A hydrogel preparation loaded with stem cells and its application

Abstract

The present invention discloses a hydrogel preparation for loading stem cells, and its preparation method and application. The hydrogel in the present invention uses fibrinogen and thrombin as gelling matrix materials, and adds antifibrinolytic solvent to improve its stability. At the same time, a stem cell protective liquid is added to maintain the survival of stem cells in the hydrogel. The present invention uses hydrogel as a biological scaffold, which simulates a three-dimensional extracellular matrix environment, can support the growth, proliferation and differentiation of stem cells, and realizes the repair of diabetic wound ulcers. The hydrogel preparation in the present invention has good biocompatibility and the function of promoting wound healing. Experimental results show that it has good effects in loading stem cells and treating diabetic wound ulcers.

Description

Technical Field

[0001] The present invention belongs to the technical field of cell preparation application, and particularly relates to a hydrogel preparation loaded with stem cells and a preparation method and application thereof. Background Art

[0002] Diabetes is a metabolic disease characterized by high blood sugar levels. It is reported that approximately 140 million people in my country currently suffer from diabetes, and it is estimated that by 2045, the number of diabetes patients in China will rise to 174 million. As one of the most common complications of diabetes, diabetic foot ulcers (DFUs) have a high morbidity and mortality rate. Diabetic foot ulcers are ischemic, neuropathic, and neuroischemic lesions of the foot caused by diabetes, resulting in insufficient blood supply to the patient's foot, abnormal sensation, and accompanied by symptoms such as wound ulceration and infection. In severe cases, it can affect muscles and bones, leading to foot necrosis and amputation.

[0003] Currently, traditional treatments for diabetic foot ulcers primarily include local wound debridement to remove necrotic tissue, hyperbaric oxygen therapy to alleviate tissue hypoxia, and blood sugar control. However, these approaches have not met expectations for clinical efficacy, severely impacting patients' quality of life. Therefore, a new treatment approach is urgently needed.

[0004] Human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) are multipotent stem cells found in the umbilical cord tissue of newborns. Stem cell therapy, led by hUC-MSCs, is a major branch of regenerative medicine. With their potential for self-renewal and multidirectional differentiation, hUC-MSCs can promote angiogenesis and tissue repair and reconstruction, and therefore hold great promise for wound healing.

[0005] With the development of regenerative medicine and the deepening of stem cell research, more and more studies are focusing on the possibility of using stem cells for the treatment of diabetic foot. Clinical trial results have shown that injecting stem cells into the wound site has a good promoting effect on wound healing (Moon, KC et al. Diabetes, 2019, 68 (4): 837-836; Carstens, MH et al. Stem Cells Translational Medicine, 2021, 10 (8): 1138-1147). However, this local injection or systemic injection of stem cells for treatment also has certain limitations, including high cell apoptosis rate, low retention rate in the lesion site, and low efficiency of cell directional differentiation. Therefore, the latest research uses biological scaffolds for local transplantation of stem cells. The biological scaffold provides cells with a spatial, three-dimensional living environment by constructing an extracellular matrix-like environment, which is conducive to cell survival, proliferation, adhesion and differentiation. Summary of the Invention

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] A method for preparing a fibrin hydrogel preparation for loading umbilical cord mesenchymal stem cells, the method comprising the following steps:

[0008] (1) Preparation of Solution A: Under a sterile environment, a certain weight unit of fibrinogen is weighed and dissolved in a stem cell protection solution to obtain Solution A. The concentration of fibrinogen in Solution A is 1 to 50 mg / mL; preferably, the concentration of fibrinogen in Solution A is 5 to 20 mg / mL;

[0009] (2) Preparation of Solution B: Under a sterile environment, a certain weight unit of thrombin is weighed, the thrombin is dissolved in a stem cell protection solution, and a certain amount of an antifibrinolytic agent is added thereto to obtain Solution B; the concentration of thrombin in Solution B is 10 to 100 U / mL, and the antifibrinolytic agent includes one or a mixture of two or more of aprotinin, tranexamic acid, 4-aminomethylbenzoic acid, and 6-aminocaproic acid;

