Molecular markers for genotyping of rice and use thereof

By using TaqMan MGB real-time fluorescence quantitative technology and molecular markers, the authenticity and purity of rice can be identified simultaneously, solving the problems of high cost and inability to be applied on a large scale of existing detection methods, and realizing low-cost, high-throughput seed quality monitoring.

CN115386648BActive Publication Date: 2026-03-17CHINA NAT SEED GRP CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-05-25
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

Existing methods for testing the authenticity and purity of rice seeds are costly, time-consuming, and cannot be applied on a large scale, resulting in insufficient seed quality assurance in agricultural production.

Method used

A set of molecular markers and primer probes based on TaqMan MGB real-time fluorescence quantitative technology was developed. By extracting DNA through mixed sampling, the authenticity and purity of rice can be identified simultaneously. Eight polymorphic sites are used to distinguish 256 haplotypes, reducing costs and increasing detection throughput.

Benefits of technology

It enables low-cost, high-throughput detection for simultaneous identification of rice authenticity and purity in breeding and production, and is suitable for large-scale seed monitoring.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003081870500000091
    Figure BDA0003081870500000091
  • Figure BDA0003081870500000101
    Figure BDA0003081870500000101
  • Figure BDA0003081870500000111
    Figure BDA0003081870500000111
Patent Text Reader

Abstract

The present application provides molecular markers, primer pairs, primer probe sets, kits for genotyping of rice, uses thereof for identifying authenticity and / or purity of rice or monitoring seed production or propagation quality of rice and methods of genotyping rice or identifying authenticity and / or purity of rice using the same.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the fields of plant biotechnology and molecular breeding, and more specifically, to a molecular marker for rice genotyping and its application. Background Technology

[0002] The authenticity and purity of seeds are of paramount importance in breeding and production. Seeds that fail to meet authenticity or purity standards have extremely detrimental effects on agricultural production. Therefore, industry standards for seeds have been successively introduced. Standards or patents regarding molecular marker methods include, but are not limited to, "GBT38551-2020 Plant Variety Identification MNP Marker Method," "NYT1433-2014 Rice Variety Identification Technical Specification SSR Marker Method," "DB43 / T 860-2014 Hybrid Rice Seed Authenticity and Purity Identification SSR Molecular Marker Method," SNP marker combinations and their applications for rice germplasm resource and variety identification (patent application number CN110527736A), and a hybrid rice backbone parent detection primer set and its application (patent application number CN111455089A). These standards and methods provide multiple solutions for promoting the compliance of seed authenticity and purity.

[0003] In summary, the methods and standards mentioned above all suffer from drawbacks such as high cost, long processing time, or limited scale. Furthermore, authenticity and purity testing are conducted separately. For example, the cost of either authenticity or purity testing services currently ranges from several hundred to several thousand yuan, and the combined cost of both tests is even higher. Moreover, purity testing is performed on a single seed basis, limiting its scale. Breeding and seed production, in both cases, are large-scale endeavors, and existing testing standards or methods are too expensive to be applied to large-scale seed authenticity and purity monitoring in breeding or production. Therefore, agricultural production has inherent shortcomings in seed quality assurance. In breeding practice, existing testing standards or methods cannot be scaled up with current resources. Summary of the Invention

[0004] To enable molecular detection methods to contribute to breeding and production practices, this application develops a set of molecular markers for simultaneously identifying the authenticity and purity of rice. In a breeding population based on over 100 materials, theoretically, single nucleotide polymorphisms (SNPs) at 8 polymorphic sites can distinguish 256 haplotypes. Using TaqMan MGB real-time fluorescence quantitative PCR technology, DNA is extracted through sample pooling for detection, simultaneously identifying authenticity and purity, achieving the dual advantages of reduced cost and increased throughput.

[0005] This application provides the following technical solution:

[0006] In a first aspect, this application provides molecular markers for rice genotyping, including one or more of the following: R0110660585GA, R0208905316CT, F0332735670GA, R0402280679AG, R0625755443GA, F0920800632TC, R1016406260GA, and F1107700914GA.

[0007] In a second aspect, this application provides a primer-probe set for rice genotyping, said primer-probe set being selected from one or more of the following groups:

[0008] The primer pair shown in SEQ ID NO. 1-2 and the two probes shown in SEQ ID NO. 3-4;

[0009] The primer pairs shown in SEQ ID NO.5-6 and the two probes shown in SEQ ID NO.7-8;

[0010] The primer pairs shown in SEQ ID NO. 9-10 and the two probes shown in SEQ ID NO. 11-12;

[0011] The primer pair shown in SEQ ID NO. 13-14 and the two probes shown in SEQ ID NO. 15-16;

[0012] The primer pairs shown in SEQ ID NO.17-18 and the two probes shown in SEQ ID NO.19-20;

[0013] The primer pairs shown in SEQ ID NO.21-22 and the two probes shown in SEQ ID NO.23-24;

[0014] The primer pairs shown in SEQ ID NO.25-26 and the two probes shown in SEQ ID NO.27-28 and / or the primer pairs shown in SEQ ID NO.29-30 and the two probes shown in SEQ ID NO.31-32.

[0015] In a third aspect, this application provides primer pairs for rice genotyping, wherein the primer pairs are selected from primer pairs capable of amplifying one or more of the following: R0110660585GA, R0208905316CT, F0332735670GA, R0402280679AG, R0625755443GA, F0920800632TC, R1016406260GA, and F1107700914GA.

[0016] In a fourth aspect, this application provides probes for rice genotyping, said probes being selected from probes capable of detecting one or more of R0110660585GA, R0208905316CT, F0332735670GA, R0402280679AG, R0625755443GA, F0920800632TC, R1016406260GA, and F1107700914GA.

[0017] In a fifth aspect, this application provides a kit for rice genotyping, comprising primer pairs selected from those capable of amplifying one or more of R0110660585GA, R0208905316CT, F0332735670GA, R0402280679AG, R0625755443GA, F0920800632TC, R1016406260GA, and F1107700914GA, and / or probes selected from those capable of detecting one or more of R0110660585GA, R0208905316CT, F0332735670GA, R0402280679AG, R0625755443GA, F0920800632TC, R1016406260GA, and F1107700914GA.

