig. 2, for the samples added with agarooligosaccharides, disaccharides, and tetrasaccharides, regardless of the culture time, the absorbance (OD660) values were significantly lower compared to the sample without addition. For the sample added with hexasaccharides, compared to the sample without addition, the absorbance was significantly lower at culture times of 23 hours and 31 hours, and was also considerably lower at 47 hours. For the sample added with octasaccharides, compared to the sample without addition, the absorbance was significantly lower at a culture time of 23 hours and was also considerably lower at 31 hours. From these results, it was revealed that agarooligosaccharides, agarobiose, agaro - tetrasaccharide, agarooctaose, and agarooctaose can suppress the growth of the genus Luminococcus. Since all of these oligosaccharides have 3,6 - anhydro - L - galactose at the reducing end, it was revealed that 3,6 - anhydro - L - galactose or oligosaccharides having this at the reducing end can suppress the growth of the genus Luminococcus.
[0058] Also, for the disaccharides and tetrasaccharides, no increase in absorbance was observed with the passage of culture time, and the absorbance values were significantly lower at any culture time. From these results, it was revealed that among agarooligosaccharides, agarobiose and agaro - tetrasaccharide have a significantly greater growth - inhibitory effect on the genus Luminococcus.
[0059] <Example 2> Growth - inhibitory effect on Fusobacterium nucleatum (1) Culture in the presence of agarooligosaccharides Ruminococcus gnavus JCM6515 was replaced with Fusobacterium nucleatum JCM8532 (RIKEN BioResource Center, Microbial Materials Development Laboratory (JCM)), and cultured by the method described in Example 1(1). The absorbance of the culture solution was measured by the turbidity method described in Example 1(2). However, the culture time was set to 48 hours. The results are shown in Fig. 3.
[0060] As shown in Fig. 3, the higher the final concentration of agarooligosaccharide in the main culture medium, the smaller the absorbance (OD660) value. That is, agarooligosaccharide suppressed the number of Fusobacterium nucleatum bacteria in a concentration-dependent manner in the main culture medium. From this result, it was revealed that agarooligosaccharide can suppress the growth of the genus Fusobacterium.
[0061] (2) Cultivation in the presence of disaccharide and tetrasaccharide Agarooligosaccharide was replaced with disaccharide and tetrasaccharide, and Fusobacterium nucleatum was cultured by the method described in Example 2(1) of the present invention, and the number of bacteria was measured by the turbidimetry method. The final concentrations of disaccharide and tetrasaccharide in the medium were 0.2% by mass (2000 μg / mL), and the culture times were 23 hours, 31 hours, and 47 hours. As comparative controls, samples added with agarooligosaccharide at the same concentration and samples without addition of any of agarooligosaccharide, disaccharide, and tetrasaccharide (no addition) were cultured in the same manner and the number of bacteria was measured. The results are shown in Fig. 4.
[0062] As shown in Fig. 4, the samples added with disaccharide and tetrasaccharide had significantly smaller absorbance (OD660) values compared to the sample without addition, regardless of the length of the culture time. In particular, for the disaccharide, no increase in absorbance was observed with the passage of the culture time, and the absorbance values were significantly smaller at any culture time. The sample added with agarooligosaccharide also had a significantly smaller absorbance at 23 hours of culture time and was also considerably smaller at 31 hours compared to the sample without addition. From this result, it was revealed that agarooligosaccharide, agarobiose, and agaro - tetrasaccharide can suppress the growth of the genus Fusobacterium. In particular, it was revealed that agarobiose has a significantly large growth inhibitory effect on the genus Fusobacterium.
[0063] In addition, since all of agarooligosaccharide, agarobiose, and agaro - tetrasaccharide have 3,6 - anhydro - L - galactose at the reducing end, it was revealed that 3,6 - anhydro - L - galactose or an oligosaccharide having this at the reducing end can suppress the growth of the genus Fusobacterium.
