Method for detecting TLR10 rs28393318 genotype and its application in evaluating long-term transplanted renal function

Abstract

The present invention provides a method for detecting the TLR10 rs28393318 genotype and its application in evaluating the long-term graft function of renal transplant recipients. The genotype of TLR10 rs28393318 can be used to predict the long-term graft function of renal transplant patients, thereby guiding clinical treatment to improve the long-term survival rate of transplanted kidneys. Therefore, the method for detecting the TLR10 rs28393318 genotype provided by the present invention can improve the prediction sensitivity of the long-term graft function of renal transplant recipients, provide strategies for preparing corresponding prediction or evaluation products, and has great social and economic benefits.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and particularly relates to a method for detecting the genotype of TLR10 rs28393318 and its application in evaluating long-term transplanted renal function. Background Art

[0002] As one of the earliest organ transplantation surgeries, kidney transplantation is a very effective treatment method for end-stage renal disease. With the standardization of organ acquisition and preservation, the increasing maturity of transplantation surgery, and the wide application of new immunosuppressive agents, the survival rate of transplanted kidneys has gradually increased, and the survival time has been continuously extended. The physical health and quality of life of transplanted patients have been greatly improved, and kidney transplantation has become the best choice for end-stage renal disease patients in addition to peritoneal dialysis and hemodialysis. However, the long-term survival of transplanted kidneys remains a major problem in kidney transplantation, and the continuous decline of renal function after transplantation is closely related to the survival of transplanted kidneys. The estimated glomerular filtration rate (eGFR) is the best indicator for evaluating renal function, and the change of eGFR over time is the recommended means for evaluating the process of renal function after transplantation. Renal transplant patients need to use immunosuppressive agents for a long time to reduce transplant rejection and improve the survival rate of transplanted kidneys. However, insufficient immunosuppressive agent effects may increase the risk of rejection, and excessive effects may cause adverse reactions, including nephrotoxicity, etc. These factors will all affect the change of eGFR after transplantation, resulting in great differences in renal function among individuals after transplantation.

[0003] Genetic factors are one of the important factors causing individual differences in transplanted renal function, and single nucleotide polymorphisms (SNPs) are the most common form of genetic variation, and 90% of individual differences are caused by SNPs.

[0004] Toll-like receptors (TLRs) are a class of important protein molecules involved in innate immunity, and are essential innate immune receptors for warning the immune system after microbial invasion, and play an important role in activating the innate immunity of the body against infection. And TLRs play an important bridging role between innate immunity and acquired immunity by regulating the activation of antigen-presenting cells such as monocytes / macrophages and dendritic cells, and the expression of co-stimulatory signals such as CD80. In addition, recent studies have shown that TLRs are also involved in certain autoimmune diseases and the transplantation immunity of the body. Animal experiments and clinical studies have also reported that TLRs are associated with the degree of allogeneic rejection, and their excessive immune response can trigger graft rejection. Therefore, the research on the participation of TLRs signaling pathway in transplantation immunity has become one of the research hotspots in the field of organ transplantation.

[0005] Currently, 13 members of the human TLRs family have been discovered in mammals and humans, namely TLR1 - TLR13. Their distribution is very extensive, mainly in monocytes, macrophages, dendritic cells, polymorphonuclear cells, B cells, T cells, basophils, NK cells and other lymphocytes. TLR10 is an important member of the TLRs family, mainly expressed in immune-related tissues and cells, including the spleen, lymph nodes, human B cells, etc. Different from other members of the TLRs family, TLR10 has an anti-inflammatory effect and inhibits other TLR signals, the production of inflammatory factors, and the activation of monocytes and B cells.

[0006] Previous literature studies have reported that TLR10 may be related to some tumors, immune diseases and infectious diseases, such as bladder cancer, IgA nephropathy, Crohn's disease, asthma, pulmonary aspergillosis, arthritis, etc. It has also been found in studies of allogeneic hematopoietic stem cell transplantation patients that TLR10 is related to the onset of acute graft-versus-host disease. The TLR10 gene polymorphism is closely related to the onset of many immune diseases, and the correlation between TLRs and organ transplantation immunity has been recognized. The TLR10 gene polymorphism is of great significance for evaluating the long-term graft function of renal transplant patients.

