A gene-edited hematopoietic stem cell and its combined application with CAR-T cells

Abstract

A method for changing cell antigen epitopes and cells prepared by the method are provided. A method and a pharmaceutical composition for treating tumors by combining the cells with CAR-T cells or antibody drugs are also provided. Cells with altered antigen epitopes are not killed by CAR-T or antibody drugs and can be injected into the patient to alleviate the side effects of CAR-T products or antibody drugs in tumor treatment.

Description

Technical Field

[0001] The present invention belongs to the technical field of tumor treatment, and specifically relates to the combined application of gene-edited hematopoietic stem cell transplantation and chimeric antigen receptor T cells or antibody drugs, and more particularly to a hematopoietic stem cell or progenitor cell that is immune to the action of chimeric antigen receptor T cells and a preparation method thereof, as well as the application of the combined CAR-T cells or antibody drugs in the treatment of tumors. Background Art

[0002] Hematopoietic stem cells (HSC) are a type of hematopoietic tissue stem cells with the potential for self-renewal and multidirectional differentiation. They produce hematopoietic progenitor cells of various lines (such as lymphoid progenitor cells and myeloid progenitor cells, etc.) through directed differentiation, and then proliferate and differentiate into various mature functional blood cells in large quantities, thereby maintaining the hematopoietic homeostasis of the entire body. In the field of disease treatment, the method of using healthy autologous or allogeneic HSC to replace the patient's HSC to rebuild the patient's hematopoietic and immune functions to treat the disease is called hematopoietic stem cell transplantation. After more than 60 years of development and application, more than 1 million patients have received and benefited from hematopoietic stem cell transplantation. As the first regenerative method to enter clinical practice, hematopoietic stem cell transplantation has had a profound impact on the development of clinical medicine related to cell therapy.

[0003] However, past studies and clinical experiments have shown that the popularization and expansion of hematopoietic stem cell transplantation in clinical applications are still greatly limited, and it faces two urgent problems: tumor recurrence and transplantation complications. For patients with relapse of autologous transplantation, it is mainly because the residual cancer cells in the bone marrow or peripheral blood of malignant tumor patients contaminate the obtained autologous stem cells, resulting in the recurrence of malignant diseases. For patients with allogeneic hematopoietic stem cell transplantation, the probability of graft-versus-host disease (GVHD) is very high. Among them, the probability of acute GVHD is 20%-60%, the incidence of chronic GVHD is about 50%, and the incidence of fatal GVHD is 5%-20%. Severe GVHD is likely to be life-threatening and needs to be treated as soon as possible once it occurs. In addition, after hematopoietic stem cell transplantation, early implantation is crucial for post-transplantation and long-term immune reconstruction. Pre-transplantation pretreatment damages the recipient's bone marrow microenvironment, which will produce a "bystander effect" on the transplanted donor hematopoietic stem cells, resulting in poor implantation and decreased self-renewal ability of the donor's hematopoietic stem cells, resulting in poor transplantation efficacy.

[0004] With the continuous breakthroughs in science and technology, many major changes have also taken place in the field of cell therapy. Modern cancer immunotherapy methods have benefited to a certain extent from the development of hematopoietic stem cell transplantation. At the same time, there is great prospect in improving the applicability, safety and efficacy of hematopoietic stem cell transplantation, and there are also many new areas of application.

[0005] Chimeric antigen receptor T cell (CAR-T) therapy is an immunotherapy technology that achieves targeted tumor killing through T cell genetic modification. By expressing receptors that can recognize specific antigens on the surface of T cells, the edited CAR-T cells can eliminate tumor cells in a targeted manner. Compared with traditional transplantation technology, the commonly used CAR-T products are all autologous, and these CAR-T cells will not cause GVHD. Multiple clinical trials have confirmed that it has a good effect on patients with relapsed / refractory blood tumors.

[0006] However, the lack of specific tumor surface antigens has always been one of the difficulties in using CAR-T for antigen-specific immunotherapy. For example, CAR-T cells targeting the CD33 antigen will kill the body's normal myeloid progenitor cells and myeloid cells in the treatment of acute myeloid leukemia, and CAR-T cells targeting the CD19 antigen cannot distinguish between malignant tumor B cells and normal B cells. Therefore, patients undergoing these treatments must endure immune deficiency caused by myeloid development disorders (CD33) or long-term B cell loss (CD19), and their quality of life is greatly affected. In addition, the survival time of CAR-T cells in the body is not as long-lasting as that of fully chimeric donor cells in transplantation. Once the killing effect of CAR-T cells on tumor cells is lost, the primary disease may return.

[0007] Considering the advantages and disadvantages of hematopoietic stem cell transplantation and CAR-T therapy, combining the two may help to maximize their strengths and minimize their weaknesses. Experimental data show that using CAR-T therapy as part of conditioning therapy before allogeneic hematopoietic stem cell transplantation can reduce the toxicity of high-dose chemotherapy and have a positive impact on the quality of life. For patients with relapsed / refractory disease, achieving complete remission through early CAR-T therapy can smoothly bridge to transplantation in the best state and achieve the best therapeutic effect. Hematopoietic stem cell transplantation combined with CAR-T therapy can improve anti-tumor targeting, reduce the relapse rate, adverse reactions and the incidence of GVHD. CAR-T therapy has good effectiveness and safety for patients who relapse after transplantation. Therefore, the combined use of CAR-T therapy in various stages of transplantation can achieve complementarity or synergy, optimize the treatment effect, expand the scope of applicability, and is expected to become a new treatment strategy worthy of promotion.

[0008] CD33 is a member of the sialic acid-binding immunoglobulin-like lectin family. It is expressed in all myeloid cells that differentiate from myeloid progenitor cells (CMPs). Therefore, CD33 is also a classic target in the diagnosis and treatment of AML (acute myeloid leukemia). However, when using CAR-T and ADC drugs targeting CD33 to treat AML patients, there are serious toxic side effects, and both normal myeloid cells and myeloid progenitor cells will be killed by targeted drugs. Currently, researchers use the CRISPR-Cas9 system to knock out the CD33 gene in human hematopoietic stem cells. After CD33 is knocked out, the hematopoietic stem cells can differentiate into myeloid cells and perform functions, and will not be recognized and killed by anti-CD33 CAR-T cells.

[0009] Therefore, modifying the target antigens of hematopoietic stem cells through gene editing technology and combining them with corresponding CAR-T products provides a new idea and model for cell therapy. Summary of the invention

[0010] In view of the shortcomings of the prior art, the purpose of the present invention is to provide a hematopoietic stem cell or progenitor cell that is immune to the action of chimeric antigen receptor T cells and its application. In the present invention, the patient's own hematopoietic stem cells are transformed, and the target antigen is epitope-modified by gene editing technology, so that the transformed hematopoietic stem cells are not killed by CAR-T cells or antibody drugs, and then the hematopoietic stem cells are transplanted back into the patient's body to alleviate the side effects of CAR-T products or antibody drugs in tumor treatment.

[0011] To this end, the present invention provides the following technical solutions.

[0012] In one aspect, the present invention provides a cell having a cell surface protein, wherein the cell surface protein is modified to have an antigenic epitope change, and the antigenic epitope change enables the cell to resist killing by CAR-T or antibody drugs.

[0013] In some embodiments, the cell is a hematopoietic stem cell or a differentiated cell thereof. In some specific embodiments, the cell is a lymphoid progenitor cell, a myeloid progenitor cell, a lymphoid cell or a myeloid cell.

[0014] In some embodiments, the cell surface protein is a lymphoid cell-specific cell surface protein or a myeloid cell-specific cell surface protein.

[0015] In some embodiments, the change in the antigenic epitope of the cell is caused by the presence of a single nucleotide mutation, a splice site mutation and / or a nucleotide fragment replacement, insertion and / or deletion in the gene encoding the cell surface protein.

[0016] In some embodiments, the cell surface protein is expressed with an exon deletion.

[0017] In some embodiments, the cell surface protein is CD33, CD19, or BCMA.

[0018] In some embodiments, the cell surface protein is CD33, which lacks the amino acid fragment encoded by the second exon in the CD33 gene.

[0019] In some embodiments, the cell surface protein is CD33, and one or any combination of the following features exists in the CD33 gene of the cell: 1) the rs12459419 site is nucleotide T; 2) the 3'ss site before the second exon sequence is AA or CT; and 3) TTTCT in the second exon is replaced by AATCC.

[0020] On the other hand, the present invention provides the use of the above-mentioned cells in combination with CAR-T or antibody drugs in the preparation of anti-tumor drugs.

[0021] In some embodiments, the CAR-T or antibody drug can target the cell surface protein of the tumor cell and kill the tumor cell. The cell surface protein expressed by the cell is modified to have an antigenic epitope change, and the antigenic epitope change makes the cell resistant to killing by the CAR-T or antibody drug.

[0022] In some embodiments, the tumor is a hematological tumor, preferably AML.

[0023] On the other hand, the present invention provides a method for preparing cells, wherein the cell surface protein of the cell has an antigenic epitope change that can resist killing by CAR-T or antibody drugs, and the method includes gene editing the encoding gene of the cell surface protein.

[0024] In some embodiments, the gene editing comprises introducing single nucleotide mutations, splice site mutations and / or nucleotide fragment substitutions, insertions and / or deletions into the coding gene.

[0025] In some embodiments, the gene editing is performed by introducing a CRISPR gene editing system into the cell.

[0026] In some embodiments, the cell is a hematopoietic stem cell or a differentiated cell thereof. In some specific embodiments, the cell is a lymphoid progenitor cell, a myeloid progenitor cell, a lymphoid cell or a myeloid cell.

[0027] In some embodiments, the cell surface protein is a lymphoid cell-specific cell surface protein or a myeloid cell-specific cell surface protein.

[0028] In some embodiments, the cell surface protein is expressed with an exon deletion.

[0029] In some embodiments, the cell surface protein is CD33, CD19, or BCMA.

[0030] In some embodiments, the cell surface protein is CD33, and the gene editing includes any one of the following or any combination thereof: 1) mutating the nucleotide C at the rs12459419 position to T; 2) mutating the nucleotide AG at the 3'ss position before the second exon sequence to AA or CT; and 3) mutating the nucleotide TTTCT in the second exon to AATCC.

[0031] In some embodiments, the CRISPR gene editing system for mutating nucleotide C at position rs12459419 to T includes an sgRNA having a target sequence of SEQ ID NO: 10, 11, 12, 14 or 15.

[0032] In some embodiments, the CRISPR gene editing system for mutating nucleotide C at rs12459419 to nucleotide T includes an sgRNA having a target sequence of SEQ ID NO: 10, 11 or 12 and a ssDNA comprising SEQ ID NO: 21; an sgRNA having a target sequence of SEQ ID NO: 14 and a ssDNA comprising SEQ ID NO: 23; or an sgRNA having a target sequence of SEQ ID NO: 15 and a ssDNA comprising SEQ ID NO: 24.

