Application of MC5R gene in detection of goat growth traits

Abstract

The invention relates to the technical field of modern livestock breeding, in particular to application of an MC5R gene in detection of goat growth traits. The invention provides application of an MC5R gene in detection of goat growth traits, a molecular marker related to the goat growth traits exists at the 519bp position of the nucleotide sequence of the MC5R gene, and the polymorphism of the molecular marker is C / T. When the genotype of the polymorphic site contained in the molecular marker is CC, the genotype corresponds to the growth trait relative advantage of the goat to be detected; when the genotype of the polymorphic site contained in the molecular marker is TT, the growth traits of the goat to be detected are relatively inferior. The molecular marker provided by the invention can be applied to identification or prediction of the growth state of the goats, can also be applied to the field of molecular breeding, and judges the genetic potential, seed reservation and seed reproduction of the goats on the basis of analysis of the genotypes of the goats. The invention has great significance for modern livestock breeding of goats.

Description

Technical Field

[0001] The present invention relates to the field of modern livestock breeding technology, and in particular to the application of the MC5R gene in detecting the growth traits of goats. Background Art

[0002] With the rapid development of the economy, people's requirements for the nutritional value, taste, and flavor of meat products are getting higher and higher. The growing demand for high-quality meat products has promoted the livestock industry to develop in the direction of high efficiency and sustainability. Mutton is rich in protein, and its calcium, iron, and vitamin C contents are higher than those of pork and beef, making it one of the high-quality meat choices. In contrast, goats have a shorter growth cycle and lower feeding costs. Therefore, studying how to improve the growth traits of goats through breeding is of great significance for the goat industry and goat breeding research.

[0003] For animal breeding, the traditional breeding cycle is long, the cost is high, and it is difficult to guarantee the accuracy of seed selection. The molecular marker-assisted selection (MAS) technology combines animal genetics and sequencing technology, thus greatly shortening the breeding process. The MC5R (Melanocortin 5 Receptor, MC5R) gene encodes the melanocortin receptor 5, which was the last to be discovered in the melanocortin receptor family. Therefore, the research on MC5R is relatively less compared to the other several. Different from MC3R and MC4R, which are mainly distributed in the central nervous system, MC5R is widely distributed in the central and peripheral tissues. The expression pattern and function of MC5R will also show differences due to its different expression positions in the body. When identifying the tissue expression profile of the MC5R gene in mice, it was found that the expression level of MC5R in the hypothalamus of mice was significantly lower than that of MC3R and MC4R, but the expression level of MC5R in peripheral tissues was significantly higher than that of other melanocortin receptors. The characteristics of expression in different tissues also prove the functional diversity of MC5R. Currently, there is no existing technology for using the MC5R gene to detect the growth traits of goats.

[0004] In view of this, the present invention is specifically proposed. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides an application of the MC5R gene in detecting the growth traits of goats.

[0006] Specifically, the technical solution of the present invention is as follows: In the first aspect, the present invention provides an application of the MC5R gene in detecting the growth traits of goats, and the nucleotide sequence of the CDS region of the MC5R gene is as shown in SEQ ID NO.01.

[0007] Preferably, the growth traits include at least one of the body weight at six months of age, body height, body slant length, and chest girth.

[0008] Further preferably, the growth traits include weight, height, body length and chest circumference at six months of age.

[0009] In a second aspect, the present invention provides a molecular marker associated with goat growth traits, wherein the molecular marker is located at 519 bp in the CDS region of the MC5R gene, and the polymorphism is C / T.

[0010] Preferably, the genotype of the polymorphic site contained in the molecular marker is CC, corresponding to the relative advantage of the growth trait of the goat to be tested.

[0011] Preferably, the genotype of the polymorphic site contained in the molecular marker is TT, corresponding to the relative disadvantage of the growth trait of the goat to be tested.

[0012] Preferably, the primer sequences for amplifying molecular markers are shown as SEQ ID NO.02 and SEQ ID NO.03.

[0013] In a third aspect, the present invention provides a specific primer pair for a molecular marker associated with goat growth traits.

[0014] Preferably, the primer sequences of the specific primer pair are shown as SEQ ID NO.02 and SEQ ID NO.03.

[0015] In a fourth aspect, the present invention provides a reagent or a kit for detecting growth traits of goats, wherein the reagent or the kit contains the specific primer pair described in the third aspect above.