[0018] In a sixth aspect, this application provides the use of the molecular markers described in the first aspect, the primer-probe sets described in the second aspect, the primer pairs described in the third aspect, the probes described in the fourth aspect, or the kits described in the fifth aspect for identifying the authenticity and / or purity of rice.

[0019] In a seventh aspect, this application provides the use of the molecular markers described in the first aspect, the primer-probe sets described in the second aspect, the primer pairs described in the third aspect, the probes described in the fourth aspect, or the kits described in the fifth aspect for monitoring the quality of rice seed production or propagation.

[0020] In an eighth aspect, this application provides a method for rice genotyping, which includes identifying the genotype of the molecular marker described in the first aspect or identifying the genotype of the molecular marker described in the first aspect using the primer-probe set described in the second aspect, the primer pair described in the third aspect, the probe described in the fourth aspect, or the kit described in the fifth aspect.

[0021] In a ninth aspect, this application provides a method for identifying the authenticity and / or purity of rice, comprising identifying the genotype of the molecular marker described in the first aspect or identifying the genotype of the molecular marker described in the first aspect using the primer-probe set described in the second aspect, the primer pair described in the third aspect, the probe described in the fourth aspect, or the kit described in the fifth aspect, and

[0022] The results are compared with the corresponding genotypes of the reference samples to determine the authenticity and / or purity of the rice.

[0023] The solution provided in this application has established a rigorous experimental plan. Through screening, comparison, and testing, the expected results have been achieved in practical application. Attached Figure Description

[0024] Figure 1 The image shows the different types of Illumina chip typing results. Type A features concentrated clustering of similar typing types with large distances between different types and few anomalous typing sites. Type B features relatively concentrated clustering of similar typing types with large distances between different types and few anomalous typing sites. Type C features dispersed clustering of similar typing types with distances between different types and anomalous typing sites. Type F features dispersed clustering of similar typing types with small distances between different types and many anomalous typing sites.

[0025] Figure 2 The experiment demonstrated the use of a DNA sample with an already tested chip to perform genotyping of eight molecular markers.

[0026] Figures 3A-3D The genotyping results for standard homozygous, heterozygous, and reference samples with known mixing ratios of eight molecular markers are shown. Figures 3A-3D The diagram shows the integration of genotypes from 30 samples mixed according to genotype ratios into the marker reference genotype.

[0027] Figure 4 The results of genotyping of 198 rice parents or near-stable lines without duplicate samples were shown using eight molecular markers.

[0028] Detailed description of the invention

[0029] definition

[0030] As used in this article, "single nucleotide polymorphism" (SNP), "SNP marker," or "SNP site" refers to a nucleotide sequence variation present in the genomic sequence of a chromosome. This variation, based on differences in nucleotide sequences (changes in a single nucleotide—A, T, C, or G), results in chromosomal genome diversity, allowing different alleles (e.g., alleles from two different individuals) or different individuals to be distinguished from each other. This variation can occur within coding or non-coding regions of a gene (e.g., promoter regions or their vicinity, or introns) or between genes.

[0031] The term “allelic gene” as used in this article refers to different forms of the same gene present at a given locus on homologous chromosomes.

[0032] The term "minor allele frequency" used in this article refers to the frequency of occurrence of an uncommon allele in a given population. A higher value indicates a greater likelihood of polymorphism between any two varieties.

[0033] As used herein, the term "SNP chip" or "chip" refers to a biochip that analyzes the presence of SNPs in a sample's DNA by arranging and attaching hundreds to hundreds of thousands of biomolecules as probes. These biomolecules, such as DNA with known sequences, DNA fragments, cDNA, oligonucleotides, RNA, or RNA fragments, are immobilized at specific intervals on small solid substrates made of glass, silicon, or nylon. Depending on the degree of complementarity, hybridization occurs between the nucleic acids in the sample and the probes immobilized on the surface. By detecting and judging the hybridization, information about the substances contained in the sample can be obtained simultaneously.

[0034] The main types of DNA chips currently available include: in-situ synthesis, which uses modified oligonucleotide monomers to synthesize spatially combined probe sequences stepwise in situ to form a DNA chip, thereby directly synthesizing an oligonucleotide probe array on a rigid surface; off-sheet synthesis, which involves using a spotting method to spot pre-synthesized probe sequences onto specific sites to form a DNA chip, thereby forming a DNA probe array immobilized on a glass substrate; and microbead synthesis, which involves directly synthesizing DNA probes on encoded microbeads, or immobilizing pre-prepared probe sequences onto encoded microbeads, and then arbitrarily assembling them to form a microbead chip.

[0035] The term "molecular markers" or "polymorphic sites" used in this document refers to genetic markers based on nucleotide sequence variations within the genetic material of individuals, directly reflecting genetic polymorphism at the DNA level. Compared with other types of genetic markers—morphological markers, biochemical markers, and cytological markers—DNA molecular markers have advantages including, but not limited to: most molecular markers are co-dominant, making selection for recessive traits very convenient; genomic variation is extremely rich, and the number of molecular markers is almost unlimited; DNA from different tissues at different stages of biological development can be used for marker analysis; molecular markers reveal variations originating from DNA; they are neutral, do not affect the expression of the target trait, and are not linked to undesirable traits; and detection methods are simple and rapid. With the development of molecular biology techniques, dozens of DNA molecular marker technologies have been developed and are widely used in genetic breeding, genome mapping, gene localization, species kinship identification, gene bank construction, and gene cloning. In the context of this application, molecular markers generally refer to SNP markers.

[0036] The term "TaqMan fluorescent probe" used in this article refers to a specific fluorescent probe added simultaneously with a pair of primers during PCR amplification. This probe is an oligonucleotide labeled with a reporter fluorescent group and a quencher fluorescent group at each end. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group. During PCR amplification, the 5′–3′ exonuclease activity of Taq polymerase cleaves and degrades the probe, separating the reporter and quencher fluorescent groups. This allows the fluorescence monitoring system to receive the fluorescent signal; that is, for each DNA strand amplified, one fluorescent molecule is formed, achieving complete synchronization between the accumulation of the fluorescence signal and the formation of the PCR product. The novel TaqMan-MGB probe enables this technology to perform both quantitative gene analysis and SNP analysis, making it a promising platform for gene diagnostics and personalized medicine analysis.

[0037] The term "authenticity" used in this article refers to the species attributes of an organism, especially rice.