[0033] In some embodiments, the CRISPR gene editing system for mutating the nucleotide AG at the 3' ss site before the second exon sequence to AA includes an sgRNA having a target sequence of SEQ ID NO: 13 or 16.

[0034] In some embodiments, the CRISPR gene editing system for mutating the nucleotide AG at the 3'ss site before the second exon sequence to AA includes an sgRNA having a target sequence of SEQ ID NO: 13 or 16 and a single-base cytosine editor, wherein the single-base cytosine editor is preferably A3A-CBE3.

[0035] In some embodiments, the CRISPR gene editing system that simultaneously mutates the nucleotide C at the rs12459419 site to T and mutates the nucleotide AG at the 3'ss site before the second exon sequence to CT includes an sgRNA having a target sequence of SEQ ID NO: 10 or 14.

[0036] In some embodiments, the CRISPR gene editing system that simultaneously mutates the nucleotide C at the rs12459419 site to T and mutates the nucleotide AG at the 3'ss site before the second exon sequence to CT includes a sgRNA having a target sequence of SEQ ID NO: 10 and a ssDNA comprising SEQ ID NO: 22, or a sgRNA having a target sequence of SEQ ID NO: 14 and a ssDNA comprising SEQ ID NO: 27.

[0037] In some embodiments, the CRISPR gene editing system for mutating nucleotides TTTCT within the second exon to AATCC includes an sgRNA having a target sequence comprising SEQ ID NO: 18 or 20.

[0038] In some embodiments, the CRISPR gene editing system for mutating nucleotides TTTCT within the second exon to AATCC includes an sgRNA comprising a target sequence comprising SEQ ID NO: 18 or 20 and a ssDNA comprising SEQ ID NO: 26.

[0039] On the other hand, provided herein is a method for clearing or reducing tumor cells in a subject, comprising administering to the subject a CAR-T or antibody drug capable of killing the tumor cells and supplementing the subject with normal cells, wherein the CAR-T or antibody drug targets the cell surface protein of the tumor cells, and the cell surface protein expressed by the normal cells is modified to have an antigenic epitope change, and the antigenic epitope change enables the normal cells to resist killing by the CAR-T or antibody drug.

[0040] In some embodiments, the tumor cell is a blood tumor cell, and the normal cell is a blood cell or a hematopoietic stem cell or progenitor cell capable of differentiating into a blood cell.

[0041] In some embodiments, the cell surface protein is a lymphoid cell-specific cell surface protein or a myeloid cell-specific cell surface protein.

[0042] In some embodiments, the change in the antigenic epitope of the normal cell is caused by the presence of a single nucleotide mutation, a splice site mutation and / or a nucleotide fragment replacement, insertion and / or deletion in the gene encoding the cell surface protein.

[0043] In some embodiments, the cell surface protein of the normal cell is expressed with an exon deletion.

[0044] In some embodiments, the cell surface protein is CD33, CD19, or BCMA.

[0045] In some embodiments, the cell surface protein is CD33, which lacks the amino acid fragment encoded by the second exon in the CD33 gene.

[0046] In some embodiments, the cell surface protein is CD33, and one or any combination of the following features exists in its encoding gene: 1) the rs12459419 position is nucleotide T; 2) the 3'ss position before the second exon sequence is AA or CT; and 3) TTTCT in the second exon is replaced by AATCC.

[0047] In some embodiments, the tumor cells are AML cells.

[0048] On the other hand, provided herein is a pharmaceutical composition or a pharmaceutical combination, which includes a CAR-T or antibody drug and normal cells, wherein the CAR-T or antibody drug can target the cell surface protein of tumor cells and kill the tumor cells, and the cell surface protein expressed by the normal cells is modified to have an antigenic epitope change, and the antigenic epitope change enables the normal cells to resist killing by the CAR-T or antibody drug.

[0049] In some embodiments, the tumor cell is a blood tumor cell, and the normal cell is a blood cell or a hematopoietic stem cell or progenitor cell capable of differentiating into a blood cell.

[0050] In some embodiments, the cell surface protein is a lymphoid cell-specific cell surface protein or a myeloid cell-specific cell surface protein.

[0051] In some embodiments, the change in the antigenic epitope of the normal cell is caused by the presence of a single nucleotide mutation, a splice site mutation and / or a nucleotide fragment replacement, insertion and / or deletion in the encoding nucleotide sequence of the cell surface protein.

[0052] In some embodiments, the cell surface protein of the normal cell is expressed with an exon deletion.

[0053] In some embodiments, the cell surface protein is CD33, CD19, or BCMA.

[0054] In some embodiments, the cell surface protein is CD33, which lacks the amino acid fragment encoded by the second exon in the CD33 gene.

[0055] In some embodiments, the cell surface protein is CD33, and one or any combination of the following features exists in its encoding gene: 1) the rs12459419 position is nucleotide T; 2) the 3'ss position before the second exon sequence is AA or CT; and 3) TTTCT in the second exon is replaced by AATCC.

[0056] In some embodiments, the tumor cells are AML cells.

[0057] The cells modified with altered antigenic epitopes provided herein can be used in combination with CAR-T cells or antibody drugs for tumor treatment. Cells with altered antigenic epitopes are not killed by CAR-T or antibody drugs and can be injected into the patient to alleviate the side effects of CAR-T products or antibody drugs in tumor treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 This is a diagram showing the analysis results of the CD33 exon2 SNP genotypes among different cell lines in Example 1.

[0059] Figure 2 The gel electrophoresis diagram of the variable splicing expression of CD33 exon2 in different cell lines in Example 1.

[0060] Figure 3A This is a schematic diagram of the design principle of probe primers spanning CD33 exon2 in the RT-qPCR experiment in Example 1.

[0061] Figure 3B This is a graph showing the RT-qPCR results for detecting the loss of CD33 exon2 in different cell lines in Example 1.

[0062] Figure 4A This is a flow cytometry result comparison diagram of the expression of CD33 exon2 and total protein in different cell lines in Example 1.

[0063] Figure 4B Statistical graph of the mean fluorescence intensity of CD33 exon2 and total protein of different cell lines in Example 1.

[0064] Figure 5 The bar graphs are of GFP positivity and cell viability of different cell lines detected by FACS flow cytometry in Example 2, wherein Figure I is the GFP positivity rate and Figure II is the cell viability.

[0065] Fig. 6A Schematic diagram of the mutation status of the G base after the 3′ss AG site of CD33 exon2 using the single-base cytosine editor A3A-CBE3 in Example 2.

[0066] Figure 6B This is a bar graph obtained after analyzing the 3′ss single base mutation efficiency using EditR in Example 2.

[0067] Figure 6C This is a comparison chart of the E13 / E2 ratio in the K562 cell line detected by RT-qPCR in Example 2.

[0068] Fig.6D This is a comparison chart of the E13 / E2 ratio in the HL60 cell line detected by RT-qPCR in Example 2.

[0069] Figure 7 This is an analysis diagram of the mutation status obtained after the SNP site and 3′ss site were mutated by RNP combined with ssDNA electroporation into cells in Example 3.

[0070] Fig. 8A This is the RT-qPCR result of E13 / E2 after the mutation of SNP site and 3′ss site in Example 3.

[0071] Figure 8B This is a graph showing the results of flow cytometry antibody staining after the mutation of the SNP site and 3′ss site in Example 3.

[0072] Fig. 9 These are the mutation status analysis diagrams of PE+ and PE- cells sorted by Tyto flow cytometry and the cells obtained after sorting in Example 4, wherein Figure I is the Tyto flow cytometry sorting diagram, and Figure II is the mutation status analysis diagram.

[0073] Fig. 10A This is a sequence comparison diagram of the highly similar DNA of CD33 and CD33 in Example 5.

[0074] Fig. 10B Schematic diagram of the editing mediated by sg4 in CD33 and off-target regions in Example 5.

[0075] Fig.11A This is an analysis diagram of the sequence obtained after sg4-14 and sg4-15 mediated mutation of the CD33 exon2 SNP site in Example 5.

[0076] Fig. 11B This is a graph showing the expression level of the V region (P67.6) encoded by CD33 exon2 in the mutated cells detected by flow cytometry in Example 5.

[0077] Fig. 12A This is a sequence analysis diagram of the AATCC mutation mediated by Sg3 and sg10 in Example 6.

[0078] Fig. 12BThis is a graph showing the expression level of the V region (P67.6) encoded by CD33 exon2 in the mutated cells detected by flow cytometry in Example 6.

[0079] Fig.13 This is a graph showing the proportion of CAR-positive cells in CD33 CART cells detected by flow cytometry in Example 7.

[0080] Fig.14A This is a flow cytometry result obtained after co-incubation of CD33 CAR-T cells and edited NB4 cells for 0 hours in Example 7.

[0081] Fig. 14B This is a graph showing the detection results of simultaneous flow cytometry staining of CD33 P67.6 and HIM-3-4 antibodies obtained 0 hour after in Example 7.

[0082] Fig. 14C This is a flow cytometry result obtained after co-incubation of CD33 CAR-T cells and edited NB4 cells for 96 hours in Example 7.

[0083] Fig.14D This is a graph showing the detection results obtained after simultaneous flow cytometry staining of CD33 P67.6 and HIM-3-4 antibodies for 96 hours in Example 7.

[0084] Fig.14E This is a curve diagram of the proportion of target cells after mutation at 0 hours, 22 hours, 44 hours, 68 hours and 96 hours after co-incubation of different cell lines with CD33 CAR-T cells in Example 7.

[0085] Fig.15A This is a sequence analysis diagram of cells obtained after electroporation of the RNP complex of sg10 and cas9 in HSC cells in Example 8.

[0086] Fig. 15B This is a diagram showing the detection results obtained after simultaneous flow cytometry staining of CD33 P67.6 and HIM-3-4 antibodies in Example 8.

[0087] Fig. 15C This is a graph showing the proportion of CD14 positive cells detected on the 1st, 5th, 9th and 14th days of differentiation in Example 8 when the culture medium for inducing myeloid monocytic differentiation of HSC in vitro was added.

[0088] Fig.15D This is a curve chart of the content of CD14 positive cells on the 1st, 5th, 9th and 14th days of differentiation in Example 8.

[0089] Fig.16 Schematic diagram of the deletion of CD33 exon 2 caused by a single nucleotide change. DETAILED DESCRIPTION

[0090] Unless otherwise specified, all technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art. For the purpose of facilitating understanding of the technical solutions provided herein, some technical terms are briefly described below.