[0064] <Example 3> Growth inhibitory effect of intestinal bacteria carrying the NanA gene homolog of Ruminococcus gnavus (1) Design of specific primers As homologs of the NanA gene of Ruminococcus gnavus ((a) in Table 1 below), (i) to (te) in Table 1 below were extracted using EMBOSS Matcher (European Bioinformatics Institute (EMBL-EBI) https: / / www.ebi.ac.uk / Tools / psa / emboss_matcher / ).
Table 1
[0065] Subsequently, based on (a) to (e) in Table 1 (SEQ ID NOs: 1 to 4), the following were prepared as specific primers capable of amplifying the NanA genes of Ruminococcus gnavus and the genus Blautia. ≪For amplification of NanA genes of Ruminococcus gnavus and Blautia≫ Forward primer; 5’- ATYCCGGCATTTTATGC -3’ (SEQ ID NO: 20) Reverse primer; 5’- CCRTTTACRTAGACACCYTTTAC -3’ (SEQ ID NO: 21)
[0066] Also, based on (ka) to (ku) in Table 1 (SEQ ID NOs: 6 to 8), the following were prepared as specific primers capable of amplifying the NanA gene of Streptococcus parasanguinis. ≪For amplification of nanA of Streptococcus parasanguinis≫ Forward primer; 5’- GCTTTTTACGCCTGCTATGA -3’ (SEQ ID NO: 22) Reverse primer; 5’- TACATTCGCCRGARGATCCGTT -3’ (SEQ ID NO: 23)
[0067] Based on (c) to (t) (SEQ ID NOS: 10 to 19) in Table 1, the following were prepared as specific primers capable of amplifying the NanA gene of the genus Bacteroides (Bacteroides acidifaciens and Bacteroides caccae). ≪For amplification of nanA of the genus Bacteroides≫ Forward primer; 5’- TTTATCAATGGTTCTTCCGGTGAAGGCTATATG -3’ (SEQ ID NO: 24) Reverse primer; 5’- CCATAGCACCAATCCCCCATGC -3’ (SEQ ID NO: 25)
[0068] (2) Rearing of mice orally administered with agarooligosaccharide Six 14-week-old male accelerated aging model mice (SAMP8) were acclimated and reared for 2 weeks while freely consuming a standard purified diet (“AIN-93M”, CLEA Japan, Inc.). The composition of the diet is shown below. The vitamin mixture and mineral mixture used conformed to AIN-93 (guidelines for standard purified diets for mice and rats published by the American Institute of Nutrition (AIN) in 1993). The rearing conditions were a temperature of 21 ± 2°C, humidity of 50 ± 10%, and a 12-hour light-dark cycle (light period: 8:00 to 20:00). 《Composition of the diet》(unit: mass%) Corn starch: 46.5692, milk casein: 14.0000, pregelatinized corn starch: 15.5000, sucrose: 10.0000, refined soybean oil: 4.0000, crystalline cellulose: 5.0000, mineral mixture: 3.5000, vitamin mixture: 1.0000, L-cystine: 0.1800, choline bitartrate: 0.2500, tertiary butylhydroquinone: 0.0008.
[0069] At 15 weeks of age, the mice were divided into two groups of three each so that there were no significant differences in measured values such as body weight, and designated as the AOS group and the control group. After acclimation breeding, the AOS group was fed a diet with 1% (w / w) agarooligosaccharide added to the standard purified diet, and the control group was fed a diet with 1% (w / w) okara powder added to the standard purified diet. They were bred under the same conditions for 27 weeks (16 - 42 weeks of age) while being allowed to freely consume the respective diets.
[0070] (3) Measurement of the number of bacteria carrying the NanA gene by quantitative PCR The mice in each group of Example 3(2) were dissected under isoflurane anesthesia to remove the cecum, and the cecal contents were collected and stored frozen. Total DNA was extracted from the cecal contents according to the method described in <Shunsuke Takahashi et al., PLosONE, Volume 9, Issue 8, e105592, August 2014: Reference 1>. Specifically, first, 100 mg of thawed cecal contents were suspended in an aqueous solution containing 4 M guanidine thiocyanate, 100 mM Tris HCl (pH 9.0), and 40 mM EDTA, and pulverized with zirconia beads using FastPrep FP100A (MP Biomedicals) to obtain a suspension. DNA was extracted from this suspension using QIAamp DNA stool Mini Kit (QIAGEN), and this was designated as the total cecal content DNA.