[0010] Preferably: the concentration of thrombin in solution B is 20-50 U / mL;

[0011] (3) Mixing stem cells: Under sterile conditions, mix and resuspend the stem cells with solution A, with a concentration of 1×10 6 Each stem cell was resuspended in 10-1000 μL of 1-50 mg / mL fibrin solution;

[0012] Preferred: Every 1×10 6 Each stem cell was resuspended in 20-100 μL of 5-20 mg / mL fibrin solution;

[0013] (4) Mixing the solutions to obtain a fibrin hydrogel: Under a sterile environment, add the solution B obtained in step (2) to the solution A mixed with stem cells in step (3), mix them evenly, and place them at a constant temperature for 3-5 minutes to obtain a fibrin hydrogel.

[0014] In the technical solution of the present invention: the fibrinogen in step (1) includes one or a mixture of two or more of human fibrinogen, bovine fibrinogen, rabbit fibrinogen, mouse fibrinogen, sheep fibrinogen and fibrinogens from other species;

[0015] The thrombin in step (1) includes one or a mixture of two or more of human thrombin, bovine thrombin, rabbit thrombin, mouse thrombin, sheep thrombin and thrombin from other species;

[0016] The antifibrinolytic agent in step (2) comprises one or a mixture of two or more of aprotinin, trans-4-aminomethylcyclohexanecarboxylic acid, 4-aminomethylbenzoic acid, and 6-aminocaproic acid.

[0017] In the technical solution of the present invention: the solvent used in step (1) and step (2) is a stem cell protection solution, which is composed of the following components: compound amino acid solution, L-glutamine, anhydrous glucose, anhydrous calcium chloride, compound electrolyte solution, and human serum albumin solution;

[0018] The content of each component of the protective solution is as follows: per 100 mL of stem cell protective solution, it contains 0.1-30 mL of compound amino acid solution, 0.01-2 g of L-glutamine, 0.1-2 g of anhydrous glucose, 0.01-1 g of anhydrous calcium chloride, 50-90 mL of compound electrolyte solution, and 1-20 mL of human serum albumin solution; further preferably: per 100 mL of stem cell protective solution, it contains 1-10 mL of compound amino acid solution, 0.1-1 g of L-glutamine, 0.5-1 g of anhydrous glucose, 0.05-0.5 g of anhydrous calcium chloride, 75-90 mL of compound electrolyte solution, and 5-20 mL of human serum albumin solution.

[0019] In the technical solution of the present invention: the stem cells include bone marrow mesenchymal stem cells, umbilical cord mesenchymal stem cells, adipose mesenchymal stem cells, placental mesenchymal stem cells, amniotic membrane mesenchymal stem cells, dental pulp mesenchymal stem cells or muscle-derived stem cells.

[0020] In the technical solution of the present invention: the hydrogel-forming matrix material may also include one or a mixture of two or more of fibrin, collagen, hyaluronic acid, alginate, agarose, chitosan, polyethylene, polyethylene glycol, acrylic acid and their derivatives.

[0021] An application of a hydrogel preparation loaded with stem cells, wherein the hydrogel loaded with stem cells is used to repair skin ulcer wounds in diabetic rats;

[0022] Furthermore, the application of the stem cell-loaded hydrogel in the repair of skin ulcers in diabetic rats includes the following steps: taking a double syringe, filling the two syringes of the syringe with the stem cell-loaded solution A and solution B respectively, adding the solutions evenly to the wound surface, and applying a sterile dressing after the solution forms a gel;

[0023] Furthermore, the application of stem cell-loaded hydrogel in the repair of skin ulcers in diabetic rats also includes using solution A to resuspend the stem cells, then adding solution B to solution A and mixing evenly, and after forming a stable gel, transplanting it to the wound surface and adhering a sterile dressing.

[0024] In this invention, we designed and successfully prepared a stem cell-loaded hydrogel preparation that promotes wound repair. On the basis of using hydrogel as a cell scaffold, a stem cell protective liquid was added to improve the survival rate of stem cells in the hydrogel, and an antifibrinolytic agent was added to improve its stability so as to exert the long-term therapeutic effect of stem cells, thereby achieving a more efficient and long-lasting treatment of diabetic foot ulcers.