[0016] In a fifth aspect, the present invention provides the use of the molecular marker or the specific primer pair or the reagent or kit in at least one of the following: (1) Application in identifying growth traits of goats; (2) Application in predicting goat growth traits; (3) Application in goat resource identification, improvement or molecular marker-assisted breeding.

[0017] In a sixth aspect, the present invention provides a molecular breeding method for high-quality goats, comprising: (1) Extracting total DNA from goats to be tested; (2) Using DNA as a template, detecting the genotype of the molecular marker according to any one of claims 2 to 4; (3) Analyze genotypes, determine the genetic potential of goats, and preserve and multiply them.

[0018] Preferably, step (3) comprises: performing allele detection on the amplified product, and determining according to the genotyping result: the genotype of the polymorphic site contained in the molecular marker is CC, corresponding to the relative advantage of the growth trait of the goat to be tested; and / or, the genotype of the polymorphic site contained in the molecular marker is TT, corresponding to the relative disadvantage of the growth trait of the goat to be tested. Beneficial Effects

[0019] The present invention provides an application of the MC5R gene in detecting the growth traits of goats. A molecular marker related to the growth traits of goats exists at the 519bp of the nucleotide sequence of the MC5R gene, and its polymorphism is C / T. When the genotype of the polymorphic site contained in the molecular marker is CC, it corresponds to the relative advantage of the growth traits of the goat to be tested; when the genotype of the polymorphic site contained in the molecular marker is TT, it corresponds to the relative disadvantage of the growth traits of the goat to be tested. The molecular marker provided by the present invention can be applied to the identification or prediction of the growth status of goats, and can also be applied to the field of molecular breeding. Based on the analysis of the goat genotype, the genetic potential of the goat can be judged, and the seed can be retained and multiplied. The present invention has great significance for modern animal husbandry of goats. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be described below.

[0021] Figure 1 This is the agarose gel electrophoresis pattern of the sequence fragment of the CDS region of the goat MC5R gene in Example 1.

[0022] Figure 2 This is a graph showing the reading results of the SnapGene software for the C519T site in the CDS region of the goat MC5R gene in Example 1; Figure 2 In the figure, Panel A: CC genotype; Panel B: CT genotype; Panel C: TT genotype. DETAILED DESCRIPTION

[0023] The present invention discovers a molecular marker associated with goat growth traits in the goat MC5R gene, and provides a new molecular marker for goat growth trait detection or molecular marker-assisted breeding.

[0024] Specifically, the technical solution of the present invention is as follows: The present invention firstly provides a single nucleotide polymorphism of a goat SNP site or an application of a substance for detecting a single nucleotide polymorphism of a goat SNP site in detecting or assisting in detecting the trait of goat litter size, wherein the SNP site is a molecular marker of the C519T site in the CDS region of the goat MC5R gene.

[0025] Among them, the molecular marker of the C519T locus: that is, there is a C>T base mutation at the 519th bp in the sequence shown in SEQ ID NO.01.

[0026] The single nucleotide polymorphism of the above SNP locus in the present invention is related to the body weight, body height, body slant length, and chest girth of goats at six months of age.

[0027] The present invention does not limit the goat breeds, and goat breeds such as Chubao Black Head Goat, Macheng Black Goat, Boer Goat, Yichang White Goat, and Matou Goat can be selected.

[0028] The present invention also provides a method for detecting the litter size trait of goats, by detecting the base type at the 519th bp in the sequence shown in SEQ ID NO.01 of goats. The body weight, body height, body slant length, and chest girth of goats with the CC genotype at six months of age are significantly higher than those of goats with the TT genotype.

[0029] The present invention also provides a substance for detecting the single nucleotide polymorphism of the SNP locus in goats, including PCR primers for amplifying genomic DNA fragments including the SNP locus or a kit containing the primers.

[0030] The present invention also provides a molecular marker associated with the litter size of goats in the MC5R gene. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO.01, and there is a C>T base mutation at the 519th bp in SEQ ID NO.01.

[0031] The above substance for detecting the single nucleotide polymorphism of the SNP locus in goats or the molecular marker associated with the growth traits of goats in the present invention can be used in goat genetic breeding to improve the growth traits of offspring goats.

[0032] The present invention provides a genetic breeding method for increasing the litter size of goats, by determining the single nucleotide polymorphism of the above SNP locus in breeding goats in the core herd of goats, and making corresponding selections according to the single nucleotide polymorphism of the SNP locus in goats: for the successive selection and breeding of breeding goats, individuals with the base at the 519th bp in the sequence shown in SEQ ID NO.01 being the CC type are selected, and individuals with the TT type and CT type are eliminated, so as to gradually increase the frequency of the CC gene at this locus, thereby increasing the body weight, body height, body slant length, and chest girth of offspring goats at six months of age.