[0038] As used herein, the term "purity" in the context of this application refers to the content of the target seed in a batch of seeds, particularly rice seeds. Detailed Implementation

[0039] To achieve the objectives of this application, this application first compared microarray data from over 900 rice parent lines, covering 151 rice parents or resource lines, to screen for polymorphic loci that could distinguish between the 151 rice parents or resource lines. A total of eight polymorphic loci distributed on different chromosomes were obtained that could completely distinguish the 151 rice parents or resource lines. Subsequently, primers and probes capable of detecting these eight polymorphic loci were developed. Using these developed primers and probes, the authenticity and purity of rice can be simultaneously identified.

[0040] Specifically, this application provides the following technical solution.

[0041] In a first aspect, this application provides molecular markers for rice genotyping, including one or more of the following: R0110660585GA, R0208905316CT, F0332735670GA, R0402280679AG, R0625755443GA, F0920800632TC, R1016406260GA, and F1107700914GA.

[0042] In a second aspect, this application provides a primer-probe set for rice genotyping, said primer-probe set being selected from one or more of the following groups:

[0043] The primer pair shown in SEQ ID NO. 1-2 and the two probes shown in SEQ ID NO. 3-4;

[0044] The primer pairs shown in SEQ ID NO.5-6 and the two probes shown in SEQ ID NO.7-8;

[0045] The primer pairs shown in SEQ ID NO. 9-10 and the two probes shown in SEQ ID NO. 11-12;

[0046] The primer pair shown in SEQ ID NO. 13-14 and the two probes shown in SEQ ID NO. 15-16;

[0047] The primer pairs shown in SEQ ID NO.17-18 and the two probes shown in SEQ ID NO.19-20;

[0048] The primer pairs shown in SEQ ID NO.21-22 and the two probes shown in SEQ ID NO.23-24;

[0049] The primer pairs shown in SEQ ID NO.25-26 and the two probes shown in SEQ ID NO.27-28 and / or the primer pairs shown in SEQ ID NO.29-30 and the two probes shown in SEQ ID NO.31-32.

[0050] In a third aspect, this application provides primer pairs for rice genotyping, wherein the primer pairs are selected from primer pairs capable of amplifying one or more of the following: R0110660585GA, R0208905316CT, F0332735670GA, R0402280679AG, R0625755443GA, F0920800632TC, R1016406260GA, and F1107700914GA.

[0051] In some implementations, the primers are selected from one or more of the following pairs:

[0052] R0110660585GA:SEQ ID NO.1-2;

[0053] R0208905316CT: SEQ ID NO.5-6;

[0054] F0332735670GA:SEQ ID NO.9-10;

[0055] R0402280679AG: SEQ ID NO.13-14;

[0056] R0625755443GA: SEQ ID NO.17-18;

[0057] F0920800632TC: SEQ ID NO.21-22;

[0058] R1016406260GA: SEQ ID NO.25-26 and / or

[0059] F1107700914GA: SEQ ID NO. 29-30.

[0060] In a fourth aspect, this application provides probes for rice genotyping, said probes being selected from probes capable of detecting one or more of R0110660585GA, R0208905316CT, F0332735670GA, R0402280679AG, R0625755443GA, F0920800632TC, R1016406260GA, and F1107700914GA.

[0061] In some implementations, the probe is selected from one or more of the following:

[0062] R0110660585GA:SEQ ID NO.3-4;

[0063] R0208905316CT: SEQ ID NO.7-8;

[0064] F0332735670GA:SEQ ID NO.11-12;

[0065] R0402280679AG: SEQ ID NO.15-16;

[0066] R0625755443GA:SEQ ID NO.19-20;

[0067] F0920800632TC: SEQ ID NO.23-24;

[0068] R1016406260GA: SEQ ID NO.27-28 and / or

[0069] F1107700914GA: SEQ ID NO. 31-32.

[0070] In a fifth aspect, this application provides a kit for rice genotyping, comprising primer pairs selected from those capable of amplifying one or more of R0110660585GA, R0208905316CT, F0332735670GA, R0402280679AG, R0625755443GA, F0920800632TC, R1016406260GA, and F1107700914GA, and / or probes selected from those capable of detecting one or more of R0110660585GA, R0208905316CT, F0332735670GA, R0402280679AG, R0625755443GA, F0920800632TC, R1016406260GA, and F1107700914GA.

[0071] In some implementations, the primers are selected from one or more of the following pairs:

[0072] R0110660585GA:SEQ ID NO.1-2;

[0073] R0208905316CT: SEQ ID NO.5-6;

[0074] F0332735670GA:SEQ ID NO.9-10;

[0075] R0402280679AG: SEQ ID NO.13-14;

[0076] R0625755443GA: SEQ ID NO.17-18;

[0077] F0920800632TC: SEQ ID NO.21-22;

[0078] R1016406260GA: SEQ ID NO.25-26 and / or

[0079] F1107700914GA: SEQ ID NO. 29-30.

[0080] In some implementations, the probe is selected from one or more of the following:

[0081] R0110660585GA:SEQ ID NO.3-4;

[0082] R0208905316CT: SEQ ID NO.7-8;

[0083] F0332735670GA:SEQ ID NO.11-12;

[0084] R0402280679AG: SEQ ID NO.15-16;

[0085] R0625755443GA:SEQ ID NO.19-20;

[0086] F0920800632TC: SEQ ID NO.23-24;

[0087] R1016406260GA: SEQ ID NO.27-28 and / or

[0088] F1107700914GA: SEQ ID NO. 31-32.

[0089] Preferably, the probe is a TaqMan probe, and more preferably, the probe is a TaqMan-MGB probe.

[0090] In some embodiments, the kit further includes other reagents for real-time quantitative PCR, including but not limited to DNA polymerase, preferably high-fidelity DNA polymerase, buffer, dNTPs, etc. Real-time quantitative PCR can be performed using commercially available real-time quantitative PCR kits. Those skilled in the art can select suitable kits as needed.

[0091] In a sixth aspect, this application provides the use of the molecular markers described in the first aspect, the primer-probe sets described in the second aspect, the primer pairs described in the third aspect, the probes described in the fourth aspect, or the kits described in the fifth aspect for identifying the authenticity and / or purity of rice.

[0092] In a seventh aspect, this application provides the use of the molecular markers described in the first aspect, the primer-probe sets described in the second aspect, the primer pairs described in the third aspect, the probes described in the fourth aspect, or the kits described in the fifth aspect for monitoring the quality of rice seed production or propagation.