[0025] Beneficial effects of the present invention:

[0026] (1) The hydrogel prepared in the present invention has the advantage of being beneficial for the survival of stem cells. Compared to the hydrogels used in existing studies, the stem cell protective solution added in the present invention has the function of increasing the survival rate and survival time of stem cells. In addition, the antifibrinolytic agent added in the present invention can improve the stability of the hydrogel, thereby exerting the long-term therapeutic effect of stem cells.

[0027] (2) The hydrogel prepared in the present invention has the function of promoting the growth and proliferation of stem cells. Compared with the two-dimensional culture of stem cells, the hydrogel provides a three-dimensional extracellular matrix-like environment for stem cell growth, which can effectively avoid the cell contact inhibition phenomenon caused by two-dimensional culture, thereby promoting the proliferation of stem cells.

[0028] (3) The stem cells in the hydrogel of the present invention can secrete stem cell exosomes, vascular endothelial growth factor (VEGF), angiopoietin-1 (ANG-1) and basic fibroblast growth factor (bFGF) and other cytokines to repair wounds.

[0029] (4) The hydrogel prepared in the present invention has good hemostatic and bioadhesive properties, which is beneficial for promoting the repair of wounds and ulcers.

[0030] (5) Therefore, the present invention can simply and efficiently prepare a safe and low-toxic hydrogel preparation, which has potential medical prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 These are the results of stem cell proliferation in fibrin hydrogels with different ratios in vitro.

[0032] Figure 2 The results are as follows: the proliferation of stem cells in fibrin hydrogels with different antifibrinolytic agents added in vitro.

[0033] Figure 3 These are the results of the proliferation of stem cells in fibrin hydrogels with different formulations in vitro.

[0034] Figure 4 These are the results of stem cell adhesion in fibrin hydrogels in vitro.

[0035] Figure 5 The results are from PCR detection of stem cell wound repair-related gene expression.

[0036] Figure 6 The results show that the fibrin hydrogel preparation loaded with umbilical cord mesenchymal stem cells promotes the healing of diabetic wounds. Figure 6 (A) Comparison of wound size in different treatment groups on days 0, 3, 5, 7, and 14; Figure 6 (B) Statistical chart of wound size in different treatment groups on days 0, 3, 5, 7, and 14.

[0037] Figure 7 These are the H&E staining results of wound tissues in different groups after 14 days of treatment.

[0038] Figure 8 These are the results of CD31 immunohistochemical staining of wound tissues in different groups after 14 days of treatment. DETAILED DESCRIPTION

[0039] The present invention successfully designed and prepared a stem cell-loaded hydrogel formulation. This hydrogel uses fibrinogen and thrombin as its gelling matrix materials, incorporates an antifibrinolytic agent to enhance its stability, and incorporates a stem cell protective solution to maintain the survival of the stem cells within the hydrogel. Using the hydrogel as a bioscaffold, the invention simulates a three-dimensional extracellular matrix growth environment, supporting the growth, proliferation, and differentiation of stem cells and achieving the repair of diabetic wound ulcers.

[0040] In one embodiment of the present invention, Wistar rats were used as the primary model to evaluate the wound repair effects of a fibrin hydrogel formulation. During model construction, a diabetic model was established using a high-fat diet plus streptozotocin injection. A full-thickness skin excision model was then established on the back of the Wistar rats.

[0041] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the inventive method, steps or conditions are intended to fall within the scope of the present invention. Experimental methods and reagents for which specific conditions are not specified in the examples are based on conventional conditions in the art.

[0042] Example 1

[0043] (1) Under sterile conditions, accurately weigh the following materials: 0.5 g of anhydrous calcium chloride, 1 g of anhydrous glucose, 0.5 g of L-glutamine, 5 mL of compound amino acid injection, 90 mL of compound electrolyte injection, and 5 mL of human serum albumin to prepare stem cell protective solution;

[0044] The compound amino acid injection product is named Compound Amino Acid Injection (15AA), with a specification of 250 mL: 20 g (total amino acids), and was purchased from Hubei Yichang Sanxia Pharmaceutical Co., Ltd.