[0091] "Cell surface protein" refers to a protein at least partially located on the cell surface after expression in this article, which is usually a membrane protein in which a partial amino acid sequence is embedded in the cell membrane, or it can be an extracellular component attached to the cell surface. For cells derived from different tissues or organs, they usually express their own specific cell surface proteins, i.e., tissue-specific or cell-specific proteins. These cell surface proteins can also increase or decrease expression as the cells differentiate or mature. In some cases, this article focuses on blood cell-specific cell surface proteins, such as proteins mainly expressed on the surface of lymphoid cells (such as T cells or B cells) or myeloid cells (such as various granulocytes, monocytes, etc.), for example, cell surface markers such as CD33, CD19, CD21, BCMA, CD22, CD24. In tumor cells, the expression of some cell surface proteins is upregulated, or some tumor-specific surface proteins are expressed, which can be used as targets for drug binding or action.

[0092] "Chimeric antibody receptor (chimeric antigen recessive, CAR)", also known as chimeric T cell receptor, chimeric immune receptor, is an engineered membrane protein receptor molecule that can confer the desired specificity to immune effector cells, such as the ability to bind to cell surface proteins (such as tumor antigens). Chimeric antigen receptors are generally composed of an extracellular antigen binding domain, a transmembrane domain, and an intracellular signaling domain. In some cases, the antigen binding domain is a scFv sequence responsible for recognizing and binding to a specific antigen. The intracellular signaling domain generally includes an immunoreceptor tyrosine activation motif (ITAM), such as a signaling domain derived from a CD3ε molecule, which is responsible for activating immune effector cells and producing a killing effect. In addition, the chimeric antigen receptor may also include a signal peptide at the amino terminus that is responsible for the localization of the new protein in the cell, and a hinge region between the antigen binding domain and the transmembrane domain. In addition to the signaling domain, the intracellular signaling domain may also include a costimulatory domain derived from, for example, a 4-1BB or CD28 molecule. Accordingly, T cells expressing CAR are referred to as CAR-T. CAR-T uses the CAR expressed on its cell surface to identify target cells, and after being activated by the target cells, it produces a killing response to the target cells. The general process of using CAR-T cells to treat subjects (such as cancer patients) is: collecting peripheral blood mononuclear cells (PBMC) from the subject, isolating and culturing T cells, introducing CAR encoding nucleic acid sequences by lentiviral transduction, continuing to culture and collect CAR+ cells, and returning CAR+ cells to the subject. It is known to those skilled in the art that in some cases, NK cells can be used instead of T cells to carry out this process. Therefore, when referring to CAR-T, NK cells expressing CAR may also be included as appropriate.

[0093] "Antibody drugs" in this article refer to antibodies or antibody-drug conjugates (ADCs) that can bind to cell surface proteins, thereby causing changes in the activity of cells expressing the cell surface proteins. For example, when an antibody molecule binds to a cell surface protein (such as a receptor), the cell activity may be inhibited, growth stagnation or death may occur, or because the antibody binds to the cell surface protein, the ligand of the cell surface protein cannot bind normally, thereby causing the cell activity to be inhibited, growth stagnation or death. For another example, when an antibody molecule binds to a cytotoxic agent through a degradable linker, the cytotoxic agent can be targeted to the cell expressing the antigen molecule by specifically recognizing the corresponding antigen molecule of the antibody, resulting in cell killing.

[0094] "Epitope" refers to the recognition and binding site of the corresponding antibody in this article. An epitope can be a continuous amino acid sequence, or a three-dimensional structure formed by discontinuous amino acids, which are usually located on the surface of a protein molecule. The antibody molecule binds to the epitope through the antigen binding site formed by its heavy chain variable region and light chain variable region. The antigen binding domain in the CAR molecule generally includes an antigen binding site in the form of scFv, which can recognize the epitope on the cell surface protein on the target cell. The epitope change is at least the insertion, deletion and / or replacement of one or more amino acids constituting the epitope. In some cases, the epitope change is a continuous amino acid deletion in a cell surface protein, such as caused by exon deletion due to alternative splicing of a precursor mRNA molecule. When the antigenic epitope of the cell surface protein of the target cell changes, the antibody molecule that recognizes the epitope will lose or weaken its binding ability. In this case, the corresponding CAR-T including the light chain variable region and the heavy chain variable region (for single domain antibodies, only the heavy chain variable region) from the antibody molecule will also lose or weaken its target cell killing ability, that is, the target cell acquires the property of "anti-CAR-T killing". In a preferred embodiment, this antigenic epitope change is only to obtain anti-CAR-T killing ability for a specific CAR-T, without affecting the normal function of the cell surface protein.

[0095] "Single nucleotide mutation" refers to a single nucleotide change in the editing gene of a cell surface protein in this article, including insertion, deletion or substitution. The single nucleotide change can cause the amino acid sequence of the expressed cell surface protein to change, or if the single amino acid change occurs in a sequence related to controlling RNA splicing (such as an exon splicing enhancer, an intron splicing enhancer, 3'ss or 5'ss), splicing errors are generated, resulting in amino acid sequence changes. These amino acid sequence changes can cause changes in the antigen epitope, thereby enabling cells expressing the cell surface protein to acquire anti-CAR-T killing ability.

[0096] "Splice site mutation" herein refers to a mutation related to the splicing of precursor RNA (pre-RNA). The mutation site can be located, for example, in exon splicing enhancers, intron splicing enhancers, 3'ss or 5'ss, branch point and other sequences, as long as they can cause changes in the amino acid sequence of the final protein produced. In some cases, the splice site mutation can cause the coding sequence of at least one exon to not appear in the synthesized protein. In a specific embodiment, when a SNP site (rs12459419) in the second exon of the CD33 gene is T, it can cause the second exon to be deleted (see Fig.16 ).

[0097] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) gene editing technology is a newly emerged technology that uses Cas nuclease to perform DNA editing on target genes under the guidance of RNA. The CRISPR gene editing system used in this technology includes Cas nuclease and guide RNA (single-guide RNA, sgRNA), and may also include ssDNA as a repair template as appropriate. sgRNA can bind to Cas nuclease, and part of the sequence can be complementary to part of the sequence of the target gene. With the help of the recognition of sgRNA, Cas nuclease can form a single-stranded or double-stranded nick at a specific site of the target gene. Cells usually repair DNA broken chains in two ways, namely homologous recombination repair mechanism (homology-directed repair, HDR) and non-homologous end joining repair mechanism (non-homologous end joining, NHEJ). When a repair template is provided to cells, the cells can be allowed to perform nick repair according to the repair template. If mutant nucleotides are added to the repair template (ssDNA), the mutations expected by the technician can be generated after homologous recombination repair, achieving the purpose of gene editing. The NHEJ repair mechanism without providing a repair template may produce a variety of mutant products, and these mutant products can also be screened to obtain the mutant products expected by the technician. Recently, various site-specific single-base editors, such as CBE, ABE and their various improved variants, have been developed on the above-mentioned CRISPR gene editing system. These base editors use fusion proteins formed by modified Cas enzymes and various deaminases to form nucleotide-directed changes at specific sites under the guidance of sgRNA. This base editor can be considered as an improved CRISPR gene editing technology, and they are also included when CRISPR gene editing is mentioned in this article. In addition, those skilled in the art can also expect that DNA homologous recombination can be used to perform specific site shearing with the help of nucleases (such as ZFN and TALEN) to introduce gene changes. As long as the desired epitope changes can be produced, the use of these and other genetic modification technologies should also be covered within the scope of protection of the present invention.

[0098] "Normal cells" in this article refer to non-tumor cells, especially non-tumor cells that are killed during CAR-T (or antibody drugs) treatment. Because CAR-T relies on its antigen binding domain to recognize antigen epitopes on tumor cells and kill tumor cells, these antigen epitopes are often expressed or present on non-tumor cells, causing them to be killed by CAR-T, resulting in "on-target, off-tumor" problems. These normal cells are killed, resulting in damage to the immune system or other functions of the subject. In medical practice, the above problems can be alleviated by supplementing these normal cells to the subject. Since these normal cells may also carry antigen epitopes recognized by CAR-T, in order to prevent them from being killed by CAR-T, the methods provided in this article can be used to modify these antigen epitopes to avoid CAR-T killing. Therefore, in terms of preventing CAR-T killing, these normal cells are mainly cells with modified antigen epitopes. These normal cells can come from the subject himself or from other donors. These normal cells can be differentiated or mature cells, or they can be stem cells, progenitor cells or precursor cells, such as hematopoietic stem cells (HSC).

[0099] "Pharmaceutical composition" refers to a pharmaceutical preparation containing at least one active pharmaceutical ingredient in this article. Pharmaceutical preparations may also generally include other ingredients such as pharmaceutically acceptable excipients and buffers. When a pharmaceutical composition includes at least two active ingredients, they generally coexist in the same pharmaceutical preparation. "Drug combination" refers to at least two active pharmaceutical ingredients in a separate state, that is, they are present in different pharmaceutical preparations, but they are suitable for administration to a subject successively or simultaneously to produce a therapeutic effect in the subject that is superior to the administration of the active pharmaceutical ingredients alone. This therapeutic effect can be reflected in the synergistic effect of the active pharmaceutical ingredients, or it can be that one active pharmaceutical ingredient weakens the side effects of another active pharmaceutical ingredient. The active pharmaceutical ingredients in the form of a "drug combination" may be present in the same drug packaging box or in different drug packaging boxes.

[0100] By combining CAR-T (or antibody drugs) therapy with the input of normal cells (such as HSC transplantation), this article provides a new treatment strategy for tumors, especially blood tumors (such as AML). Based on this strategy, by supplementing the subjects with genetically modified normal cells (such as HSC), the side effect of CAR-T killing non-tumor cells during tumor treatment can be overcome, so that in the design of CAR-T therapy, it is not necessary to select tumor-specific antigens (which are often difficult to find) as targets, but tumor-associated antigens can also be selected as targets.

[0101] The hematopoietic stem cells or progenitor cells provided herein that are free from the killing effect of chimeric antigen receptor T cells may include a gene editing system for mutating nucleotide sequences encoding cell surface proteins. The cell surface proteins include cell surface proteins targeted by CAR-T cells. Preferably, the antigen surface protein includes any one of a CD33 antibody recognition epitope, a CD19 antibody recognition epitope, or a BCMA antibody recognition epitope. As a preferred technical solution of the present invention, the SNP (single nucleotide polymorphism site, rs12459419) genotype of the second exon region (exon2) corresponding to the CD33 antibody recognition epitope site of the hematopoietic stem cell or progenitor cell is expressed as a mutated T genotype; and / or, the TTTCT site of the second exon region corresponding to the CD33 antibody recognition epitope site of the hematopoietic stem cell is expressed as a mutation of AATCC. The present invention uses CD33 as the target antigen, and conducts SNP and CD33 variable splicing experiments with commercial AML cells. After confirming the effectiveness of the SNP site mutation, the mutation that can effectively cause the CD33 V structure to not bind to the antibody is screened; after screening, it is found that there is a SNP site in CD33 exon2. After the SNP is mutated from C to T, the second exon is deleted, thereby causing the CD33 V domain to not be expressed, but after the mutation, there is also a risk that the CD33 C domain is affected; therefore, the present invention unexpectedly discovered in further research that the introduction of a new AATCC mutable site can not only block the expression of the CD33 V domain, but also does not affect the expression of the CD33 C domain, and the resulting cells not only tolerate the killing of Anti-CD33 CAR-T, but also do not affect the normal in vitro differentiation of the cells.