[0093] In an eighth aspect, this application provides a method for rice genotyping, which includes identifying the genotype of the molecular marker described in the first aspect or identifying the genotype of the molecular marker described in the first aspect using the primer-probe set described in the second aspect, the primer pair described in the third aspect, the probe described in the fourth aspect, or the kit described in the fifth aspect.

[0094] In a ninth aspect, this application provides a method for identifying the authenticity and / or purity of rice, comprising identifying the genotype of the molecular marker described in the first aspect or identifying the genotype of the molecular marker described in the first aspect using the primer-probe set described in the second aspect, the primer pair described in the third aspect, the probe described in the fourth aspect, or the kit described in the fifth aspect, and

[0095] The results are compared with the corresponding genotypes of the reference samples to determine the authenticity and / or purity of the rice.

[0096] Example

[0097] The following examples are used to illustrate this application, but are not intended to limit the scope of this application. Unless otherwise specified, the examples are carried out under conventional experimental conditions or under the conditions recommended in the manufacturer's instructions.

[0098] Example 1: Identification of polymorphic sites in 1151 rice parent haplotypes, and design, synthesis, and testing of marker sequences.

[0099] Identification of polymorphic sites in rice parent haplotypes

[0100] The first round of screening: 151 existing key inbred lines or key germplasm resources (parents) were selected (see Table 1). Using the genotype data of existing microarrays, the genotype data of other suitable parent samples that have been tested on microarrays were also selected (the sample types must not be multiple single plants or multiple grains mixed). A total of more than 900 parent genotype datasets including the 151 materials were screened.

[0101] Table 1. Haplotype information of 151 rice parents

[0102]

[0103]

[0104]

[0105]

[0106] Note: Hom1 refers to homozygous genotype 1, and Hom2 refers to homozygous genotype 2.

[0107] For R0110660585GA, Hom1 is AA and Hom2 is GG;

[0108] For R0208905316CT, Hom1 is TT and Hom2 is CC;

[0109] For F0332735670GA, Hom1 is GG and Hom2 is AA;

[0110] For R0402280679AG, Hom1 is AA and Hom2 is GG;

[0111] For R0625755443GA, Hom1 is GG and Hom2 is AA;

[0112] For F0920800632TC, Hom1 is CC and Hom2 is TT;

[0113] For R1016406260GA, Hom1 is AA, and Hom2 is GG; and

[0114] For F1107700914GA, Hom1 is GG and Hom2 is AA.

[0115] Second round of screening: In order to distinguish more existing materials, the paternal and maternal parent types were differentiated. Polymorphic sites with a MAF (minimum allele frequency) of 33.3% or higher were selected from both paternal and maternal parent types, and the intersection was calculated to obtain 448 polymorphic sites that met the requirements.

[0116] The third round of screening involved examining the genotyping results using Illumina Studio software. A total of 9557 samples (provided they were not mixed samples) were analyzed to determine the genotyping effectiveness and categorized into four main types: Type A: clustered similar genotypes with large intervals between different types and few anomalous genotypes; Type B: relatively clustered similar genotypes with large intervals between different types and few anomalous genotypes; Type C: dispersed clusters of similar genotypes with intervals between different types and anomalous genotypes; Type F: dispersed clusters of similar genotypes with small intervals between different types and many anomalous genotypes. Finally, 36 polymorphic sites were identified in Type A and 145 polymorphic sites in Type B, totaling 181 polymorphic sites. (See...) Figure 1 .

[0117] The fourth round of screening: Based on the different chromosome distributions and the selection of polymorphic sites with large mean values ​​and small coefficients of variation in the paternal and maternal lines, eight sites (i.e. SNPs) were finally identified, as shown in Table 2.

[0118] Table 2. Chromosomal coordinates of the eight polymorphic loci and allele frequency distribution in over 900 paternal and maternal parent materials.

[0119]

[0120] Note: 1. The names in Table 2 are coordinate codes from the MSU6 version.

[0121] 2. AA refers to one homozygous genotype, BB refers to another homozygous genotype, AB is a heterozygous genotype, and NC indicates an undetermined genotype category.

[0122] For R0110660585GA, AA is AA, BB is GG, and AB is GA;

[0123] For R0208905316CT, AA represents TT, BB represents CC, and AB represents CT;

[0124] For F0332735670GA, AA is GG, BB is AA, and AB is GA;

[0125] For R0402280679AG, AA is AA, BB is GG, and AB is AG;

[0126] For R0625755443GA, AA is GG, BB is AA, and AB is GA;

[0127] For F0920800632TC, AA is CC, BB is TT, and AB is TC;

[0128] For R1016406260GA, AA is AA, BB is GG, and AB is GA; and

[0129] For F1107700914GA, AA is GG, BB is AA, and AB is GA.

[0130] 3. chr refers to chromosome.

[0131] Design of probe primer sequences

[0132] Using the TaqMan MGB Allelic Discrimination module of Primer Express V3.0.1 software, 201 bp of nucleic acid sequences (100 bp upstream and downstream of the polymorphic site) were used as reference sequences for marker primers and probes, while avoiding other polymorphic sites near the sequence (see Table 3). If the software displayed recommended primer and probe sequences, suitable probe and primer sequences were selected as candidates; otherwise, the nucleic acid sequence provided as a reference design was converted into a reverse complementary sequence, and the design was attempted again. If a suitable probe and primer sequence could still not be recommended, the marker sequence design for that polymorphic site was considered unsuccessful. If multiple primer and probe sequences were recommended for a single sequence, the primer and probe sequence with the lowest penalty score among the software recommendations was selected.

[0133] Table 3. Other variant sites upstream and downstream of the 8 polymorphic sites and their allele frequencies

[0134]

[0135] Note: Refer to MSU6.1, provided by Ricevarmap.

[0136] Eight successfully genotyped primer-probe combinations were obtained. Each combination consists of a pair of primers and two TaqMan-MGB probes, with sequences shown in SEQ ID NO. 1-32 (each combination consists of four sequences starting from SEQ ID NO. 1-32), as detailed in Table 4. The 32 sequences (SEQ ID No. 1-SEQ ID No. 32) of the eight molecular markers obtained above were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0137] Table 4. Sequences of probes and primers targeting the eight polymorphic sites.