[0045] (2) Under sterile conditions, accurately weigh 10 mg of fibrinogen and dissolve it in the prepared stem cell protection solution to obtain a fibrinogen solution with a concentration of 10 mg / mL. 6 Solution A was obtained by resuspending the human umbilical cord mesenchymal stem cells in 1 mL of fibrinogen solution.

[0046] (3) Under sterile conditions, accurately weigh 25U of thrombin powder and dissolve it in the prepared stem cell protection solution to obtain a 25U / mL thrombin solution. Then, add 100μL of 15000U / mL aprotinin solution and 100μL of 15mg / mL tranexamic acid solution to 0.8mL of thrombin solution and mix well to obtain Solution B.

[0047] (4) Under a sterile environment, the above solution A and solution B were mixed evenly in a well plate at a volume ratio of 5:1, 3:1, and 1:1, and allowed to stand at a constant temperature of 37°C for 3 minutes to obtain a stable stem cell hydrogel.

[0048] Figure 1The results show the proliferation of stem cells in fibrin hydrogels with different ratios in vitro. The proliferation of stem cells in fibrin hydrogels with different ratios was evaluated using the CCK-8 assay. The absorbance results showed that the stem cells in the hydrogels significantly proliferated with increasing stem cell culture time.

[0049] Example 2

[0050] The following four groups were set up. Except for step (3), the other steps (1), (2), and (4) were the same as those described in Example 1, and the volume ratio of solution A to solution B was 1:1.

[0051] Blank hydrogel group: Step (3) Under sterile conditions, accurately weigh 25U thrombin powder, and use the prepared stem cell protection solution to dissolve the thrombin to obtain solution B with a thrombin solution concentration of 25U / mL.

[0052] Tranexamic acid group: Step (3) Under sterile conditions, accurately weigh 25 U of thrombin powder and dissolve the thrombin in the prepared stem cell protection solution to obtain a 25 U / mL thrombin solution. Then, add 200 μL of a 15 mg / mL tranexamic acid solution to 0.8 mL of the thrombin solution to obtain Solution B.

[0053] Aprotinin group: Step (3) Under sterile conditions, accurately weigh 25U of thrombin powder and dissolve the thrombin in the prepared stem cell protection solution to obtain a 25U / mL thrombin solution. Then, add 200μL of aprotinin solution at a concentration of 15000U / mL to 0.8mL of the thrombin solution to obtain Solution B.

[0054] Tranexamic acid / aprotinin group: Step (3) Under sterile conditions, accurately weigh 25 U of thrombin powder and dissolve the thrombin in the prepared stem cell protection solution to obtain a 25 U / mL thrombin solution. Then, add 100 μL of a 15,000 U / mL aprotinin solution and 100 μL of a 15 mg / mL tranexamic acid solution to 0.8 mL of the thrombin solution to obtain Solution B.

[0055] Figure 2The results show the proliferation of stem cells in fibrin hydrogels containing different antifibrinolytic agents in vitro. The CCK-8 assay was used to evaluate the proliferation of stem cells in fibrin hydrogels containing different antifibrinolytic agents. Absorbance results indicate that fibrin hydrogels containing either tranexamic acid or aprotinin alone are more conducive to stem cell growth. This is due to their ability to slow down the degradation of the fibrin hydrogel, resulting in a stable gelation period of approximately 10 days. Furthermore, the combination of aprotinin and tranexamic acid stabilized the hydrogel for over 14 days, further enhancing the survival and proliferation of stem cells within the hydrogel.

[0056] Example 3

[0057] Set up 4 groups, and the grouping is as follows:

[0058] 1. Blank hydrogel group:

[0059] (1) Under sterile conditions, accurately weigh 10 mg of fibrinogen and dissolve it in PBS to obtain a fibrinogen solution with a concentration of 10 mg / mL. 6 Solution A was obtained by resuspending the human umbilical cord mesenchymal stem cells in 1 mL of fibrinogen solution.