[0102] Therefore, the SNP site and / or TTTCT site in the second exon region of CD33 of the mutated hematopoietic stem cell, preferably the mutated TTTCT site, can effectively tolerate the killing of anti-CD33 CAR-T, and the cells can differentiate normally in vitro. Traditional knockouts can cause the loss of gene function. Compared with direct gene knockout, some genes are mutated by gene editing and other means, causing the conformation of the antigen epitope to change. Under the premise of not affecting the function of the protein, the targeting of CAR-T or antibody drugs to it is invalid, and the effect on hematopoietic stem cells is smaller. In the process of co-incubation with CAR-T cells, the cell tolerance of the gene mutation provided by the present invention is stronger and the survival rate is higher.

[0103] At the same time, the gene editing method and design ideas provided in the present invention can also be extended to other target antigens, such as specifically expressed antigens in lymphoid and myeloid cells (B cells, T cells, NK cells, monocytes, granulocytes, etc.), which greatly broadens the choice of tumor targets in cell immunotherapy. By combining hematopoietic stem cell transplantation and CAR-T cell therapy, a new treatment idea is provided for tumor immunotherapy.

[0104] For example, for antigens such as CD19 and BCMA, the present invention can edit the relevant antigens of hematopoietic stem cells through base editing or knockout-coordinated homologous recombination, and screen out the mutation sites of antigens such as CD19 and BCMA, respectively, so that the differentiated B cells or plasma cells can tolerate the targeting of anti-CD19-CAR-T cells (or anti-CD19 antibodies) or anti-BCMA-CAR-T cells (or anti-BCMA antibodies) and have normal cell functions.

[0105] Preferably, the 3'ss site of the CD33 gene of the hematopoietic stem cell exhibits a mutation from AG to AA or CT.

[0106] Similarly, in the present invention, a gene editing method for mutating the nucleotide sequence encoding CD33 can be used to change the antibody recognition epitope of CD19 or the antibody recognition epitope of BCMA. The experimental method or design idea based on it is similar to that of CD33. The difference is that the sgRNA used in the gene editing system is different, and accordingly, the targeted site also changes accordingly.

[0107] As a preferred technical solution of the present invention, the gene editing system includes a CRISPR gene editing system. The CRISPR gene editing system may include a Cas enzyme and sgRNA (or their expression vectors). Among them, the sgRNA includes an sgRNA for mutating CD33 antibody recognition epitope sites, an sgRNA for mutating CD19 antibody recognition epitope sites, or an sgRNA for mutating BCMA antibody recognition epitope sites.

[0108] In the present invention, the sgRNA used to mutate the nucleotide sequence encoding the second exon region of CD33 includes any one of the nucleotide sequences shown in SEQ ID NO: 10 (sg4), SEQ ID NO: 11 (sg4-14), SEQ ID NO: 12 (sg4-15), SEQ ID NO: 18 (sg3) or SEQ ID NO: 20 (sg10).

[0109] When sg4 is used to mutate the SNP site, sg4 may mismatch with the CD33 homologous sequence, resulting in off-target. Therefore, the present invention further replaces the 14th (sg4-14) or 15th (sg4-15) base on sg4 to reduce the possibility of sg4 off-targeting to the CD33 homologous region. Both sg4-14 and sg4-15 can effectively mediate the mutation of the SNP site C to T on CD33 exon2, and the mutated cell exon2 is missing; in the mutation group mediated by sg3 and sg10, TTTCT on the CD33 region is mutated to AATCC, and in the CD33 homologous region, the sequencing peak is single and has no difference with the group with only electroporation of cas9, indicating that sg3 and sg10 will not off-target to the CD33 homologous sequence to produce non-specific cutting.

[0110] Preferably, the sgRNA is any one of SEQ ID NO: 11 (Sg4-14), SEQ ID NO: 12 (Sg4-15) or SEQ ID NO: 20 (Sg10).

[0111] Preferably, the sgRNA is SEQ ID NO: 20, and the TTTCT site in the second exon region corresponding to the CD33 epitope site of the prepared hematopoietic stem cell exhibits an AATCC mutation.

[0112] In the present invention, corresponding sgRNAs are also designed for the antibody recognition epitopes of CD19 or BCMA to achieve gene mutation.

[0113] As a preferred technical solution of the present invention, the gene editing system also includes a repair template ssDNA.

[0114] Wherein, the repair template ssDNA includes a nucleotide sequence shown in any one of SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24 or SEQ ID NO: 26.

[0115] The present invention also provides a method for preparing hematopoietic stem cells or progenitor cells as described above, the method comprising transferring a gene editing system into the hematopoietic stem cells or progenitor cells to be edited. Wherein, the method of transfer includes any one of transduction, transfection or electroporation. For example, the method described in the present invention may be: preparing an RNP complex of cas9 and sgRNA, incubating, then mixing the RNP complex with an optional repair template ssDNA, adding a hematopoietic stem cell suspension to be edited, electrotransferring, and culturing with a culture medium after the electrotransfer to obtain gene-edited hematopoietic stem cells.

[0116] The present invention also provides the use of the hematopoietic stem cells or progenitor cells in preparing medicines for treating tumors.

[0117] The present invention also provides the use of the hematopoietic stem cells or progenitor cells in combination with CAR-T cells in the preparation of drugs for treating tumors, the development of antibodies or antibody-like drugs combined with small molecules, and the development of immune cell therapy drugs expressing antibody-like molecules or CAR molecules.

[0118] In the present invention, hematopoietic stem cells modified with CD33 epitopes are combined with Anti-CD33 CAR-T, hematopoietic stem cells modified with CD19 epitopes are combined with Anti-CD19 CAR-T, and hematopoietic stem cells modified with BCMA epitopes are combined with Anti-BCMA CAR-T. Their application in the treatment research of tumor cell immunity is of great significance for alleviating the side effects of CAR-T products in tumor treatment and improving the quality of life of patients.

[0119] The present invention also provides a pharmaceutical composition, which comprises the hematopoietic stem cells or progenitor cells as described above. Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0120] The present invention also provides a treatment method, which comprises administering the above-mentioned pharmaceutical composition and CAR-T to a subject.

[0121] Wherein, the subject is an animal or a human suffering from a tumor.

[0122] Compared with the prior art, the present invention has the following beneficial effects:

[0123] The present invention is based on the design concept of gene editing to transform the normal conformation of antigen epitopes, block the immunity-related structure of the original surface protein, avoid it being targeted by antibodies while it still has normal biological functions, and provides different sgRNA designs to mutate the CD33 exon2 site of hematopoietic stem cells, so that the exon2 site is deleted, thereby causing the CD33 V domain to not be expressed, escaping the targeting and killing of anti-CD33 CAR-T cells, and solving the side effects caused by CAR-T cells while killing tumor cells; at the same time, in order to solve the problems of off-target and low efficiency faced by hematopoietic stem cells in the gene editing preparation process, the present invention further excludes sgRNAs that are easy to off-target and inefficient, and the prepared cells not only express the CD33 V domain, but also do not affect the CD33 The expression of the C domain, when co-incubated with CAR-T cells, has a high survival rate and is higher than that of cells after CD33 gene knockout. At the same time, the in vitro differentiation ability of HSC obtained by using the sgRNA is not affected. The present invention is a feasible means based on extensive basic research. It creates "tumor-specific" antigens by gene editing mutated hematopoietic stem cells to facilitate cellular immunotherapy, and solves the "on-target, off-tumor" problem caused by CAR-T cells targeting healthy cells in the patient's body that normally express target antigens while killing tumor cells, providing a new treatment idea for tumor immunotherapy.

[0124] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and through specific implementation methods. However, the following examples are only simple examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0125] The materials used in the following examples are shown in Table 1, and the remaining materials not mentioned can be purchased from conventional manufacturers in the field.

[0126] Table 1 Some experimental materials used in the examples

[0127]

[0128] In the following examples, the experimental methods used are as follows, and the remaining experimental methods not mentioned are all conventional experimental techniques and means known to those skilled in the art.

[0129] 1. Cell genotype identification

[0130] Collect about 1×10 5 cells, using PureLink TM Genomic DNA was extracted with the Genomic DNA Mini Kit (for mutant cells, genomic DNA was generally collected 72 hours after electroporation). Using genomic DNA as a template, AmpliTaqGoldTM 360 Master Mix PCR was used to amplify the DNA fragment covering the target region. The PCR product was sequenced and the base sequence map was obtained by Sanger sequencing to compare the sequence genotype.

[0131] 2. RT-qPCR identification of variable splicing of CD33 exon2 at the mRNA level

[0132] Collect about 1×10 6 cells, using PrimeScript TM RT reagent Kit was used to extract RNA from cells and then Premix DimerEraser TM The kit reverse transcribes RNA to obtain cDNA. Using cDNA as a template, a probe primer (E13) across CD33 exon2 is designed to specifically amplify the exon2 deleted sequence (m); the probe primer (E2) on exon2 can specifically amplify the exon2 normally expressed sequence (M), and the ct value of RT-qPCR is calculated and derived.

[0133] Finally, the m / Mct ratio reflects the degree of alternative splicing of CD33 exon2. The higher the ratio, the higher the exon2 deletion expression and the higher the occurrence of alternative splicing.

[0134] The common primers and probe primers used in the examples herein are shown in Table 2.

[0135] Table 2 Primers used in the examples

[0136] Primer name Sequence (5′to3′) SEQ ID NO. CD33-F GAAGCTGCTTCCTCAGACATGC 1 CD33-R ATGGTTCTCTCCGTAGTCACAC 2 CD33-similar-F GAAGCCTCTGCCTCAGACATGC 3 CD33-similar-R ATGGTTCTCTCCGTGGTCACAC 4 CD33-VIC-E2 ACAGTTACAAATCTCCCCAG 5 CD33-FAM-E13 TGCTGCCCCTGCTGTGGGCAGACTTGAC 6 CD33-E2F TCTTTCGGATGGAGAGAGGA 7 CD33-E1F ACACAGGAAGCCCTGGAAG 8 CD33-E3R GAGCAGGTCAGGTTTTTGGA 9

[0137] 3. Flow Cytometry Staining

[0138] Collect about 1×10 5 Cells were washed once with PBS + 2% fetal bovine serum buffer, and the supernatant was completely discarded. Human FcR-blocker was added, and the cells were blocked and incubated at 4°C in the dark for 10 minutes. After washing once, flow cytometry antibodies were added, mixed and incubated at 4°C in the dark for 30 minutes. After washing once, buffer (containing DAPI or 7-AAD) was added and detected on the machine.