[0138] SEQ ID NO.1 F1QR01 forward primer GACTTCCTCGCCAATTACACTAAAC

[0139] SEQ ID NO.2 F1QR01 Reverse primer GTGGAAATACTCTCTCATGGACAAGA

[0140] SEQ ID NO.3 F1QR01 TaqMan MGB probe 1ATAATTAGTTTCTAGTGATCGGA

[0141] SEQ ID NO.4 F1QR01 TaqMan MGB probe 2 ATTAGTTTCTAGCGATCGGA

[0142] SEQ ID NO.5 F1QR02 forward primer ATGCGTACATGCTCCTGAGTAACA

[0143] SEQ ID NO.6 F1QR02 reverse primer TCATAACGGGTCAGGTCTATATAATAGG

[0144] SEQ ID NO.7 F1QR02 TaqMan MGB probe 1 GTCATTCTACCCTGTCC

[0145] SEQ ID NO.8 F1QR02 TaqMan MGB probe 2 GTCATTCTACCCCGTCC

[0146] SEQ ID NO.9 F1QR03 forward primer TTATCAGGGTTTTTGCGTTATCG

[0147] SEQ ID NO.10 F1QR03 Reverse primer TGTTACGCGTTGAGAACCGTTA

[0148] SEQ ID NO.11 F1QR03 TaqMan MGB probe 1 TGTTATCAATGGGCACCT

[0149] SEQ ID NO.12 F1QR03 TaqMan MGB probe 2 GTTATCAATGAGCACCT

[0150] SEQ ID NO.13 F1QR04 forward primer CACTAGCTACCTCCTCCAAATTGT

[0151] SEQ ID NO.14 F1QR04 Reverse primer ACAGCCACAGTTCATCTATCCTAA

[0152] SEQ ID NO.15 F1QR04 TaqMan MGB probe 1 GGAATTGTTGTGCTTAA

[0153] SEQ ID NO.16 F1QR04 TaqMan MGB probe 2 AATTGTTGCGCTTAA

[0154] SEQ ID NO.17 F1QR05 forward primer CCCTAGAAAAATGCAAGTAGCAA

[0155] SEQ ID NO.18 F1QR05 Reverse primer CTCATATGTGCCACTTGAAAATG

[0156] SEQ ID NO.19 F1QR05 TaqMan MGB probe 1 CTGAAAAGGCAGAAGT

[0157] SEQ ID NO.20 F1QR05 TaqMan MGB probe 2 ACTGAAAAGGTAGAAGT

[0158] SEQ ID NO.21 F1QR06 forward primer AGAGAGACACCATTCACAAAGTTAGAT

[0159] SEQ ID NO.22 F1QR06 reverse primer CATGGTTTTCACAATTGGATTT

[0160] SEQ ID NO.23 F1QR06 TaqMan MGB probe 1 CGGGATCGACATTC

[0161] SEQ ID NO.24 F1QR06 TaqMan MGB probe 2 ACGGGATTGACATTC

[0162] SEQ ID NO.25 F1QR07 forward primer CAGCATAGGACATACCCTACAAA

[0163] SEQ ID NO.26 F1QR07 Reverse primer CTAAACGACAACCAGTGTACCACTA

[0164] SEQ ID NO.27 F1QR07 TaqMan MGB probe 1ACAGTCAAGTTTATATTT

[0165] SEQ ID NO.28 F1QR07 TaqMan MGB probe 2 ACAGTCAAGTCTATATTT

[0166] SEQ ID NO.29 F1QR08 forward primer TGATGTTTGTTCTACCAGGCTCTAGA

[0167] SEQ ID NO.30 F1QR08 Reverse primer CGCCTCAGGTTTTTAGGTATGG

[0168] SEQ ID NO.31 F1QR08 TaqMan MGB probe 1 TTGATTGGGATCTTTC

[0169] EQ ID NO.32 F1QR08 TaqMan MGB probe 2 TTGATTGGAATCTTTC

[0170] Example 2: Verification of the effectiveness of the aforementioned eight molecular markers in verifying the authenticity and purity of rice.

[0171] To verify the authenticity and purity of the simultaneous identification of rice parents and hybrids using eight molecular markers, it is necessary to test the actual detection and genotyping effects of the primer-probe combination. A minimum number of samples (no fewer than eight) representing each genotype were used in the experiment. The consistency between the genotypes of the reference samples and the genotypes detected was compared to determine whether the primer-probe combination achieved the expected detection effect. The specific operating steps of this embodiment are as follows:

[0172] 1. Extraction of genomic DNA from rice leaves:

[0173] Genomic DNA was extracted from rice leaf tissue according to the testing requirements. The DNA extraction from young rice leaves was performed using the standard procedure of the Kangwei Plant Genome Extraction Kit.

[0174] 2. DNA sample quality testing:

[0175] The levels of protein and organic contamination in genomic DNA were measured using a Nanodrop spectrophotometer. The A260 / 280 ratio of genomic DNA should be between 1.8 and 2.0, and the A260 / 230 ratio should be between 1.8 and 2.2. The concentration of the DNA working solution was 10 ng / μl.

[0176] 3. Genotyping:

[0177] Follow the standard operating procedures provided on the Life Technologies website (http: / / tools.lifetechnologies.com / content / sfs / manuals / 4478673.pdf) to generate the original genotype data of the test sample, that is, the genotype of the sample at a specific locus, such as homozygote hom1 (corresponding to genotype AA, TT, CC, or GG), homozygote hom2 (corresponding to genotype TT, AA, GG, or CC), standard heterozygote het (corresponding to genotype AG, TC, AT, AC, TG, or CG), mixed (Un), or no amplified hybridization signal (Un).

[0178] 4. Data Analysis:

[0179] The QuantStudio 12K Flex Real-Time PCR System's built-in analysis software, referencing custom-constructed genotyping intervals, based on... Figure 3A -D shows the method for interpreting and classifying the detection effect of molecular markers: (a) homozygous hom1 (corresponding to genotypes AA, TT, CC, or GG); (b) homozygous hom2 (corresponding to genotypes TT, AA, GG, or CC); (c) standard heterozygous het (corresponding to genotypes AG, TC, AT, AC, TG, or CG); (d) mixed (Un); (e) no amplification signal (Un).