[0060] (2) Under sterile conditions, accurately weigh 25 U thrombin powder and dissolve the thrombin in PBS to obtain a 25 U / mL thrombin solution.

[0061] (3) Under a sterile environment, the fibrin solution containing human umbilical cord mesenchymal stem cells and the thrombin solution were mixed evenly in a well plate at a volume ratio of 1:1, and allowed to stand at a constant temperature of 37°C for 3 minutes to obtain a stable stem cell hydrogel.

[0062] 2. Tranexamic acid / aprotinin group:

[0063] (1) Under sterile conditions, accurately weigh 10 mg of fibrinogen and dissolve it in PBS to obtain a fibrinogen solution with a concentration of 10 mg / mL. 6 Solution A was obtained by resuspending the human umbilical cord mesenchymal stem cells in 1 mL of fibrinogen solution.

[0064] (2) Under sterile conditions, accurately weigh 25 U thrombin powder and dissolve it in PBS to obtain a 25 U / mL thrombin solution. Then, add 100 μL of 15,000 U / mL aprotinin solution and 100 μL of 15 mg / mL tranexamic acid solution to 0.8 mL of the thrombin solution to obtain Solution B.

[0065] (3) Under a sterile environment, solution A and solution B were mixed evenly in a well plate at a volume ratio of 1:1 and allowed to stand at a constant temperature of 37°C for 3 minutes to obtain a stable stem cell hydrogel.

[0066] 3. Stem cell protective solution group:

[0067] (1) Under sterile conditions, accurately weigh the following materials: 0.5 g of anhydrous calcium chloride, 1 g of anhydrous glucose, 0.5 g of L-glutamine, 1 mL of compound amino acid injection, 90 mL of compound electrolyte injection, and 9 mL of human serum albumin to prepare stem cell protective solution.

[0068] (2) Under sterile conditions, accurately weigh 10 mg of fibrinogen and dissolve it in the prepared stem cell protection solution to obtain a fibrinogen solution with a concentration of 10 mg / ml. 6 Solution A was obtained by resuspending the human umbilical cord mesenchymal stem cells in 1 mL of fibrinogen solution.

[0069] (3) Under sterile conditions, accurately weigh 25 U of thrombin powder and dissolve the thrombin in the prepared stem cell protection solution to obtain a thrombin solution with a concentration of 25 U / mL to obtain solution B.

[0070] (4) Under a sterile environment, the above solution A and solution B were mixed evenly in a well plate at a volume ratio of 1:1, and allowed to stand at a constant temperature of 37°C for 3 minutes to obtain a stable stem cell hydrogel.

[0071] 4. Tranexamic acid / aprotinin / stem cell protection solution group:

[0072] (1) Under sterile conditions, accurately weigh the following materials: 0.5 g of anhydrous calcium chloride, 1 g of anhydrous glucose, 0.5 g of L-glutamine, 1 mL of compound amino acid injection, 90 mL of compound electrolyte injection, and 9 mL of human serum albumin to prepare stem cell protective solution.

[0073] (2) Under sterile conditions, accurately weigh 10 mg of fibrinogen and dissolve it in the prepared stem cell protection solution to obtain a fibrinogen solution with a concentration of 10 mg / mL. 6 Solution A was obtained by resuspending the human umbilical cord mesenchymal stem cells in 1 mL of fibrinogen solution.

[0074] (3) Under sterile conditions, accurately weigh 25U of thrombin powder and dissolve it in the prepared stem cell protection solution to obtain a 25U / mL thrombin solution. Then, add 100μL of 15000U / mL aprotinin solution and 100μL of 15mg / mL tranexamic acid solution to 0.8mL of thrombin solution.

[0075] (4) Under a sterile environment, solution A and solution B were mixed evenly in a well plate at a volume ratio of 1:1 and allowed to stand at a constant temperature of 37°C for 3 minutes to obtain a stable stem cell hydrogel.