[0139] 4. Electroporation

[0140] The LONZA electroporator was used, and the electroporation programs and electroporation kits recommended by the LONZA official website were used. The specific electroporation conditions used for each cell are shown in Table 3.

[0141] Take the required cells and centrifuge at 100g for 10 minutes. After centrifugation, completely remove the culture medium and resuspend with Lonza electroporation buffer. At the same time, prepare the RNP complex of cas9 and sgRNA and incubate at room temperature for 15 minutes. Then mix the ssDNA and RNP complex, add the cell suspension, transfer to the Lonza 16-well electroporation cup, and place it in the 4D-Nucleofector TM X unit, select the corresponding program for electroporation according to the cell type. After electroporation, carefully pipette the cell suspension into a 48-well plate and continue culturing with 1640 complete medium or hematopoietic stem cell-specific medium.

[0142] Table 3 Various cell electroporation conditions

[0143]

[0144]

[0145] 5. Design of sgRNA for editable epitope sites of CD33

[0146] Through literature data, we found the editable CD33 epitope site. There is a SNP site in the second exon region of CD33. When the SNP is C, CD33 is expressed normally (denoted as M); when the SNP site is T, CD33 produces variable splicing, the second exon is deleted and not expressed (denoted as m).

[0147] The hCD33 genome sequence was downloaded from the UCSC genome browser, and sgRNA was designed using the CHOPCHOP website. SgRNAs that were prone to off-target and inefficient were excluded, and the final selected sgRNAs are shown in Table 4 below.

[0148] Table 4 sgRNA and ssDNA sequences

[0149]

[0150]

[0151]

[0152] 6. Preparation of CD33 CAR-T cells

[0153] Thaw frozen healthy PBMCs and add 20 μL / 10 7CD3 microbeads were added to the cells and CD3-positive T cells were sorted out using LS sorting columns. T cells were activated with CD3 / CD28 antibody magnetic beads on the day of sorting. Viral transduction was performed 24-48 hours after activation. The M0I of the lentivirus packaged with CAR molecules was 3, and 800ng / μL PolyBrene and 1μg / μL DEAE were added to assist infection. After 24 hours of infection, the virus was removed by centrifugation at 300g for 10 minutes and replaced with fresh T culture medium.

[0154] Five days after T cells were infected with lentivirus, flow cytometry was used to detect the CAR positivity rate. The CD33-CAR molecule carries an EGFR tag, so EGFR antibody detection can reflect the CAR positivity rate.

[0155] 7. Co-incubation of CD33-CAR-T cells with edited target cells to detect mutation tolerance

[0156] After the target cells were electroporated and CD33 CAR-T cells were prepared, the two cells were mixed at a 1:30 effector-target ratio (taking 3e6 target cells as an example, the number of effector CAR-positive cells should be 1e5. If the CAR positivity in CAR-T cells is 10%, the number of CD33 CAR-T cells should be 1e6, that is, the co-incubation system contains 3e6 target cells and 1e6 CD33 CAR-T cells).

[0157] The T cell culture medium was used for 96 hours, during which the proportion of CD3 positive cells was detected, which could reflect the changes in CAR-T cells. Correspondingly, the proportion of CD3 negative cells could reflect the changes in the proportion of target cells after mutation.

[0158] During the period, the changes in the proportion of cells that can bind to CD33 P67.6 or HIM3-4 antibodies in the mutated target cells were detected synchronously. If the cells lost the ability to bind to P67.6 but still bound to HIM3-4, these mutated cells could survive, proving that the mutated cells could tolerate the killing of CD33CAR-T.

[0159] Example 1 The SNP genotype of the second exon of CD33 is associated with the alternative splicing of the exon

[0160] In order to explore the feasibility of modifying CD33 variable splicing by SNP site mutation, five AML cell lines (HL60, NB4, THP1, KG1, Molm13) expressing CD33 and CML cell K562 were first selected as research objects in this example.

[0161] (1) Collect genomic DNA from each cell line, design amplification primer pairs upstream and downstream of CD33 exon2, use gDNA as a template, perform PCR on the CD33 exon2 region, perform Sanger sequencing on the PCR product, open the sequencing file with SnapGene, and compare the genotype of the SNP site (rs12459419) on CD33 exon2 of each cell line.

[0162] The results showed that the CD33 exon2 SNP genotypes were not exactly the same among different AML / CML cell lines ( Figure 1 ): The shaded part is the CD33 exon 2 exon sequence, and the fourth base is the SNP site. The SNP site genotype of K562 and HL60 is T, while NB4, KG1, THP-1, and Molm13 are C genotypes.

[0163] (2) Cell RNA was collected and reverse transcribed into cDNA. Primers CD33-F / CD33-R were used to detect the loss of CD33 exon2 in different cell lines at the mRNA level by RT-PCR. The PCR band when exon2 was missing was 317 bp (m), and the PCR band when exon2 was present was 698 bp (M). When the template amount in each group was consistent, the weaker the m band, the higher the degree of variable splicing loss of exon2.

[0164] The results showed that the CD33 exon2 of cells with T genotype (K562, HL60) at the SNP site was more likely to undergo variable splicing and deletion ( Figure 2 ):

[0165] In K562 and HL60 cells, the proportion of the m band was greater than that of the M band, indicating that the CD33 exon2 deletion in K562 and HL60 cells was higher; in NB4 and THP1 cells, the strength of the m band and the M band was not much different, indicating that the variable splicing of CD33 exon2 in NB4 and THP1 cells was lower than that in K562 and HL60 cells; in Molm13 and KG1 cells, the proportion of the M band was higher, indicating that the degree of variable splicing of CD33 exon2 in these two cells was lower.

[0166] (3) In order to more accurately quantify the proportion of exon2 variable splicing deletions, a probe (CD33-FAM-E13) across CD33 exon2 was further designed in this example. The RT-qPCR primers CD33-E2F and CD33-E3R can specifically identify the deletion of exon2 (denoted as m); the probe (CD33-VIC-E2) is on exon2, and the RT-qPCR primers CD33-E1F and CD33-E3R can specifically indicate the normal expression of exon2 (denoted as M), as shown in FIG. Figure 3A shown.

[0167] Cell RNA was collected and reverse transcribed into cDNA. RT-qPCR was used to detect the loss of CD33exon2 in different cell lines at the mRNA level. The higher the m / M ratio, the higher the degree of alternative splicing loss of exon2.

[0168] The results showed that the CD33 exon2 of cells with T genotype (K562, HL60) at the SNP site was more likely to undergo variable splicing and deletion ( Figure 3B ):

[0169] Using Raji cells as a control, the CD33 exon2 m / M ratios of various AML / CML cell lines relative to Raji cells were statistically analyzed. In K562 and HL60 cells with SNP genotype T, the m / M ratios were more than 5 times that of the control group, followed by THP-1 and NB4 cells with SNP genotype C. The m / M ratios of KG1 and Molm13 cells with SNP genotype C were no different from those of the control group, or even lower (<1 times).

[0170] (4) Flow cytometry was used to further verify the expression of CD33 exon2 protein levels.

[0171] Studies have shown that the P67.6 clone-derived antibody can specifically bind to the CD33 V domain, so it can be used to indicate the expression of exon2 (M). Cells with variable splicing deletions of exon2 cannot bind to P67.6. The HIM3-4 clone-derived antibody can specifically recognize the CD33 C domain and can be normally bound regardless of whether exon2 is deleted or not (Total).

[0172] AML / CML living cells were collected and co-stained with CD33-P67.6 and CD33-HIM3-4 direct-labeled antibodies. The expression of CD33 exon2 and total protein was detected by flow cytometry, and the mean fluorescence intensity (MFI) was calculated. The ratio of Total / M MFI reflected the variable splicing of CD33 exon2. The larger the ratio, the higher the loss of CD33 exon2.

[0173] Flow cytometry results showed that the binding capacity of K562 cells to P67.6 antibody was significantly lower than that of other AML / CML cell lines, while the expression of Molm13 was the highest; and K562 cells had the highest Total / M MFI ratio, the highest loss of CD33 exon2, and the lowest loss of Molm13 exon2 ( Figure 4A , Figure 4B ):

[0174] Gray is the isotype control of each flow cytometry antibody. The ability to bind to P67.6 can reflect the expression of CD33M. It can be seen that CD33exon2 is not expressed by variable shearing:

[0175] K562<HL60<THP1<NB4 / KG1<Molm13.

[0176] The ability to bind HIM3-4 reflects the expression of total CD33 protein:

[0177] K562<HL60<THP1<NB4<KG1<Molm13.

[0178] Statistical analysis of the ratio of CD33 Total / M MFI in each cell line:

[0179] K562>HL60>THP1>KG1>NB4>Molm13;

[0180] The results showed that the degree of CD33 exon2 deletion in K562 cells was the highest, and that in Molm13 exon2 was the lowest, which was basically consistent with the expression of CD33 exon2 detected at the mRNA level.

[0181] In this example, a method system that can effectively identify the genotype of the SNP site and the variable splicing phenotype is preliminarily established. The genotype of the SNP site can be clearly indicated by Sanger sequencing. The means of RT-PCR / RT-qPCR and P67.6 clone-derived flow antibody detection can indicate the proportion of CD33 exon2 variable splicing deletion, laying a method foundation for the next step of mutating CD33 exon2 SNP to change the variable splicing of CD33 for concept verification. The preliminary conclusion obtained in this example is that the cells with SNP T genotype have a higher degree of variable splicing, which provides a basis for the next step of designing SNP C to T mutation to increase the jump expression of CD33 exon2.

[0182] Example 2 Mutation of CD33 exon2 3'ss and SNP can enhance its alternative splicing

[0183] (1) HL60, K562, and NB4 are more suitable cells for electroporation among AML / CML cells.

[0184] After preliminarily exploring the CD33 exon2 SNP genotypes and exon2 expression levels of several AML / CML cells, in order to further perform mutation editing based on each cell line, we initially used a plasmid containing pmax-GFP to explore the electroporation conditions suitable for each cell line.

[0185] LONZA electroporator was used. Countstar cell counter was used to count cell viability 24 hours after electroporation, and FACS flow cytometry was used to detect the GFP positive rate of cells.