[0180] 5. Result Comparison – Comparison of Genotype Testing Results with Actual Genotypes:

[0181] The actual reference genotype is the genotype obtained by detecting the sample's DNA using an Illumina microarray. The genotyping results obtained following the four steps described above are compared with the actual reference genotype; the results can be found in [link to relevant documentation]. Figure 2 .

[0182] 6. Conclusion

[0183] Judgment principle: Those with a genotype completely identical to the reference genotype are judged as the same or very similar varieties; those with a genotype inconsistent with the reference genotype are judged as different or impure varieties. Through the above 5 steps, the results show that the genotype detection results of the two methods are completely consistent for the tested materials. This result indicates that the 8 sets of primer and probe sets can reliably perform genotyping, providing reliable results for authenticity and purity determination.

[0184] Example 3: Construction of the genotyping reference file for the aforementioned 8 molecular markers

[0185] To simultaneously identify authenticity and purity, reference standard samples with acceptable purity and different mixing ratios were established. To this end, methods were employed, including single-plant sampling and proportional mixing of known genotype samples, to establish standard samples with acceptable purity and different purities. These served as the reference for purity differentiation, thereby enabling the construction of a clustering and genotyping reference document.

[0186] The specific operating steps are as follows:

[0187] Construction of a genotyping reference file for samples with acceptable purity. A clustering file for marker genotyping was constructed using over 2200 samples from single plants. The process involved selecting F2 generation seeds harvested during 48 combination mating tests (specific types are shown in Table 5), soaking, germinating, and sowing 42 or 48 seeds in seedling trays for seedling cultivation. Leaf samples were taken at 7-10 days of seedling age. To ensure equal leaf quantity, a 3mm sampler was used, and samples of the same area were selected from each individual plant. DNA was extracted using the Kangwei reagent kit, and the DNA quality met the requirements for PCR detection. Marker detection was performed according to the genotyping method mentioned in Example 2 to establish a genotyping reference file for samples with acceptable purity.

[0188] Construction of genotyping reference files for samples with varying degrees of contamination. Leaf samples with known genotypes were mixed by area, specifically ten leaves per stack, with three stacks constituting one mixed sample. See Table 6 for the specific mixing scheme. DNA was extracted using the Kangwei reagent kit, ensuring DNA quality met PCR detection requirements. Label detection was performed according to the genotyping method mentioned in Example 2 to establish genotyping reference files for samples with varying degrees of contamination.

[0189] Table 5. List of 48 combination fits

[0190]

[0191]

[0192] Table 6. Specific operating procedures for mixing 30 samples according to genotype ratio

[0193]

[0194]

[0195] Remark: a Each plant has the same area.

[0196] The genotyping results were displayed using an XY scatter plot generated by Excel. As shown in Figure 3, most molecular markers could distinguish 10% of samples mixed with another homozygous type (except for one side of F1QR03 and F1QR07), and all could distinguish 20% of samples mixed with another homozygous type. This result indicates that by mixing equal amounts of leaf samples and performing two replicates on a single DNA sample, it is possible to identify the authenticity of the variety while simultaneously identifying the vast majority of samples with a purity below 90%. In other words, a single mixed rice leaf tissue sample can simultaneously identify authenticity and purity.

[0197] The specific determination method is as follows: First, determine whether the genotype falls within the standard range for homozygous or heterozygous genotypes. If both fall within the standard range, assign AA (hom1), AB (het), or BB (hom2). If not, classify it as Un. Second, if any Un genotype is found, classify it as a different or impure variety. If all genotypes are one of AA (hom1), AB (het), or BB (hom2), compare the genotypes of the test sample and the reference sample. If the genotypes match, classify them as the same or very similar varieties; if they do not match, classify them as different varieties.

[0198] Example 4: Application of the aforementioned 8 molecular markers in the detection of authenticity and purity of 198 near-stable lines from 151 haplotypes and high-generation crosses bred through self-pollination.

[0199] To test the practical effectiveness of eight molecular markers in determining authenticity and purity during the propagation of parental and high-generation near-stable lines, 38 parental or stable resource materials and 160 high-generation lines from their cross-pollination progeny were collected. These were seeds harvested in 2018. Leaf samples were collected from plants planted in the field in 2019. After quantitative sampling using a sampler, DNA samples of acceptable quality were obtained using the Kangwei Plant DNA Extraction Kit. Genotyping results were obtained through genotyping using the aforementioned eight molecular markers. (See [link to relevant documentation]). Figure 4 See Table 7.

[0200] Table 7. Genotypic information of 198 rice parents or near-stable lines detected by eight molecular markers.

[0201]

[0202]

[0203]

[0204]

[0205]

[0206] Note: Hom1 refers to homozygous genotype 1, and Hom2 refers to homozygous genotype 2.

[0207] For F1QR01, Hom1 is AA and Hom2 is GG;

[0208] For F1QR02, Hom1 is TT and Hom2 is CC;

[0209] For F1QR03, Hom1 is GG and Hom2 is AA;

[0210] For F1QR04, Hom1 is AA and Hom2 is GG;

[0211] For F1QR05, Hom1 is GG and Hom2 is AA;

[0212] For F1QR06, Hom1 is CC and Hom2 is TT;

[0213] For F1QR07, Hom1 is AA, Hom2 is GG; and

[0214] For F1QR08, Hom1 is GG and Hom2 is AA.

[0215] The results showed that among the 38 parental or stable resource materials, 7 (18.42%) had a genotype of Un or different from the genotype detected by the microarray, and were therefore identified as different or impure varieties. Among the 160 unstable high-generation lines obtained from hybridization between the above materials, 61 (38.13%) had a genotype of Un or different from the genotype detected by the microarray. The proportion of different or impure varieties between stable and unstable lines met expectations, providing strong support for the effectiveness of the above markers in identifying the authenticity and purity of rice seeds.

[0216] The results indicate that these eight molecular markers can help monitor abnormal events that occur during rice seed propagation, and make a positive contribution to ensuring the quality of seed propagation.

[0217] Example 5: Application of the aforementioned 8 molecular markers in the determination of authenticity and purity of 66 F1 ligands

[0218] To test the practical effectiveness of eight molecular markers in determining authenticity and purity during testcross seed production, 66 F1 seeds were collected. These seeds were harvested in 2018, and leaf samples were collected from the plants planted in the field in 2019. After quantitative sampling using a sampler, DNA samples of acceptable quality were obtained using the Kangwei Plant DNA Extraction Kit. Genotyping results were obtained through genotyping of the aforementioned eight markers, as shown in Tables 8 and 9.