[0007] Currently, there is still no reliable method to predict the long-term graft function of renal transplant patients. Given its impact on the long-term survival rate of transplanted kidneys, predicting it undoubtedly has great clinical and economic value. Summary of the Invention

[0008] In order to overcome the defects in the prior art, the present invention provides a method for detecting the TLR10 rs28393318 genotype, and further provides a strategy for preparing products for evaluating the long-term graft function of renal transplant subjects and evaluating whether subjects need to focus on monitoring kidney pathological changes. The method for detecting the TLR10 rs28393318 genotype uses matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF). Its technical principle is that first, the genomic fragment containing the SNP is amplified by PCR, then single-base extension is achieved through sequence-specific primers. Subsequently, the sample analyte and the chip matrix are co-crystallized and then excited by a transient nanosecond (10 -9 s) intense laser in a vacuum tube. The nucleic acid molecules are thus desorbed into single-charged ions. Since the flight time of ions in an electric field is inversely proportional to the ion mass, the accurate molecular weight of the sample analyte is obtained by detecting the flight time of the nucleic acid molecules in the vacuum tube, thereby detecting the SNP site information.

[0009] To achieve the above object, the present invention adopts the following technical solutions:

[0010] The first aspect of the present invention is to provide a method for detecting the TLR10 rs28393318 genotype, which comprises the following steps:

[0011] Step 1, extracting genomic DNA from the whole blood of the subject, adjusting the concentration, and then performing PCR amplification;

[0012] Step 2, after the amplified PCR product is treated with SAP, performing a single-base extension reaction;

[0013] Step 3, purifying the single-base extension reaction product, detecting it with a time-of-flight mass spectrometer, and performing gene typing.

[0014] Further, the concentration of the genomic DNA is adjusted to 20-50 ng / μl.

[0015] Further, the sequences of the primers used in the PCR amplification in Step 1 are SEQ ID No.: 1 and SEQ ID No.: 2.

[0016] Further, the sequence of the single-base extension primer used in the single-base extension reaction in Step 2 is SEQ ID No.: 3.

[0017] The second aspect of the present invention is to provide the application of the reagent used in the above method in the preparation of a product for evaluating the long-term graft function of renal transplant recipients, and the product includes the reagent used in the above method and an instruction manual.

[0018] Further, the above instruction manual includes the following instructions:

[0019] a. Detecting the TLR10 rs28393318 genotype by the above method;

[0020] b. Evaluating the renal function of the subject according to the evaluation criteria based on the genotyping detection results; the genotyping detection results are selected from one of AA type, AG type, and GG type; the evaluation criteria are: the decline of renal function after renal transplantation in subjects carrying AA / AG type is faster than that in subjects carrying GG type, and the risk of renal function injury is greater.

[0021] Further, the above product is a kit.

[0022] The third aspect of the present invention is to provide the application of the reagent used in the above method in the preparation of a product for evaluating whether a subject needs to be monitored for kidney pathological changes, and the product includes the reagent used in the above method and an instruction manual.

[0023] Further, the above instruction manual includes the following instructions:

[0024] a. Detecting the TLR10 rs28393318 genotype by the above method;

[0025] b. Evaluate whether the subject needs to be closely monitored for renal pathological changes according to the evaluation criteria based on the genotyping test results; the genotyping test results are selected from one of AA type, AG type, and GG type; the evaluation criteria are as follows: subjects carrying AA / AG type need to be closely monitored for renal pathological changes and adjust the treatment plan; subjects carrying GG type do not need to be closely monitored for renal pathological changes and adjust the treatment plan.

[0026] Furthermore, the above product is a kit.

[0027] The fourth aspect of the present invention is to provide a kit for evaluating the long-term graft renal function of renal transplant subjects and evaluating whether the subject needs to be closely monitored for renal pathological changes, including the reagents used in the above method, preferably including primers with sequences of SEQ ID No.: 1 to SEQ ID No.: 3.

[0028] The present invention adopts the above technical solutions and has the following technical effects compared with the prior art:

[0029] The genotype of TLR10 rs28393318 can be used to predict the long-term graft renal function of renal transplant patients, thereby guiding clinical treatment to improve the long-term survival rate of the transplanted kidney. Therefore, the method for detecting the genotype of TLR10 rs28393318 provided by the present invention can improve the prediction sensitivity of the long-term graft renal function of renal transplant subjects, provide a strategy for preparing corresponding prediction or evaluation products, and has great social and economic benefits. Description of the Drawings

[0030] Figure 1 It is the AA type genotyping map of the TLR10 rs28393318 locus, where the peak of A is 14.8 and the peak of G is 1.9;

[0031] Figure 2 It is the AG type genotyping map of the TLR10 rs28393318 locus, where the peak of A is 5.1 and the peak of G is 4.9;

[0032] Figure 3 It is the GG type genotyping map of the TLR10 rs28393318 locus, where the peak of A is 2.1 and the peak of G is 7.3;

[0033] Figure 4 It is a line graph showing the effect of TLR10 rs28393318 gene polymorphism on renal function after transplantation. Detailed Embodiments

[0034] The present invention provides a method for detecting the TLR10 rs28393318 genotype, and further provides a strategy for preparing products for evaluating the long-term graft renal function of renal transplant recipients, evaluating whether the recipients need to focus on monitoring renal pathological changes, and adjusting treatment regimens. The present invention will be described in detail and specifically below through specific embodiments and drawings to better understand the present invention. However, the following embodiments do not limit the scope of the present invention.