[0076] Figure 3 These are the results of the proliferation of stem cells in fibrin hydrogels with different formulations under in vitro conditions. The proliferation of stem cells in fibrin hydrogels with different formulations was evaluated by the CCK-8 method, and the absorbance results showed that the addition of antifibrinolytic agents to the formulation can effectively delay the degradation of fibrin hydrogels, increasing the stable gel time from 3 days to more than 14 days. Due to the delayed degradation of the hydrogel, stem cells can adhere to the three-dimensional grid structure of the hydrogel for a longer period of time, which is beneficial to their survival and proliferation, and achieves long-term secretion of therapeutic cytokines. At the same time, the absorbance results show that the addition of stem cell protective fluid as a dispersing medium for the hydrogel matrix material is more conducive to cell proliferation, indicating that the aqueous environment provided by the stem cell protective fluid is more conducive to the growth and survival of stem cells.

[0077] Example 4

[0078] The morphology of stem cells in the fibrin hydrogel was observed using a living cell workstation. The fibrin hydrogel was prepared as follows:

[0079] (1) Under sterile conditions, accurately weigh the following materials: 0.5 g of anhydrous calcium chloride, 1 g of anhydrous glucose, 0.5 g of L-glutamine, 1 mL of compound amino acid injection, 90 mL of compound electrolyte injection, and 9 mL of human serum albumin to prepare stem cell protective solution.

[0080] (2) Under sterile conditions, accurately weigh 10 mg of fibrinogen and dissolve it in the prepared stem cell protection solution to obtain a fibrinogen solution with a concentration of 10 mg / mL. 6 Individual umbilical cord mesenchymal stem cells were resuspended in 1 mL of fibrinogen solution to obtain solution A.

[0081] (3) Under sterile conditions, accurately weigh 25 U of thrombin powder and dissolve it in the prepared stem cell protection solution to obtain a 25 U / mL thrombin solution. Then, add 100 μL of 15,000 U / mL aprotinin solution and 100 μL of 15 mg / mL tranexamic acid solution to 0.8 mL of thrombin solution to obtain Solution B.

[0082] (4) Under a sterile environment, the above solution A and solution B were mixed evenly in a well plate at a volume ratio of 1:1, and allowed to stand at a constant temperature of 37°C for 3 minutes to obtain a stable stem cell hydrogel.

[0083] Figure 4 The results show the adhesion of stem cells in fibrin hydrogels in vitro. By observing the cell morphology of fibrin hydrogels at different time points, the results show that on day 0, the stem cells were spherical and evenly dispersed in the fibrin hydrogel. On day 1, the stem cells produced filopodia, indicating that the stem cells adhered. In addition, the morphology of stem cells in the following days was observed to be long spindle-shaped, indicating that the stem cells in the hydrogel had a good survival state. The fibrin hydrogel provides a three-dimensional network structure environment similar to the extracellular matrix for stem cells, on which the stem cells adhere, thereby facilitating their proliferation and exerting a long-term therapeutic effect.

[0084] Example 5

[0085] Figure 5 Results of PCR-based assays for stem cell wound repair-related gene expression. RT-qPCR was used to measure the expression of VEGF, ANG-1, and bFGF on day 7 of culture to assess whether the 3D stem cell gel culture system affects wound repair at the genetic level. The results showed that the 3D stem cell gel culture system did not impair the wound repair function of stem cells and that the gene expression of VEGF, ANG-1, and bFGF was increased compared to 2D culture.

[0086] Table 1 Primer sequences for genes involved in RT-qPCR detection:

[0087] VEGF-FORWARD GAGGAGCAGTTACGGTCTGTG VEGF-REVERSE TCCTTTCCTTAGCTGACACTTGT ANG1-FORWARD TAAATCAAACATCCCCTCTT ANG1-REVERSE AGGTGTCCAGCTCTTCCT BFGF-FORWARD AGAAGAGCGACCCTCACATCA BFGF-REVERSE CGGTTAGCACACACTCCTTTG GAPDH-FORWARD GACATGCCGAAGCTCACTG GAPDH-REVERSE GCTTCACCACCTTCTTGATG

[0088] Example 6

[0089] (1) Under sterile conditions, accurately weigh the following materials: 0.2 g anhydrous calcium chloride, 0.1 g anhydrous glucose, 0.01 g L-glutamine, 1 mL compound amino acid injection, 90 mL compound electrolyte injection, and 9 mL human serum albumin to prepare stem cell protective solution.