[0219] The results showed that among the 66 F1 seeds, 25 (37.88%) had a genotype of Un or a genotype different from the one previously detected by the microarray and were therefore classified as different or impure varieties. To determine the effectiveness of the implementation, field results were examined on the above 66 samples. It was found that the degree of mixing in the plots classified as different or impure varieties was significantly higher than that in the plots classified as the same or very similar varieties. The morphological changes were mainly manifested as uneven height, inconsistent color, or differences in whether the variety had awns or not, indicating obvious mixing (results not shown). The field results confirmed the effectiveness of the eight markers in determining the authenticity and purity of the results.

[0220] The results indicate that these eight molecular markers can help monitor abnormal events that occur during rice seed production, and make a positive contribution to ensuring the quality of seed production.

[0221] Although this application has been described in detail above with general descriptions and specific embodiments, some modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, such modifications or improvements made without departing from the spirit of this application are all within the scope of protection claimed in this application.

[0222]

[0223]

[0224]

[0225]

[0226]

[0227] sequence list <110> China Seed Group Co., Ltd. <120> Molecular markers for rice genotyping and their applications <160> 32 <170> SIPOSequenceListing 1.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <400> 1 gacttcctcg ccaattacac taaac 25 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <400> 2 gtggaaatac tctctcatgg acaaga 26 <210> 3 <211> twenty three <212> DNA <213> Artificial Sequence <400> 3 ataattagtt tctagtgatc gga 23 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 attagtttct agcgatcgga 20 <210> 5 <211> twenty four <212> DNA <213> Artificial Sequence <400> 5 atgcgtacat gctcctgagt aaca 24 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <400> 6 tcataacggg tcaggtctat ataatagg 28 <210> 7 <211> 17 <212> DNA <213> Artificial Sequence <400> 7 gtcattctac cctgtcc 17 <210> 8 <211> 17 <212> DNA <213> Artificial Sequence <400> 8 gtcattctac cccgtcc 17 <210> 9 <211> twenty three <212> DNA <213> Artificial Sequence <400> 9 ttatcagggt ttttgcgtta tcg 23 <210> 10 <211> twenty two <212> DNA <213> Artificial Sequence <400> 10 tgttacgcgt tgagaaccgt ta 22 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <400> 11 tgttatcaat gggcacct 18 <210> 12 <211> 17 <212> DNA <213> Artificial Sequence <400> 12 gttatcaatg agcacct 17 <210> 13 <211> twenty four <212> DNA <213> Artificial Sequence <400> 13 cactagctac ctcctccaaa ttgt 24 <210> 14 <211> twenty four <212> DNA <213> Artificial Sequence <400> 14 acagccacag ttcatctatc ctaa 24 <210> 15 <211> 17 <212> DNA <213> Artificial Sequence <400> 15 ggaattgttg tgcttaa 17 <210> 16 <211> 15 <212> DNA <213> Artificial Sequence <400> 16 aattgttgcg cttaa 15 <210> 17 <211> twenty three <212> DNA <213> Artificial Sequence <400> 17 ccctagaaaa atgcaagtag caa 23 <210> 18 <211> twenty three <212> DNA <213> Artificial Sequence <400> 18 ctcatatgtg ccacttgaaa atg 23 <210> 19 <211> 16 <212> DNA <213> Artificial Sequence <400> 19 ctgaaaaggc agaagt 16 <210> 20 <211> 17 <212> DNA <213> Artificial Sequence <400> 20 actgaaaagg tagaagt 17 <210> twenty one <211> 27 <212> DNA <213> Artificial Sequence <400> twenty one agagagacac cattcacaaa gttagat 27 <210> twenty two <211> twenty two <212> DNA <213> Artificial Sequence <400> twenty two catggttttc acaattggat tt 22 <210> twenty three <211> 14 <212> DNA <213> Artificial Sequence <400> twenty three cgggatcgac attc 14 <210> twenty four <211> 15 <212> DNA <213> Artificial Sequence <400> twenty four acgggattga cattc 15 <210> 25 <211> twenty three <212> DNA <213> Artificial Sequence <400> 25 cagcatagga cataccctac aaa 23 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <400> 26 ctaaacgaca accagtgtac cacta 25 <210> 27 <211> 18 <212> DNA <213> Artificial Sequence <400> 27 acagtcaagt ttatattt 18 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <400> 28 acagtcaagt ctatattt 18 <210> 29 <211> 26 <212> DNA <213> Artificial Sequence <400> 29 tgatgtttgt tctaccaggc tctaga 26 <210> 30 <211> twenty two <212> DNA <213> Artificial Sequence <400> 30 cgcctcaggt ttttaggtat gg 22 <210> 31 <211> 16 <212> DNA <213> Artificial Sequence <400> 31 ttgattggga tctttc 16 <210> 32 <211> 16 <212> DNA <213> Artificial Sequence <400> 32 ttgattggaa tctttc 16

Claims

1. A molecular marker for genotyping of rice consisting of: R0110660585GA, R0208905316CT, F0332735670GA, R0402280679AG, R0625755443GA, F0920800632TC, R1016406260GA and F1107700914GA.

2. A primer probe set for genotyping of rice, the primer probe set consisting of: a primer pair of SEQ ID NO. 1-2 and two probes of SEQ ID NO. 3-4; a primer pair of SEQ ID NO. 5-6 and two probes of SEQ ID NO. 7-8; a primer pair of SEQ ID NO. 9-10 and two probes of SEQ ID NO. 11-12; a primer pair of SEQ ID NO. 13-14 and two probes of SEQ ID NO. 15-16; a primer pair of SEQ ID NO. 17-18 and two probes of SEQ ID NO. 19-20; a primer pair of SEQ ID NO. 21-22 and two probes of SEQ ID NO. 23-24; a primer pair of SEQ ID NO. 25-26 and two probes of SEQ ID NO. 27-28; and a primer pair of SEQ ID NO. 29-30 and two probes of SEQ ID NO. 31-32.