[0035] In the embodiments, the methods are conventional methods unless otherwise specified, and the reagents used are conventional commercially available reagents or reagents prepared according to conventional methods unless otherwise specified.

[0036] Example 1

[0037] This example explores the effect of TLR10 rs28393318 gene polymorphism on the decline level of renal function within 5 years after renal transplantation in renal transplant patients. The specific experimental steps and results are as follows:

[0038] 1. Inclusion and exclusion criteria for renal transplant patients

[0039] A total of 172 Chinese Han renal transplant patients were selected and underwent allogeneic renal transplantation at Huashan Hospital, Fudan University from January 2000 to December 2015. The inclusion and exclusion criteria are as follows:

[0040] Inclusion criteria: First-time allogeneic renal transplant Han patients; aged 18 - 65 years; body weight > 40 kg, height > 150 cm; receiving triple immunosuppressive therapy based on tacrolimus; preoperative panel reactive antibody class I and class II antibodies were both negative, and lymphocyte cytotoxic cross-match test was < 10%; survival > 1 year after transplantation, and having complete follow-up data; being able to fully understand the purpose of this study and understand possible adverse reactions, and voluntarily participating in the experiment and signing the informed consent form.

[0041] Exclusion criteria: Those who did not meet the standard dosing regimen; non-first-time renal transplant or combined organ transplant patients; those with a history of malignant tumor or previous malignant tumor; postoperative follow-up time < 5 years.

[0042] 2. Immunosuppressive regimen

[0043] All patients used a triple maintenance immunosuppressive regimen, namely calcineurin inhibitor (CNI), mycophenolic acid (MPA), and glucocorticoid. The calcineurin inhibitor was tacrolimus (TAC, Prograf, Astellas, Ireland), and mycophenolic acid included mycophenolate mofetil (MMF, CellCept, (Roche, Shanghai, China) and sodium mycophenolate (MPS, Myfortic, (Novartis, Basel, Switzerland), and the glucocorticoid is prednisone or methylprednisolone.

[0044] The initial dose of TAC is 0.1 - 0.15 mg / kg / d, orally administered once in the morning and once in the evening. Subsequently, through TDM and dose adjustment, the trough concentration of TAC is maintained at: 8 - 10 ng / mL within the first month, 6 - 8 ng / mL from the 1st to the 3rd month, and thereafter maintained at 4 - 6 ng / mL. In special cases, the individual target concentration value can be adjusted according to clinical needs.

[0045] MMF or MPS is administered starting from the first day after surgery, twice a day. The dosing of MMF is adjusted according to the weight gradient. For patients with a body weight < 50 kg, 50 - 70 kg, and > 70 kg, the initial doses are 1.0 g / day, 1.5 g / day, and 2.0 g / day respectively, and are reduced to 0.75 g / day, 1.0 g / day, and 1.5 g / day respectively after 1 month. The MPS dose is converted according to 0.18 g MPS = 0.25 g MMF.

[0046] The glucocorticoid is administered starting from the day of surgery. 1 g of methylprednisolone is intravenously injected on the day of surgery, and then 500 mg is intravenously injected every day for 3 consecutive days. Starting from the fourth day after surgery, prednisone 80 mg is switched to oral administration and gradually decreased by 10 mg / day to 20 mg (on the 10th day), and then decreased to 10 mg / day again after 3 months.

[0047] Some patients are given induction immunosuppressive therapy after surgery, including daclizumab (Zenapax, (Roche, Shanghai, China), basiliximab (Simulect, (Novartis, Basel, Switzerland), antithymocyte globulin (ATG, (Genzyme, France) and antilymphocyte immunoglobulin (ALG, Wuhan Institute of Biological Products, Wuhan, China).

[0048] 3. Indexes of transplanted kidney function

[0049] The function of the transplanted kidney is evaluated by the change in the estimated glomerular filtration rate (eGFR) after transplantation. The baseline value, eGFR (ml / min) at 3, 6, 9 months, and 1, 2, 3, 4, 5 years after surgery are collected for statistics. The eGFR baseline value is defined as the highest value reached after the rise of eGFR after transplantation.