[0090] (2) Under sterile conditions, accurately weigh 10 mg of fibrinogen and dissolve it in 1 ml of the prepared stem cell protection solution to obtain a fibrinogen solution with a concentration of 10 mg / mL. 6 Individual umbilical cord mesenchymal stem cells were resuspended in 1 mL of fibrinogen solution to obtain solution A.

[0091] (3) Under sterile conditions, accurately weigh 25 U of thrombin powder and dissolve it in 1 mL of the prepared stem cell protection solution to obtain a 25 U / mL thrombin solution. Then, add 100 μL of a 20,000 U / mL aprotinin solution and 100 μL of a 20 mg / mL tranexamic acid solution to 0.8 mL of the thrombin solution to obtain Solution B.

[0092] (4) Under a sterile environment, the above solution A and solution B were mixed evenly in a well plate at a volume ratio of 1:1, and allowed to stand at a constant temperature of 30°C for 5 minutes to obtain a stable stem cell hydrogel.

[0093] Example 7

[0094] (1) Under sterile conditions, accurately weigh the following materials: 0.25 g of anhydrous calcium chloride, 1 g of anhydrous glucose, 0.05 g of L-glutamine, 5 mL of compound amino acid injection, 80 mL of compound electrolyte injection, and 15 mL of human serum albumin to prepare stem cell protective solution.

[0095] (2) Under sterile conditions, accurately weigh 20 mg of fibrinogen and dissolve it in 1 mL of the prepared stem cell protection solution to obtain a fibrinogen solution with a concentration of 20 mg / mL. 6 Individual umbilical cord mesenchymal stem cells were resuspended in 1 mL of fibrinogen solution to obtain solution A.

[0096] (3) Under sterile conditions, accurately weigh 50 U of thrombin powder and dissolve it in 1 mL of the prepared stem cell protection solution to obtain a 50 U / mL thrombin solution. Then, add 100 μL of aprotinin solution (10,000 U / mL) and 100 μL of tranexamic acid solution (25 mg / mL) to 0.8 mL of the thrombin solution to obtain Solution B.

[0097] (4) Under a sterile environment, the above solution A and solution B were mixed evenly in a well plate at a volume ratio of 1:1, and allowed to stand at a constant temperature of 25°C for 10 minutes to obtain a stable stem cell hydrogel.

[0098] Example 8

[0099] 1. To investigate the therapeutic efficacy of a stem cell-loaded hydrogel formulation on skin ulcers in diabetic rats, 7- to 8-week-old Wistar rats were selected as experimental subjects. After four weeks of feeding on a 45% high-fat diet, streptozotocin was injected intraperitoneally at a dose of 65 mg / kg. Three days after injection, blood glucose levels were measured. A level above 16.7 mmol / l was considered a successful diabetic model, and subsequent experiments were performed.

[0100] 2. After maintaining diabetes for one week, a 20mm×20mm full-thickness skin defect was constructed on the back of the rats, and then the rats were divided into groups for treatment. The PBS group was injected with 1ml of PBS subcutaneously at the edge of the wound and a sterile dressing was applied. The gel treatment group was injected with 500μl of fibrin solution (15mg / mL) and 500μl of thrombin solution (50U / mL) in two double syringes respectively, and injected on the wound surface. After a stable gel was formed, a sterile dressing was applied. The stem cell treatment group was injected with 1mL of stem cell suspension (1×10 6 The stem cell gel treatment group was treated by adding 500 μL of 10 6 A fibrin solution (15 mg / mL, prepared as in Example 1) containing 1000 μL of stem cells and a thrombin solution (50 U / mL) containing 1500 U / mL of aprotinin solution and 1.5 mg / mL of tranexamic acid were injected into the wound surface, and a sterile dressing was applied after a stable gel was formed.