3. The primer probe set of claim 2, wherein the probes are TaqMan probes.

4. The primer probe set of claim 3, wherein the probes are TaqMan-MGB probes.

5. A primer pair for genotyping of rice, the primer pair capable of amplifying each of R0110660585GA, R0208905316CT, F0332735670GA, R0402280679AG, R0625755443GA, F0920800632TC, R1016406260GA and F1107700914GA, respectively.

6. The primer pair of claim 5, wherein the primer pair consists of: R0110660585GA: SEQ ID NO. 1-2; R0208905316CT: SEQ ID NO. 5-6; F0332735670GA: SEQ ID NO. 9-10; R0402280679AG: SEQ ID NO. 13-14; R0625755443GA: SEQ ID NO. 17-18; F0920800632TC: SEQ ID NO. 21-22; R1016406260GA: SEQ ID NO. 25-26 and F1107700914GA: SEQ ID NO. 29-30.

7. Probes for genotyping of rice, which can detect each of R0110660585GA, R0208905316CT, F0332735670GA, R0402280679AG, R0625755443GA, F0920800632TC, R1016406260GA and F1107700914GA, respectively.

8. The probes of claim 7, wherein the probes consist of: R0110660585GA: SEQ ID NO. 3-4; R0208905316CT: SEQ ID NO. 7-8; F0332735670GA: SEQ ID NO. 11-12; R0402280679AG: SEQ ID NO. 15-16; R0625755443GA: SEQ ID NO. 19-20; F0920800632TC: SEQ ID NO. 23-24; R1016406260GA: SEQ ID NO. 27-28 and F1107700914GA: SEQ ID NO. 31-32.

9. A kit for genotyping of rice, which comprises primer pairs capable of amplifying each of R0110660585GA, R0208905316CT, F0332735670GA, R0402280679AG, R0625755443GA, F0920800632TC, R1016406260GA and F1107700914GA, respectively, and / or probes capable of detecting each of R0110660585GA, R0208905316CT, F0332735670GA, R0402280679AG, R0625755443GA, F0920800632TC, R1016406260GA and F1107700914GA, respectively.

10. The kit of claim 9, wherein the primer pairs consist of: R0110660585GA: SEQ ID NO. 1-2; R0208905316CT: SEQ ID NO. 5-6; F0332735670GA: SEQ ID NO. 9-10; R0402280679AG: SEQ ID NO. 13-14; R0625755443GA: SEQ ID NO. 17-18; F0920800632TC: SEQ ID NO. 21-22; R1016406260GA: SEQ ID NO. 25-26 and F1107700914GA: SEQ ID NO. 29-30.

11. The kit of claim 9, wherein the probes consist of: R0110660585GA: SEQ ID NO. 3-4; R0208905316CT: SEQ ID NO. 7-8; F0332735670GA: SEQ ID NO. 11-12; R0402280679AG: SEQ ID NO. 15-16; R0625755443GA: SEQ ID NO. 19-20; F0920800632TC: SEQ ID NO. 23-24; R1016406260GA: SEQ ID NO. 27-28 and / or F1107700914GA: SEQ ID NO. 31-32.

12. The kit of claim 11, wherein the probe is a TaqMan probe.

13. The kit of claim 12, wherein the probe is a TaqMan-MGB probe.

14. The kit of any one of claims 9 to 13, wherein the kit further comprises reagents for performing real-time fluorescent quantitative PCR.

15. The kit of claim 14, wherein the reagents for performing real-time fluorescent quantitative PCR comprise a DNA polymerase, a buffer and dNTPs.

16. Use of the molecular marker of claim 1, the primer probe set of any one of claims 2 to 4, the primer pair of claim 5 or 6, the probe of claim 7 or 8, or the kit of any one of claims 9 to 15 for identifying the authenticity and / or purity of rice.

17. The use of claim 16, wherein the rice is selected from the rice types shown in Table 1.

18. Use of the molecular marker of claim 1, the primer probe set of any one of claims 2 to 4, the primer pair of claim 5 or 6, the probe of claim 7 or 8, or the kit of any one of claims 9 to 15 for monitoring the quality of seed production or propagation of rice.

19. The use of claim 18, wherein the rice is selected from the rice types shown in Table 1.

20. A method of genotyping rice, comprising identifying the genotype of the molecular marker of claim 1, or using the primer probe set of any one of claims 2 to 4, the primer pair of claim 5 or 6, the probe of claim 7 or 8, or the kit of any one of claims 9 to 15 to identify the genotype of the molecular marker of claim 1.

21. A method of identifying the authenticity and / or purity of rice, comprising identifying the genotype of the molecular marker of claim 1, or using the primer probe set of any one of claims 2 to 4, the primer pair of claim 5 or 6, the probe of claim 7 or 8, or the kit of any one of claims 9 to 15 to identify the genotype of the molecular marker of claim 1, and comparing the result obtained with the corresponding genotype of a reference sample, thereby determining the authenticity and / or purity of the rice.

22. A method of identifying the authenticity and / or purity of rice, comprising identifying the genotype of the molecular marker of claim 1, or using the primer probe set of any one of claims 2 to 4, the primer pair of claim 5 or 6, the probe of claim 7 or 8, or the kit of any one of claims 9 to 15 to identify the genotype of the molecular marker of claim 1, and comparing the result obtained with the corresponding genotype of a reference sample, thereby determining the authenticity and / or purity of the rice.

23. A method of identifying the authenticity and / or purity of rice, comprising identifying the genotype of the molecular marker of claim 1, or using the primer probe set of any one of claims 2 to 4, the primer pair of claim 5 or 6, the probe of claim 7 or 8, or the kit of any one of claims 9 to 15 to identify the genotype of the molecular marker of claim 1, and comparing the result obtained with the corresponding genotype of a reference sample, thereby determining the authenticity and / or purity of the rice.

24. A method of identifying the authenticity and / or purity of rice, comprising identifying the genotype of the molecular marker of claim 1, or using the primer probe set of any one of claims 2 to 4, the primer pair of claim 5 or 6, the probe of claim 7 or 8, or the kit of any one of claims 9 to 15 to identify the genotype of the molecular marker of claim 1, and comparing the result obtained with the corresponding genotype of a reference sample, thereby determining the authenticity and / or purity of the rice.

Citation Information

Patent Citations

  • SNP marker combination for germplasm resource and variety identification of rice and application of SNP marker combination

    CN110527736A

  • Hybrid rice backbone parent detection primer group and application thereof

    CN111455089A