[0050] The glomerular filtration rate was calculated using the 2009 CKD-EPI formula: 141 × min(SCr / κ, 1) α × max(SCr / κ, 1) -1.209 × 0.993 Age [× 1.018 if female], where SCr is serum creatinine in mg / dl; for females, κ = 0.7, α = -0.329, and for males, κ = 0.9, α = -0.411; min is the smaller value of SCr / κ and 1, and max is the larger value of SCr / κ and 1; Age is the patient's age in years.

[0051] 4. Genotype detection

[0052] For all enrolled kidney patients, 2 ml of peripheral venous blood was collected, anticoagulated with EDTA, and stored at -20°C in a refrigerator for genotype detection.

[0053] The genotyping method for kidney transplant patients was MassARRAY time-of-flight mass spectrometry. Genomic DNA from whole blood was extracted using a DNA extraction kit and adjusted to a concentration of 20 - 50 ng / μl. Probes and primers were synthesized by Shanghai Bioengineering Company. The DNA template was subjected to PCR cycling, and the PCR products were subjected to SAP treatment and extension reaction. After purification of the extension products, the test samples were transferred from a 384-well reaction plate to a MassARRAY SpectroCHIP chip covered with matrix. After transferring the samples to the SpectroCHIP chip, they were placed in a mass spectrometer for detection, and the experimental results were analyzed using TYPER software to obtain genotyping data.

[0054] The specific steps are as follows:

[0055] (1) Multiplex PCR reaction: Search for the target gene sequence, design and synthesize PCR primers (ACGTTGGATGCCTGGTCAGCTCTTCTATTC (SEQ ID No.:1) and ACGTTGGATGAGGTTAACATACGCTGTGGG (SEQ ID No.:2)) for the mutation sites. Add 1 μl of DNA and 4 μl of PCR reaction solution (composition shown in Table 1 below) to each well of a 384-well plate, seal the film, briefly centrifuge, and then place it in a PCR instrument to run the PCR reaction program. The PCR reaction program is: 94°C for 15 min, 45 cycles (94°C for 20 s, 56°C for 30 s, 72°C for 1 min), 72°C for 3 min;

[0056] Table 1 PCR reaction solution

[0057]

[0058]

[0059] (2) SAP treatment: Prepare the SAP reaction system as shown in Table 2 below. Add 2 μl of the SAP reaction solution to each well of a 384-well plate. After sealing the film and centrifuging, place it in a PCR instrument and run the SAP reaction program. SAP reaction program: 37 °C for 40 min, 85 °C for 5 min.

[0060] Table 2 SAP reaction system

[0061]

[0062] (3) Extension reaction: Design a single-base extension primer TATATTCAGATTGAACGGTCC (SEQ ID No.: 3); add 2 μl of the iPlex reaction solution (the composition is shown in Table 3 below) to each well of a 384-well plate. After sealing the film and centrifuging, place it in a PCR instrument and run the extension reaction program. The extension reaction conditions are: 94 °C for 30 sec, 40 cycles (94 °C for 5 sec, 5 sub-cycles (52 °C for 5 sec, 80 °C for 5 sec)), 72 °C for 3 min.

[0063] Table 3 Extension reaction system

[0064]

[0065] (4) Product purification: Centrifuge the 384-well plate at 1,000 rpm for 1 min after the reaction ends. Add 25 μl of deionized water to each well, invert it on a 384-well resin plate, and then invert the resin plate and buckle it on the 384-well plate. Tap to make the resin fall into the 384-well plate. After sealing the film, flip the 384-well plate for 20 min and centrifuge at 3,500 rpm for 5 min.

[0066] (5) Mass spectrometry detection: Transfer the test sample from the 384-well reaction plate to a MassARRAY SpectroCHIP chip covered with matrix, place it in a MassARRAY Analyzgr Compact mass spectrometer for detection, and analyze the experimental results with TYPER software to obtain genotyping data (the genotyping diagrams of AA, AG, and GG are respectively as Figures 1-3 ).

[0067] 5. Statistical analysis of the association study

[0068] The effect of gene polymorphism on the changing trend of eGFR was analyzed by using a mixed linear model for repeated measurement data. The data set was reorganized into a Mixed analyzable structure, and the repeated measurement variance structure was selected as the compound symmetry structure; a multi-factor mixed linear model was used for multi-factor statistical analysis of SNPs, and clinical confounding factors such as age, gender, body weight, induction immunotherapy, cold ischemia time, and kidney source were included as confounding factors in each model.