[0033] Based on the above - mentioned solution provided by the present invention, the present invention discovers molecular markers associated with litter size in the goat MC5R gene. The molecular marker contains the SNP locus of C519T; the haplotype composed of the above - mentioned SNP locus can be used as a molecular marker for goat growth traits. The present invention verifies the effect of the above - mentioned SNP molecular marker on the body weight, body height, body slant length, and chest girth of goats at six months of age, and can apply it to the genetic improvement of breeding sheep to increase litter size, thereby improving the growth performance of offspring and further enhancing the market competitiveness of breeding enterprises. The present invention provides a new molecular marker for molecular marker - assisted breeding of goat litter - size traits, realizes early selection of goat growth traits, shortens the breeding process; the detection method is fast, accurate, and not affected by breeding environmental conditions factors.

[0034] To make the objectives, technical solutions, and advantages of the present invention clearer, the technical solutions in the present invention will be described clearly and completely below. Obviously, the described embodiments are some embodiments of the present invention, rather than all embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0035] At the endpoints and any values disclosed in this specification, the precise range or value is not limited. These ranges or values should be understood to include values close to these ranges or values. For numerical ranges, between the endpoint values of each range, between the endpoint values of each range and a single point value, and between single point values, they can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.

[0036] In the description of this specification, the descriptions referring to terms such as "one embodiment", "some embodiments", "specific implementation manners", or "some specific implementation manners" mean that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the embodiments of the present invention. In this specification, the schematic descriptions of the above - mentioned terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0037] The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels without special instructions. The experimental methods without specific conditions mentioned in the embodiments are usually carried out according to conventional conditions or according to the conditions recommended by the manufacturer.

[0038] The sequences involved in the following embodiments include: SEQ ID NO.01: ATGAACTCCTCATTCCACCTGCACTTCTGGGATCTTGGGCTGAACGCCACGGAAGGCAACCTCTCGGGACTGAGTGTGAGGAACGCGTCCTCACCATGTGAGGACATGGGCATTGCGGTGGAGGTGTTCCTGGCCCTGGGCCTCATCAGCCTGCTGGAGAACATCCTGGTCATCGGGGCCATTGTGAGGAATCGGAACCTGCACATCCCCATGTACTTCTTCATGGGCAGTTTGGCGGTGGCCGACATGTTGGTGAGCTTGTCCAACTTCTGGGAGACCATCACCATCTACCTGCTCACCAACAAGCACCTGGTGATGGCCGATGCCTCCGTGCGGCACCTGGACAATGTGTTCGACTCCATGATCTGCATCTCCGTGGTGGCCTCCATGTGCAGCCTGCTGGCCATTGCTGTGGACCGCTATGTCACCATCTTCTGCGCCCTGCGCTACCAGCGCATCATGACGGGGCGGCACTCGGGGGCCATCATCGCCGGCATCTGGGCCTTCTGCACCAGCTGCGGCACGGTCTTCATCGTGTACTACGAGTCCACATACGTGGTCGTCTGCCTCATCGCCATGTTCCTCACCATGCTGCTCCTCATGGCGTCTCTGTACACCCACATGTTCCTTCTGGCTCGAACCCATGTCCGGCGCATTGCCGCCCTGCCTGGGCACAGCTCTGTGTGGCAGAGGACTGGCGTGAAGGGCGCCATCACCCTGGCCATGCTGCTGGGCGTCTTCATCGTCTGCTGGGCCCCCTTCTTCCTCCACCTCATCCTGATGATTTCGTGTCCTCAGAACCTCTACTGCTCTTGCTTCATGTCTCACTTCAACATGTACCTCATCCTCATCATGTGTAACTCTGTGATTGACCCTCTGATATACGCCTTCCGCAGCCAAGAGATGCGGAAGACCTTTAAGGAGATTGTTTGTTTTCAGGGCTTCAGAACACCCTGTAGGTTCCCGAGCAGGTACTAA。

[0039] The sequence shown in SEQ ID NO.01 is the sequence information of the CDS region of the MC5R gene of Chubao Black-headed Sheep, which is the DNA sequence serving as the molecular marker of the present invention. At the 519th base of this sequence, there is a mutation of an allele, that is, the base "C" mutates to the base "T". Example 1

[0040] Obtaining of SNP detection fragments of the goat MC5R gene and establishment of a polymorphic locus detection method.