[0071] Using the total cecal content DNA as a template, quantitative PCR was performed using the real-time PCR reagent "PowerTrack? SYBR Green Master Mix" (ThermoFisher) and the primers of SEQ ID NOs: 20 - 25 above to determine the DNA copy number of each gene. The annealing temperature was set to 50°C (for the nanA genes of R. gnavus, Blautia, and S. parasanguinis) or 60°C (for the nanA gene of the genus Bacteroides). Since the DNA copy number of each NanA gene can be said to reflect the number of bacteria carrying each NanA gene, the copy number per 1 g of cecal contents was calculated and designated as the "proportion of bacteria carrying the NanA gene". The median value for each group of the proportion of bacteria carrying the NanA gene is shown in Figure 5.
[0072] As shown in Fig. 5, the proportion of bacteria carrying the NanA gene of Luminococcus gnavus and Blautia was 4371 in the control group, while it was 481 in the AOS group. That is, in the mice orally administered with agarooligosaccharide, the proportion of bacteria carrying the NanA gene of Luminococcus gnavus and Blautia in the intestine was smaller than that in the mice not administered with agarooligosaccharide.
[0073] The proportion of bacteria carrying the NanA gene of Streptococcus parasanguinis was 78082 in the control group, while it was 28434 in the AOS group. That is, in the mice orally administered with agarooligosaccharide, the proportion of bacteria carrying the NanA gene of Streptococcus parasanguinis in the intestine was smaller than that in the mice not administered with agarooligosaccharide.
[0074] The proportion of bacteria carrying the NanA gene of the genus Bacteroides was 364355642 in the control group, while it was 159166582 in the AOS group. That is, in the mice orally administered with agarooligosaccharide, the proportion of bacteria carrying the NanA gene of the genus Bacteroides in the intestine was smaller than that in the mice not administered with agarooligosaccharide.
[0075] From these results, it was clarified that agarooligosaccharide, 3,6-anhydro-L-galactose, or an oligosaccharide having this at the reducing end can suppress the number of intestinal bacteria carrying a NanA gene with high sequence identity to the NanA gene of Luminococcus gnavus (SEQ ID NO: 1) in the genomic DNA.
Claims
1. A growth inhibitor for intestinal bacteria that possesses in genomic DNA an N - acetylneuraminic acid lyase gene consisting of a DNA sequence having a sequence identity of 45.6% or more with SEQ ID NO: 1, said agent having an agarooligosaccharide as an active ingredient.
2. The agent according to claim 1, which is used for suppressing the expression of N - acetylneuraminic acid lyase in the intestine.
3. The agent according to claim 1, which is used for suppressing the degradation of intestinal mucin.
4. The agent according to claim 1, which is used for preserving the intestinal barrier function.
5. The agent according to claim 1, wherein the intestinal bacteria belong to the genus Lachnococcus, Fusobacterium, Blautia or Bacteroides.
6. The agent according to claim 1, wherein the agarooligosaccharide is an agarooligosaccharide containing agarobiose.
7. A growth inhibitor for intestinal bacteria that possesses in genomic DNA an N - acetylneuraminic acid lyase gene consisting of a DNA sequence having a sequence identity of 45.6% or more with SEQ ID NO: 1, said agent having 3,6 - anhydro - L - galactose or an oligosaccharide having this at the reducing end as an active ingredient.
Citation Information
Patent Citations
Composition for adjusting enterobacterial flora
JP2017163980A
Use of 3,6-anhydro-l-galactose for preventing dental caries
US20180280272A1
Use of agarobiose or agarooligosaccharide having anticariogenic activity
US20200078383A1
Cited By
Expression inhibitor and expression inhibition method for protein involved in bacterial-type fatty acid synthesis, and agent for altering fatty acid composition of organism and method for altering the same
JP2025124987A