[0186] The results showed that K562, HL60, and NB4 had better cell viability and higher GFP positive rate after electroporation, and were more suitable for later electroporation editing ( Figure 5 , where Figure I is the GFP positive rate, and Figure II is the cell viability):

[0187] The viability of K562 and HL60 cells 24 hours after electroporation was very high, at over 95%, and the GFP positivity of K562 and HL60 was also above 95%, ranking the highest; the viability of NB4 cells 24 hours after electroporation was also very high, at around 95%, but its GFP positivity was around 65%; the viability of KG1 cells after electroporation was around 60%, but its GFP positivity was less than 40%, making it slightly more difficult to edit mutations in the cells later; the viability of THP1 and Molm13 cells after electroporation was only around 10%, and their GFP positivity was also less than 10%, making them unsuitable for electroporation editing mutations later.

[0188] (2) 3'ss site mutation can induce CD33 exon2 jump expression in HL60 and K562

[0189] Since the SNP sites in K562 and HL60 cells are already T genotypes, only mutations at the 3'ss sites can further increase variable splicing.

[0190] In this example, a single-base cytosine editor A3A-CBE3 based on CRISPR-Cas9 technology was used, and sgRNA (sg8: SEQ ID NO: 13, sg13: SEQ ID NO: 16) that can mutate the G base at the 3'ss AG site was designed, and the CBE plasmid and sgRNA plasmid were electrotransfected into cells. The genomic DNA of the cells on the 7th day after electrotransfection was collected, and the CD33 exon2 region was PCR-derived using primers CD33-F / CD33-R, and the PCR product was Sanger sequenced. The sequencing file was opened with SnapGene to compare the mutation status of the G base at the 3'ss AG site of CD33 exon2.

[0191] The results showed that both sgRNA8 and sgRNA13 could effectively mutate the G base at the 3'ss site in K562 and HL60 cells ( Fig. 6A , Figure 6B ):

[0192] The shaded part is the CD33 exon 2 exon sequence, and the first two bases of exon 2, AG, are the 3'ss site.

[0193] In K562 and HL60 cells, cells that were only electroporated with CBE were used as blank controls, and their 3'ss site was AG; under the mediation of sgRNA8 or sg13, the base C on the complementary chain where sg8 and sg13 were located was directed mutated to T by CBE, so the G base at the 3'ssAG site showed a mutation to the A base.

[0194] The inventors further used the RT-qPCR method for identifying exon2 deletion in Example 2 to detect the effect of 3'ss mutation on exon2 alternative splicing.

[0195] The results showed that 3'ss mutation could enhance the alternative splicing of K562 and HL60 exon2 ( Figure 6C , Fig.6D ):

[0196] In K562 cells, the ratio of E13 / E2 in the sg8 group was higher than that in the sg13 group, and both sg8 and 13 in the edited group were higher than those in the blank control group, indicating that the exon2 variable splicing of the edited cells increased. The 3'ss mutation efficiency of the sg8 group was higher than that of sg13, so the exon2 deletion caused by it was also higher.

[0197] In HL60 cells, the E13 / E2 ratios in the sg8 and sg13 groups were higher than that in the blank control group, indicating that the 3'ss mutation in HL60 cells would also lead to the jumping expression of CD33 exon2.

[0198] Example 3 Sg4-mediated SNP site and 3'ss mutation can effectively induce CD33 exon2 deletion in NB4

[0199] In this embodiment, based on CRISPR-Cas9 technology, Cas9 protein and sgRNA are used to form RNP, and a ssDNA repair template is provided. The SNP site on the ssDNA is T, and the 3'ss site is CT. The RNP and ssDNA are delivered into the cell by electroporation.

[0200] By utilizing homologous recombination (HDR) during the cell repair process, the sgRNA binding site on CD33 exon2 of the cell genome will be partially repaired using ssDNA as a repair template after Cas9 cutting, and the SNP and 3'ss sites will be replaced from the original C, AG to T, CT.

[0201] (1) Sg4 can effectively mutate SNP and 3'ss sites

[0202] Based on previous studies, cells with SNP genotype C have less variable splicing, which is a better cell model for exploring SNP mutation to change variable splicing. NB4 cells are superior to SNP C cells such as THP1 and KG1 in terms of electroporation rate and efficiency.

[0203] Therefore, in this example, sgRNA and corresponding ssDNA were designed for SNP sites on NB4 cells, including sg4: SEQ ID NO: 10 and its ssDNA: SEQ ID NO: 21, sg9: SEQ ID NO: 14 and its ssDNA: SEQ ID NO: 23, sg12: SEQ ID NO: 15 and its ssDNA: SEQ ID NO: 24. In order to mutate SNP and 3'ss sites at the same time, a new combination of ssDNA and original sg4 (ssDNA: SEQ ID NO: 22) and a combination of ssDNA and sg9 (ssDNA: SEQ ID NO. 28) were designed, and the sgRNA (SEQ ID NO: 17) and ssDNA (SEQ ID NO: 25) of CD33-KO reported in the literature were used as controls. The SNP site and 3'ss site were mutated by electroporation of RNP combined with ssDNA into cells.

[0204] The results showed that sg4 could simultaneously and efficiently induce CD33 SNP mutation and 3'ss mutation in NB4 cells ( Figure 7 ):

[0205] The group into which only cas9 protein was transferred was used as a control. The SNP site and 3'ss site on CD33 exon2 in its genome had no mutation (each sequencing site was a single peak graph). The KO group reported in the literature was used as a positive control. Due to the insertion mutation from T to TT in CD33exon2, the transcription and translation of CD33 had frameshift mutations, and CD33 was knocked out.

[0206] In the ssDNA electroporation group of RNP complex combined with mutation SNP site, sg4 can effectively mutate SNP from C (blue peak) to T (red peak), sg12 wild type C genotype (blue peak) and SNP mutated T genotype (red peak) accounted for about 50% respectively, while the sg9 from C (blue peak) to T (red peak) was the lowest.

[0207] In the ssDNA electroporation group of RNP complex combined with simultaneous mutation of SNP site and 3'ss site, sg4 can efficiently mutate SNP from C (blue peak) to T (red peak), and simultaneously mutate 3'ss site from AG to CT. Since the PAM end of Sg12 is farther from 3'ss than sg9, it is not as good as sg9 in mediating mutation of 3'ss, so sg9 is selected in this example to mediate simultaneous mutation of SNP and 3'ss site.

[0208] The results showed that the editing efficiency of sg9 combined with ssDNA with simultaneous mutations in SNP and 3'ss sites was not high. In the sequencing peak graph, there was basically no mutation in the SNP site, and the 3'ss site showed overlapping peaks of AG wild type and CT mutant type, with a mutation efficiency of less than 20%.

[0209] (2) Sg4-mediated SNP and 3'ss mutation can effectively mediate the alternative splicing of CD33 exon2

[0210] RT-qPCR and FACS were used to detect the effects of SNP and 3'ss mutation on the expression of NB4CD33 exon2.

[0211] The results showed that SNP sites and 3'ss mutations can effectively induce variable splicing of CD33 exon2 of NB4:

[0212] RT-qPCR results showed that the CD33 E13 / E2 ratio of the mutant SNP site (RNP-C) was higher than that of the non-mutated group, and the CD33 E13 / E2 of the mutant SNP and 3'ss sites (RNP-C+ag) was the highest, indicating that both SNP mutation and 3'ss mutation promoted the variable splicing of CD33 exon2 ( Fig. 8A ).

[0213] The results of flow cytometry antibody staining showed that about 60% of cells with SNP mutation lost the ability to bind to the P67.6 antibody, and about 80% of NB4 with both SNP and 3'ss mutations did not bind to the P67.6 antibody. This indicates that both SNP and 3'ss mutations can promote the loss of CD33exon2, and then the CD33 V domain is not expressed, and has no ability to bind to the P67.6 antibody ( Figure 8B ).

[0214] However, in this embodiment, the mutation SNP and 3'ss strategy is intended not to affect the expression of CD33 total protein, but only to mutate several bases to affect the expression of CD33 V domain, so as to escape the killing of CAR-T targeting CD33 V domain. The results showed that the mutated cells were basically the same as those in the complete knockout (KO group) and did not bind to CD33 HIM-3-4 antibody. Only about 10% of the mutated cells did not bind to P67.6 but still bound to HIM3-4. The genotype of these cells needs to be further identified.

[0215] Example 4 AATCC mutation leads to loss of CD33 exon2 without affecting the C domain

[0216] Although the strategy of mutating the SNP site or 3'ss site in the early stage can cause the CD33 V domain to not be expressed, the CD33 C domain (HIM-3-4 antibody binding ability) is also affected. Therefore, the inventors sorted out the NB4 cells that did not bind to P67.6 but still bound to HIM3-4 after mutation by Tyto flow sorting (PE+), and used the cells that did not bind to HIM3-4 as the control (PE-), such as Fig. 9 As shown in Figure I, the genotype of the cell population was identified in a relatively more homogeneous cell population after sorting.

[0217] The results showed that the AATCC mutation (such as Fig. 9 (as shown in Figure II):

[0218] In sg4-mediated SNP-mutated NB4 cells:

[0219] 4.85% of the PE+ cell population was sorted out, which mainly showed the wild-type C genotype at the SNP site, but showed the mutation of TTTCT to AATCC at the TTTCT site;

[0220] PE- cells have a C to T mutation at the SNP site, and there are also a large number of indels, which are mainly frameshift mutations caused by Cas9 protein cutting.

[0221] In NB4 cells with sg4-mediated simultaneous mutation of SNP and 3'ss site:

[0222] 4% of the PE+ cell population was sorted out, and the SNP and 3'ss sites also showed mainly wild-type genotypes. Similarly, at the TTTCT site, there was a peak of mutation from TTTCT to AATCC; PE- cells had mutations from C to T and AG to CT at the SNP and 3'ss sites, as well as mixed peaks caused by frameshift mutations.

[0223] That is, whether the SNP is mutated or the SNP and 3'ss site are mutated simultaneously, the CD33 V domain is destroyed, and the C domain is not affected. A small group of cells (about 10%) are actually AATCC mutations.

[0224] Example 5: sg4 targeting SNP and 3'ss mutation has off-target effects. The modified sg4-14\sg4-15 can greatly reduce the risk of off-target effects.

[0225] Based on the introduction of AATCC mutations found in the previous strategy of targeting SNPs and 3'ss mutations, the inventors compared CD33 with the sequences of possible off-target positions of sgRNA on the genome (homologous sequences) to detect whether endogenous repair may exist, that is, after the CD33 exon2 position is broken after being cut by Cas9 protein, it is partially repaired using the CD33 homologous sequence as a template, and then the original sequence will be replaced by the homologous sequence.

[0226] (1) Sequence comparison revealed that the introduction of the AATCC mutation was indeed an endogenous repair.