[0041] 1. Extraction of goat genomic DNA: Select the meat goats improved from Macheng Black Goats (Chubao Black-headed Sheep) as the experimental animals. The samples are from the breeding farm of the Institute of Animal Husbandry and Veterinary Medicine, Hubei Academy of Agricultural Sciences. Use a blood genomic DNA extraction kit (produced by Beijing Tiangen Biochemical Technology Co., Ltd.) to extract the whole genomic DNA of goats. The specific steps refer to the kit instructions. Detect the concentration and quality of the obtained genomic DNA, label it with a number and store it in a -80 °C refrigerator for later use.

[0042] 2. Obtaining of SNP genetic marker detection fragments: (1) PCR amplification: Design primers according to the goat MCR genomic sequence. The primer sequence information is as follows: Forward primer (SEQ ID NO.02): ATGAACTCCTCATTCCACCTGCAC (5’→3’); Reverse primer (SEQ ID NO.03): GTTCTGACTCCTCCTAACCCACT (5’→3’).

[0043] Use the above primers to perform PCR amplification on the genomic DNA of Chubao Black-headed Sheep. The reaction system is shown in Table 1.

[0044] Table 1 PCR reaction system

[0045] The PCR reaction program is set as follows: pre-denaturation at 98 °C for 45 s; denaturation at 98 °C for 10 s; annealing temperature is set at 62 °C for 30 s; extension at 72 °C for 25 s; the number of cycles is fixed, 34×; final extension at 72 °C for 5 min; 12 °C for 1 min. The agarose gel electrophoresis pattern of the CDS region sequence fragment of the MC5R gene is shown in Figure 1 .

[0046] Store the PCR amplification product at 4 °C.

[0047] (2) Purification of PCR products: The above PCR products were purified using a Gel Extraction Kit (Shanghai Sangon Biotech Co., Ltd.), and the specific steps can be found in the instruction manual.

[0048] 3. Detection of molecular markers by SNaPshot method: SNaPshot extension primers for the C519T locus were designed based on the genomic sequence of the goat MC3R gene: Add 5U SAP and 2U Exo I to 15 μL of the purified PCR product, mix well by shaking, incubate at 37 °C for 1 h, and then incubate at 75 °C for 15 min to inactivate SAP and ExoI enzymes; aspirate 3 μL of the treated 15 μL PCR product using the SNaPshot Multiplex Kit (Applied Biosystems) for SNaPshot detection. The PCR reaction system is 10 μL, including 5 μL of Reaction Mix reagent, 3 μL of the PCR product treated with SAP and ExoI enzymes, 0.5 μL of each extension primer, and 1 μL of deionized water. The PCR amplification program is denaturation at 96 °C for 10 s, annealing at 50 °C for 5 s, extension at 60 °C for 30 s, for 25 cycles, and store at 4 °C; dilute the SNaPshot product 20-fold. The dilution system is 9.25 μL of Hi-Di Formamide, 0.25 μL of GS-120LIZ, and 0.5 μL of the SNaPshot product. The reaction system is denaturation at 95 °C for 5 min and ice bath for 4 min; prepare a mixed solution containing 350 μL of Hi-Di formamide and 50 μL of Matrix standard, denature at 95 °C for 5 min, quickly cool on ice for 5 min, divide into 2 tubes, aliquot onto the upper machine plate, and perform spectral calibration on the 3730XL DNA Analyzer instrument; use the 3730XL DNA Analyzer to perform capillary electrophoresis on the prepared samples and collect signals; finally, use SnapGene software to analyze the experimental results. The results are as Figure 2 shown. Example 2

[0049] Detection of the polymorphism distribution of the molecular markers prepared by the present invention in the goat population.

[0050] In this example, the polymorphism of the locus at the 519 bp position in the CDS region of the goat MC3R gene was detected in the black-headed sheep population, and the detection results are shown in Table 2.

[0051] Table 2 Genotype frequencies and gene frequencies of the C519T locus of the goat MC3R gene

[0052] As can be seen from the results in Table 2, there are three genotypes of individuals at the C519T locus of the goat MC5R gene in the Chubao Blackhead sheep population, namely CC, CT, and TT genotypes. Among them, the homozygous T type is the dominant gene, and the allele gene frequency is 0.61. After chi-square test, the genotype distribution at this locus conforms to the Hardy-Weinberg equilibrium state. Example 3

[0053] Association analysis and application of the molecular marker of the present invention with the lambing traits of goats.