[0069] 6. Statistical results

[0070] To investigate the effect of TLR10 rs28393318 gene polymorphism on renal function after transplantation, we used a linear mixed model to analyze the relationship between SNP and the changing trend of eGFR in kidney transplant patients within 5 years after transplantation. As shown in Table 4 below and Figure 1 , analysis revealed that SNP had a significant effect on the changing trend of eGFR. The eGFR of patients with the AA / AG genotype decreased significantly faster than that of patients with the GG genotype. The eGFR of patients with the AA / AG genotype decreased by 30.4% within 5 years, while that of patients with the GG genotype decreased by 16.4% (P = 0.00003).

[0071] Table 4 Effect of TLR10 rs28393318 gene polymorphism on renal function after transplantation

[0072]

[0073]

[0074] Multivariate analysis included clinical confounding factors such as age, gender, weight, induction immunosuppressive therapy, cold ischemia time, and kidney source, and investigated the effect of rs28393318 gene polymorphism on renal function after transplantation after including these factors. The results are shown in Table 5 below. The results were consistent with the univariate analysis. The rs28393318 gene polymorphism affected the changing trend of eGFR, and the rate of decline of eGFR in patients with the GG genotype was slower than that in patients with the AA / AG genotype (TP = 0.0004).

[0075] Table 5 Multivariate analysis of the effect of TLR10 rs28393318 gene polymorphism on renal function after transplantation

[0076]

[0077] 7. Conclusion

[0078] From the above results, taking kidney transplant patients as the research object, the decline of eGFR in subjects carrying the AA / AG type within 5 years after transplantation was faster than that in subjects with the GG type (-30.4% vs. -16.4%, P = 0.00003). Kidney transplant patients with the AA / AG type had a greater risk of impaired renal function after transplantation than those with the GG type.

[0079] Therefore, the renal function of the patient after transplantation can be predicted by detecting the TLR10 rs28393318 genotype of the patient who needs a kidney transplant. The transplanted kidney function of the patient with the AA / AG genotype declines faster than that of the patient with the GG genotype, and the risk of renal function damage is greater. Based on the test results, it can help predict risks. Subjects with the AA / AG genotype need to focus on monitoring renal pathological changes and adjust treatment plans; subjects with the GG genotype do not need to focus on monitoring renal pathological changes and adjust treatment plans.

[0080] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modification and substitution of the present invention are also within the scope of the present invention. Therefore, the equalization and modification made without departing from the spirit and scope of the present invention should be included in the scope of the present invention. Sequence Listing <110> Zhongshan Hospital Affiliated to Fudan University Huashan Hospital Affiliated to Fudan University <120> Methods for detecting TLR10 rs28393318 genotype and its application in evaluating long-term allograft renal function <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <400> 1 acgttggatg cctggtcagc tcttctattc 30 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <400> 2 acgttggatg aggttaacat acgctgtggg 30 <210> 3 <211> twenty one <212> DNA <213> Artificial Sequence <400> 3 tatattcaga ttgaacggtc c 21

Claims

1. Use of a reagent for detecting the TLR10 rs28393318 genotype in the preparation of a product for evaluating the long-term graft function of kidney transplant recipients, characterized in that The product includes the reagent and the instruction manual.

2. The use according to claim 1, characterized in that The instruction manual includes the following instructions: a. Detect the genotype of TLR10 rs28393318 by mass spectrometry; b. Evaluate the renal function of the subject according to the evaluation criteria based on the genotyping test results; the genotyping test results are selected from one of AA type, AG type and GG type; the evaluation criteria are: the decline of renal function after kidney transplantation in subjects carrying AA / AG type is faster than that in subjects carrying GG type, and the risk of renal function injury is greater.

3. Use of a reagent for detecting the TLR10 rs28393318 genotype in the preparation of a product for evaluating whether a subject needs to be closely monitored for kidney pathological changes, characterized in that The product includes the reagent and the instruction manual.

4. The use according to claim 3, characterized in that The instruction manual includes the following instructions: a. Detect the genotype of TLR10 rs28393318 by mass spectrometry; b. Evaluate whether the subject needs to focus on monitoring the pathological changes of the kidney according to the evaluation criteria based on the genotyping test results; the genotyping test results are selected from one of AA type, AG type and GG type; the evaluation criteria are: subjects carrying AA / AG type need to focus on monitoring the pathological changes of the kidney and adjust the treatment plan; subjects carrying GG type do not need to focus on monitoring the pathological changes of the kidney and adjust the treatment plan.

Images