[0227] A gene on human chromosome 19 has a sequence highly similar to CD33 ( Fig. 10A ), the introduction of AATCC mutation is actually the result of the rupture after Cas9 protein cutting, and the partial repair using the homologous sequence as a template, resulting in the original TTTCT being mutated to AATCC. And because the probability of endogenous template repair is lower than that of artificially provided ssDNA template repair, SNP and 3'ss mutation genotypes accounted for the majority in the early mutation strategy, and the AATCC mutation was detected by Sanger sequencing only after the inventors sorted out the small group of cells.

[0228] (2) Compare the sequences of the targeted SNP and 3'ss sgRNA to identify the possibility of off-target effects.

[0229] The results showed that among the sgRNAs previously used for mutation of SNP and 3'ss, except for sg4 which differed from the CD33-like sequence at the 18th base, the other sgRNAs completely matched the homologous sequence of CD33, posing a serious risk of off-target effects.

[0230] In this example, in order to further verify whether sg4 would mismatch with the CD33 homologous sequence and cause off-target, only Cas9 protein and sg4 were transferred into NB4 cells. Primers were designed for the CD33 region and the homologous region, and the PCR products were sequenced to detect the cleavage of Cas9 protein in CD33 and the homologous region.

[0231] The results showed that both the CD33 region and the homologous region had frameshift mutations ( Fig. 10B ):

[0232] In the CD33 region: when only Cas9 protein was transferred, no mutation occurred; when Cas9 protein and sg4 were transferred, a large number of frameshifts occurred in the CD33 exon2 region.

[0233] In the CD33 homologous region: when only Cas9 protein was transferred, no mutation occurred; when Cas9 protein and sg4 were transferred, a small amount of frameshift occurred in the CD33 homologous region, proving that sg4 was indeed partially off-target, causing the Cas9 protein to produce non-specific cutting at a similar sequence position of CD33.

[0234] (3) Furthermore, the base at position 14 (sg4-14: SEQ ID NO: 11) or position 15 (sg4-15: SEQ ID NO: 2) on sg4 was replaced to reduce the possibility of sg4 off-targeting to the CD33 homologous region.

[0235] Similarly, sgRNA and cas9 were used to form an RNP complex, and ssDNA with SNP C to T mutation was provided, which was electroporated into NB4 cells. PCR and Sanger sequencing of CD33 and CD33 homologous sequences were performed to identify the efficiency and off-target possibility of the modified sg4-mediated SNP mutation.

[0236] The results showed that both sg4-14 and sg4-15 could effectively mediate the mutation of SNP site C to T on CD33 exon2. After the mutation, the exon2 of the cells was missing and could not bind to CD33 P67.6 antibody:

[0237] Sg4-14 and sg4-15 mediate the SNP site on CD33 exon2 to show a C and T nested peak, indicating that even if Sg4 is replaced with bases 14 or 15, it can still bind to the CD33 region normally and mediate the mutation of the SNP site ( Fig.11A ).

[0238] In the CD33 homologous region, the sequencing indel was very low, indicating that the modified Sg4 rarely went off-target to the CD33 homologous region.

[0239] FACS results showed that ( Fig. 11B ), 60% of the cells in the sg4-14 mutant group did not bind to P67.6, and about 20% of the cells did not bind to P67.6 and normally bound to HIM3-4; 50% of the cells in the sg4-15 mutant group did not bind to P67.6, and about 26% of the cells did not bind to P67.6 and normally bound to HIM3-4.

[0240] Therefore, although the previous strategies targeting SNP sites and 3′ss mutations could not avoid off-target problems with the sgRNAs nearby, sg4-14 and sg4-15 after Sg4 modification can still serve as mutated SNP sites and promote the role of variable splicing of CD33 exon2.

[0241] Example 6 Sg3 and sg10-mediated AATCC mutations can efficiently induce CD33 exon2 deletion in NB4

[0242] In addition to the fact that mutated SNP sites or 3'ss sites promote exon2 jumping expression from the perspective of upregulating alternative splicing, the AATCC mutation is a promising mutation site that the inventors unexpectedly discovered.

[0243] This mutation exists naturally, and preliminary results show that the mutated AATCC can not only block the antibody binding of CD33 V domain, but also does not affect the binding of CD33 C domain, which means that the AATCC mutation can escape the killing of CD33-CAR-T or GO drugs targeting CD33 V region, and the mutation has little effect on the expression of the entire CD33 protein, and can minimize the impact on the normal function of CD33 protein.

[0244] The inventors designed sgRNA for the TTTCT site (sg3: SEQ ID NO: 18, sg7: SEQ ID NO: 19, sg10: SEQ ID NO: 20), provided ssDNA containing AATCC mutation (SEQ ID NO: 26) as the repair template for sg3 and sg7, and provided ssDNA containing AATCC mutation (SEQ ID NO: 27) as the repair template for sg10. 72 hours after electroporation of NB4 cells, PCR was performed to identify the CD33 exon2 region, and sequencing was used to detect the mutation efficiency.

[0245] The results showed that sg3 and sg10 could effectively mediate AATCC mutation. After mutation, cells did not bind to CD33-P67.6 clone antibody, and the binding ability of CD33 C domain was basically unaffected, only showing knockout caused by partial indel ( Fig. 12A ):

[0246] The results of genome Sanger sequencing showed that in the sg3 or sg10-mediated mutation group, the TTTCT on the CD33 region was mutated to AATCC, and in the CD33 homologous region, the sequencing peak was single and had no difference from the group with only electroporation of cas9, indicating that sg3 and sg10 would not off-target to the CD33 homologous sequence to produce nonspecific cutting. sg7 had almost no mutations at the TTTCT site, but produced some overlapping peaks in the CD33 homologous region, indicating that sg7 would partially mismatch to the CD33 homologous region and produce nonspecific cutting.

[0247] FACS results showed that ( Fig. 12B ), the percentage of cells with sg3 mutation that do not bind to P67.6 and normally bind to HIM3-4 is as high as 73.2%, and the percentage of cells with sg10 mutation that do not bind to P67.6 and normally bind to HIM3-4 is 62.2%, while in the previous strategy, the percentage of cells with sg4-14 or sg4-15 mutation SNPs that do not bind to P67.6 and normally bind to HIM3-4 is only 20%-30%.

[0248] Example 7 sg10-mediated AATCC mutation is more resistant to killing by Anti-CD33-CAR-T

[0249] Although the modified sg4 (sg4-14, sg4-15) can effectively mutate SNP or 3′ss site and lead to variable splicing of CD33exon2, and rarely off-target to the CD33 homologous region, only 20%-30% of them lose the ability to bind to the V region and do not affect the binding of the C region.

[0250] Under the same condition of not off-target, sg10 can effectively mutate AATCC, and the mutated cell V region almost loses the antibody binding ability, and 60%-70% of the C region is still unaffected. Therefore, the inventors chose AATCC mutation for later killing tolerance experiments and HSC editing differentiation.

[0251] To further explore whether the mutated cells can tolerate CD33-CAR-T killing, the inventors first prepared CAR-T cells targeting CD33, and obtained CD33-CAR-T cells that stably expressed CAR by infecting activated T cells with lentivirus containing CAR molecules. 72 hours after infection, the conversion of CAR was detected by flow cytometry.

[0252] FACS results showed that CAR-positive cells accounted for 66.3% ( Fig.13 ).

[0253] The inventors further designed a co-incubation experiment of NB4 cells after AATCC (sg3, sg10) or SNP mutation (sg4-14, sg4-5) and Anti-CD33-CAR-T, and the effector-target ratio of CAR-positive cells in CD33-CAR-T cells to NB4 target cells was 1:30.

[0254] From the time when CD33-CAR-T cells and edited NB4 cells were co-cultured, CD3-positive cells were detected by flow cytometry, representing CAR-T cells, and CD3-negative cells represented target cells. At the same time, CD33 P67.6 and HIM-3-4 antibodies were stained by flow cytometry to verify whether the NB4 cells that tolerated CAR-T killing were mutant cell populations.

[0255] The co-incubation results showed that sg10-edited cells could tolerate CD33-CAR-T killing:

[0256] The ratio of CAR-T and edited NB4 cells was detected at 0 hours after co-incubation. CD3-negative cells were NB4 cells, and CD3-positive cells were CD33-CAR-T cells. The 66.3% CAR-positive CAR-T cells and edited NB4 cells were calculated according to a 1:30 effector-target ratio. Theoretically, NB4 cells accounted for 95.2%. Under actual operational errors, FACS results showed that the initial ratio of NB4 target cells in each group was between 93.1% and 95.2%, which was an acceptable fluctuation ( Fig.14A ).

[0257] After 96 hours of co-incubation, the proportion of cells in the electroporated cas9-unedited group was gradually killed by CD33-CAR-T from the initial 95.2% to 2.87%, sg4-15-edited NB4 cells were killed to 23.4%, sg4-14-edited NB4 cells were killed to 57.4%, sg3-edited NB4 cells were killed to 71.2%, and sg10-edited NB4 cells were still 94.6%, which was higher than the 90.7% of CD33 KO NB4 cells ( Fig. 14B ).

[0258] The antibody binding ability of the CD33 V region and C region of the target cells after mutation was detected from 0 hours of co-incubation. The results showed that at 0 hours, 67.5% of the CD33 V region of the unmutated group of cells could still be recognized by the P67.6 antibody, 10.07% of the NB4 cells edited by sg4-15 could be recognized by the P67.6 antibody, 13.3% of the NB4 cells edited by sg4-14 could bind to the P67.6 antibody, 4.11% of the NB4 cells edited by sg3 could be recognized by the P67.6 antibody, 0.84% ​​of the NB4 cells edited by sg10 could be recognized by the P67.6 antibody, and 4.49% of the NB4 cells of CD33 KO could be recognized by the P67.6 antibody ( Fig. 14C ).

[0259] After 96 hours of incubation, the mutant target cell population that tolerated CD33-CAR-T killing was detected. The results showed that NB4 cells that could bind to CD33P67.6 antibody were targeted and killed by CD33-CAR-T, and cells that still had normal C domain antibody binding ability after mutation could tolerate killing ( Fig.14D ).

[0260] By detecting the proportion of mutant cells at 0 hours, 22 hours, 44 hours, 68 hours, and 96 hours after co-incubation, it was found that with the killing of CAR-T cells, the sg10 mutant group cells escaped the killing of CD33-CAR-T, while the sg3, sg4-14, and sg4-15 mutant group cells still activated CD33-CAR-T cells, causing the killing and rapid proliferation of CAR-T cells, and then the target cells were killed to death or the proportion of target cells in the whole body continued to decrease ( Fig.14E ).