[0054] To determine whether the SNPs in the CDS region of the goat MC3R gene are related to its growth, 561 Chubao Blackhead sheep were selected as experimental materials. The sample collection and relevant lambing information all came from the sheep farm of the Institute of Animal Husbandry and Veterinary Medicine, Hubei Academy of Agricultural Sciences. The genotypes of different individuals were detected by direct sequencing method, and the correlation between individuals with different genotypes and their lambing traits was analyzed. The GLM program in the SAS statistical analysis software was used to conduct the association analysis between the traits of individuals with different genotypes of the molecular marker. The model used was: Model 1: Y = overall mean + genotype + sheep farm environmental effect + residual; Model 2: Y = overall mean + additive effect + dominant effect + sheep farm environmental effect + residual.

[0055] Among them, Y is the phenotypic value of the trait. Additive effect = (homozygote 1 - homozygote 2) / 2, and 1, 0, -1 are used to represent homozygote 1, heterozygote, and homozygote 2 respectively; Dominant effect = heterozygote - (homozygote 1 + homozygote 2) / 2, and 1, -1, 1 are used to represent homozygote 1, heterozygote, and homozygote 2 respectively. The statistical analysis results are shown in Table 3.

[0056] Table 3 Association analysis of the SNP locus of the MC3R gene with growth traits

[0057] Using the SAS 9.4 data analysis software, the association analysis of the SNP locus of the MC5R gene of the Chubao Blackhead sheep with its growth traits at 3, 6, and 12 months of age is shown in Table 3. The C519T locus of the MC5R gene has three genotypes, namely CC, CT, and TT. Among them, the body weight, body height, body slant length, and chest circumference of the CC genotype at 6 months of age are significantly higher than those of the TT genotype (P < 0.05). Therefore, individuals with the CC genotype at the C519T locus of the goat MC5R gene are screened, hoping to obtain sheep with better growth traits.

[0058] Finally, it should be noted that the above embodiments are only preferred embodiments of the present invention, used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements for some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the various embodiments of the present invention; therefore, any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Application of the MC5R gene in detecting growth traits of goats, characterized in that, The nucleotide sequence of the CDS region of the MC5R gene is shown in SEQ ID NO.01; Preferably, the growth trait includes at least one of weight at six months of age, height, body length and chest circumference.

2. Molecular markers related to goat growth traits, characterized in that, The molecular marker is located at the 519 bp position in the CDS region of the MC5R gene, and the polymorphism is C / T.

3. The molecular marker according to claim 2, characterized in that, The genotype of the polymorphic site contained in the molecular marker is CC, corresponding to the relative advantage of the growth trait of the goats to be tested; And / or, the genotype of the polymorphic site contained in the molecular marker is TT, corresponding to the relative disadvantage of the growth trait of the goat to be tested.

4. The molecular marker according to claim 2, wherein The primer sequences for amplifying molecular markers are shown in SEQ ID NO.02 and SEQ ID NO.

03.

5. A specific primer pair for amplifying the molecular marker according to any one of claims 2 to 4.

6. The specific primer pair according to claim 5, characterized in that, The primer sequences of the specific primer pair are shown as SEQ ID NO.02 and SEQ ID NO.

03.

7. A reagent or kit for detecting the growth traits of goats, characterized in that, Contains the specific primer pair described in any one of claims 5-6.

8. Use of the molecular marker according to any one of claims 2 to 4, the specific primer pair according to any one of claims 5 to 6, or the reagent or kit according to claim 7 in at least one of the following: (1) Application in identifying growth traits of goats; (2) Application in predicting goat growth traits; (3) Application in goat resource identification, improvement or molecular marker-assisted breeding.

9. A molecular breeding method for high-quality goats, characterized in that, include: (1) Extracting total DNA from goats to be tested; (2) Using DNA as a template, detecting the genotype of the molecular marker according to any one of claims 2 to 4; (3) Analyze genotypes, determine the genetic potential of goats, and preserve and multiply them.

10. The molecular breeding method according to claim 9, wherein Step (3) comprises: performing allele detection on the amplified product, and judging according to the genotyping result: the genotype of the polymorphic site contained in the molecular marker is CC, corresponding to the relative advantage of the growth trait of the goat to be tested; and / or, the genotype of the polymorphic site contained in the molecular marker is TT, corresponding to the relative disadvantage of the growth trait of the goat to be tested.

Images