[0261] Example 8 Sg10-mediated AATCC mutation has no effect on in vitro directed differentiation of HSC

[0262] Based on previous experiments, the present invention has verified in NB4 AML cells that the RNP complex combined with ssDNA electroporation can produce site-directed mutations, among which sg10-mediated AATCC mutations can affect the binding ability of CD33 P67.6 antibodies, and after editing, NB4 cells tolerate the killing of Anti-CD33 CAR-T.

[0263] Therefore, in this example, the mutation strategy was further applied to the editing of hematopoietic stem cells HSC to detect whether the RNP method can effectively induce the AATCC mutation of HSC, and flow cytometry was used to detect whether the antibody binding ability of the CD33 V region of the HSC was destroyed after the mutation.

[0264] The results showed that Cas9 and sg10 formed an RNP complex and provided a ssDNA template containing the AATCC mutation. After electroporation into HSC, it also caused some AATCC mutations in HSC ( Fig.15A ), and the CD33 V region of the mutated cells lost its ability to bind antibodies ( Fig. 15B ):

[0265] At the TTTCT site, in the control group where only cas9 protein was electroporated, there was no sgRNA mediation, so there was no cas9 protein cutting, and the TTTCT site sequencing showed a single peak ( Fig.15A );

[0266] When cas9 protein and sg10 were transferred and AATCC repair template was provided, overlapping peaks of TTTCT wild type and AATCC mutant were shown at the TTTCT site. However, the peak value of AATCC after mutation was lower than that of the original TTTCT, so the mutation efficiency in HSC cells needs to be optimized.

[0267] Flow cytometry showed that the CD33 V region of the non-mutated cells had normal antibody binding ability (P67.6 positive), and the C region could still bind antibodies normally (HIM3-4 positive); the C region of the mutated cells was not affected (HIM3-4 positive), and the antibody binding ability of the V region was destroyed (P67.6 negative), indicating that the V region structure of the mutated cells changed, which could escape the killing of CD33 CAR-T targeting the V region, and its C region was not affected ( Fig. 15B ).

[0268] To further explore whether the edited HSCs have normal differentiation ability, the inventors evaluated the ability of HSCs to differentiate into monocytes in vitro at the cellular level. The proportion of CD14-positive cells was detected on days 1, 5, 9, and 14 of differentiation by adding culture medium that induced myeloid monocyte differentiation of HSCs in vitro.

[0269] The results showed that HSCs in the Sg10 editing group had normal myeloid monocyte differentiation ability in vitro:

[0270] CD14-PE was used to detect the monocytes of the non-mutated group (orange) and AATCC mutated HSC cells (purple) on the 14th day. The results showed that both the mutated group and the non-mutated group cells could be normally differentiated into monocytes ( Fig. 15C ).

[0271] The proportion of CD14 positive cells on days 1, 5, 9, and 14 of differentiation was recorded. The results showed that the differentiation trend of the mutated cells (red) was basically consistent with that of the unedited group (black). Moreover, at the end point of differentiation, day 14, the proportion of HSCs differentiating into CD14 monocytes after mutation was even higher than that of the unedited group ( Fig.15D ).

[0272] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention. SEQUENCE LISTING <110> Shanghai Reindeer Biotechnology Co., Ltd. <120> A gene-edited hematopoietic stem cell and its combined application with CAR-T cells <130> P11144-PI-CN <150> CN 202110461504.3 <151> 2021-04-27 <160> 28 <170> PatentIn version 3.5 <210> 1 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> CD33-F <400> 1 gaagctgctt cctcagacat gc 22 <210> 2 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> CD33-R <400> 2 atggttctct ccgtagtcac ac 22 <210> 3 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> CD33-similar-F <400> 3 gaagcctctg cctcagacat gc 22 <210> 4 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> CD33-similar-R <400> 4 atggttctct ccgtggtcac ac 22 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD33-VIC-E2 <400> 5 acagttacaa atctccccag 20 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> TGCTGCCCCTGCTGTGGGCAGACTTGAC <400> 6 tgctgcccct gctgtgggca gacttgac 28 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD33-E2F <400> 7 tctttcggat ggagagagga 20 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CD33-E1F <400> 8 acacaggaag ccctggaag 19 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD33-E3R <400> 9 gagcaggtca ggtttttgga 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sg4 <400> 10 gaaatttgga tccatagcca 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sg4-14 <400> 11 gaaattagga tccatagcca 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sg4-15 <400> 12 gaaatatgga tccatagcca 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sg8 <400> 13 agggcccctg tggggaaacg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sg9 <400> 14 tgaccctcgt ttccccacag 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sg12 <400> 15 tcgtttcccc acaggggccc 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sg13 <400> 16 gggcccctgt ggggaaacga 20 <210> 17 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> KO <400> 17 gtcagtgacg gtacagga 18 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sg3 <400> 18 tgcacttgca gccagaaatt 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sg7 <400> 19 agaaatttgg atccatagcc 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sg10 <400> 20 aaatttctgg ctgcaagtgc 20 <210> 21 <211> 130 <212> DNA <213> Artificial Sequence <220> <223> ssDNA-SNP(sg4 / 4-14 / 4-15) <400> 21 ctgcccctgc tgtgggcagg tgagtggctg tggggagagg ggttgtcggg ctgggccgag 60 ctgaccctcg tttccccaca ggggtcctgg ctatggatcc aaatttctgg ctgcaagtgc 120 aggagtcagt 130 <210> 22 <211> 130 <212> DNA <213> Artificial Sequence <220> <223> ss-DNA-SNP+3'ss(sg4) <400> 22 ctgcccctgc tgtgggcagg tgagtggctg tggggagagg ggttgtcggg ctgggccgag 60 ctgaccctcg tttccccacc tgggtcctgg ctatggatcc aaatttctgg ctgcaagtgc 120 aggagtcagt 130 <210> 23 <211> 130 <212> DNA <213> Artificial Sequence <220> <223> ssDNA-SNP(sg9) <400> 23 tgcagggcac gaggacgcac aaaccctcct gtaccgtcac tgactcctgc acttgcagcc 60 agaaatttgg atccatagcc aggactcctg tggggaaacg agggtcagct cggcccagcc 120 cgacaacccc 130 <210> 24 <211> 130 <212> DNA <213> Artificial Sequence <220> <223> ssDNA-SNP(sg12) <400> 24 agaaagtgca gggcacgagg acgcacaaac cctcctgtac cgtcactgac tcctgcactt 60 gcagccagaa atttggatcc atagctagga cccctgtggg gaaacgaggg tcagctcggc 120 ccagcccgac 130 <210> 25 <211> 139 <212> DNA <213> Artificial Sequence <220> <223> ssDNA-KO <400> 25 aaccagtaac catgaactgg ggagttcttg tcgtagtagg gtatgggatg gaagaaagtg 60 cagggcacga ggacgcacaa accctccttg taccgtcact gactcctgca cttgcagcca 120 gaaatttgga tccatagcc 139 <210> 26 <211> 135 <212> DNA <213> Artificial Sequence <220> <223> ssDNA-TTTCT(sg3 / 7) <400> 26 gggcaggtga gtggctgtgg ggagaggggt tgtcgggctg ggccgagctg accctcgttt 60 ccccacaggg gccctggcta tggatccaaa aatccggctg caagtgcagg agtcagtgac 120 ggtacaggag ggttt 135 <210> 27 <211> 135 <212> DNA <213> Artificial Sequence <220> <223> ssDNA-TTTCT(sg10) <400> 27 tgtcgtagta gggtatggga tggaagaaag tgcagggcac gaggacgcac aaaccctcct 60 gtaccgtcac tgactcctgc acttgcagcc ggatttttgg atccatagcc agggcccctg 120 tggggaaacg agggt 135 <210> 28 <211> 130 <212> DNA <213> Artificial Sequence <220> <223> ss-DNA-SNP+3'ss(sg9) <400> 28 tgcagggcac gaggacgcac aaaccctcct gtaccgtcac tgactcctgc acttgcagcc 60 agaaatttgg atccatagcc aggactcagg tggggaaacg agggtcagct cggcccagcc 120 cgacaacccc 130

Claims

1. A cell having a cell surface protein, wherein the cell surface protein is modified to have an antigenic epitope change, and the antigenic epitope change enables the cell to resist killing by CAR-T or antibody drugs; The cell surface protein is CD33, and in the CD33 gene of the cell: TTTCT in the second exon is replaced by AATCC; wherein the cells are hematopoietic stem cells; The TTTCT in the second exon is the TTTCT corresponding to the target sequence of SEQ ID NO: 18 or 20.

2. Use of the cell according to claim 1 in combination with CAR-T or antibody drugs in the preparation of anti-tumor drugs, wherein: The tumor is a blood tumor, and the blood tumor is AML.

3. The use according to claim 2, wherein the CAR-T or antibody drug can target the cell surface protein of tumor cells to kill the tumor cells, and the cell surface protein expressed by the cells is modified to have an antigenic epitope change, and the antigenic epitope change enables the cells to resist killing by the CAR-T or antibody drug.

4. A method for preparing a cell, wherein a cell surface protein of the cell has an antigenic epitope change that can resist killing by CAR-T or antibody drugs, and the method comprises gene editing the coding gene of the cell surface protein; The cell surface protein is CD33, and the gene editing is: mutating the nucleotide TTTCT in the second exon to AATCC; wherein the cells are hematopoietic stem cells; wherein the TTTCT in the second exon is the TTTCT corresponding to the target sequence of SEQ ID NO: 18 or 20, in, The method is not a method for diagnosis or treatment of disease.

5. The method of claim 4, wherein the gene editing is performed by introducing the CRISPR gene editing system into the cell.

6. The method of claim 5, wherein the nucleotide TTTCT in the second exon is mutated to AATCC's CRISPR gene editing system includes sgRNA, the sequence of which is SEQ ID NO: 18 or 20.

7. The method of claim 5, wherein the nucleotide TTTCT in the second exon is mutated to AATCC's CRISPR gene editing system includes sgRNA and ssDNA, the sequence of the sgRNA is SEQ ID NO: 18 or 20, and the sequence of the ssDNA is SEQ ID NO:

26.

8. A pharmaceutical composition comprising (i) a CAR-T or antibody drug, and (ii) normal cells, wherein the CAR-T or antibody drug can target a cell surface protein of a tumor cell and kill the tumor cell, and the cell surface protein expressed by the normal cell is modified to have an antigenic epitope change, and the antigenic epitope change enables the normal cell to resist killing by the CAR-T or antibody drug; The cell surface protein is CD33, and in the CD33 gene of the normal cell: TTTCT in the second exon is replaced by AATCC; The normal cells are hematopoietic stem cells; The TTTCT in the second exon is the TTTCT corresponding to the target sequence of SEQ ID NO: 18 or 20.

9. The pharmaceutical composition of claim 8, wherein the tumor cells are blood tumor cells.

10. The pharmaceutical composition of claim 8, wherein the tumor cells are AML cells.

Images