[0101] 3. Take photos and record the wound size on the 0th, 3rd, 5th, 7th, and 14th days of treatment. After 14 days, cut off the new skin tissue for subsequent experiments.

[0102] Figure 6 (A) Comparison of wound size between different treatment groups on days 0, 3, 5, 7, and 14. The images show that compared with the PBS group, the stem cell gel group has a better ability to promote wound repair, and the wound area is significantly reduced.

[0103] Figure 6 (B) Statistical chart of wound size at days 0, 3, 5, 7, and 14 for different treatment groups. Comparing wound areas reveals that the stem cell gel group exhibits the best wound repair capacity, with a wound healing rate of 90.3% at day 14. Fibrin hydrogel, due to its wound repair capacity, can accelerate the wound healing process into the coagulation phase, thus also promoting wound healing.

[0104] Figure 7 The following are the results of HE staining of wound tissues in different groups after 14 days of treatment. Comparison of the HE staining results of the wounds of different treatment groups shows that the PBS group still has a large number of blood cells at the wound site and has obvious defects, while the stem cell gel treatment group has formed a clear epidermis and dermis at the wound site, and hair follicles have appeared, indicating a better wound repair effect.

[0105] Figure 8The following are CD31 immunohistochemical staining results for wound tissue from different treatment groups after 14 days of treatment. CD31 immunohistochemistry is used to observe the presence of new blood vessels in wound tissue. Comparison of CD31 immunohistochemical staining results across different treatment groups showed that the stem cell gel-treated group had the greatest number of new blood vessels, with intact luminal structures, indicating superior wound repair efficacy.

[0106] The above examples are provided for illustrative purposes only, disclosing examples and accompanying drawings of the fibrin hydrogel preparations prepared herein, and are not intended to limit the embodiments. Those skilled in the art will appreciate that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the disclosure of the examples and accompanying drawings, and obvious variations or modifications derived therefrom remain within the scope of protection of the present invention.

Claims

1. A stem cell-loaded hydrogel preparation for promoting wound healing, characterized in that: The hydrogel is a fibrin hydrogel made from fibrinogen and thrombin as main raw materials. The preparation method comprises the following steps: (1) Preparation of Solution A: Under a sterile environment, weigh a certain weight unit of fibrinogen and dissolve the fibrinogen in stem cell protection solution to obtain Solution A. The concentration of fibrinogen in Solution A is 1-50 mg / mL; (2) Preparation of Solution B: Under a sterile environment, weigh a certain weight unit of thrombin, dissolve the thrombin in a stem cell protection solution, and add a certain amount of an antifibrinolytic agent to obtain Solution B; the concentration of thrombin in Solution B is 10 to 100 U / mL, and the antifibrinolytic agent includes one or a mixture of two or more of aprotinin, tranexamic acid, 4-aminomethylbenzoic acid, and 6-aminocaproic acid; (3) Mixing stem cells: Under sterile conditions, mix and resuspend the stem cells with solution A; each 1×10 6 Resuspend each stem cell in 10-1000 μL of solution A; (4) Mixing the solutions to obtain a fibrin hydrogel: Under a sterile environment, add the solution B obtained in step (2) to the solution A mixed with stem cells in step (3), mix well, and allow to stand at 25-40°C for 3-5 minutes to obtain a fibrin hydrogel; Among them, every 100mL of stem cell protection solution contains 1-10mL of compound amino acid solution, 0.1-1g of L-glutamine, 0.5-1g of anhydrous glucose, 0.05-0.5g of anhydrous calcium chloride, 75-90mL of compound electrolyte solution, and 5-20mL of human serum albumin solution.

2. The stem cell-loaded hydrogel preparation according to claim 1, wherein The fibrinogen includes one or a mixture of two or more of human fibrinogen, bovine fibrinogen, rabbit fibrinogen, mouse fibrinogen, sheep fibrinogen and fibrinogens from other species.

3. The stem cell-loaded hydrogel preparation according to claim 1, wherein The concentration of fibrinogen in solution A is 5 to 20 mg / mL.

4. The stem cell-loaded hydrogel preparation according to claim 1, wherein The thrombin includes one or a mixture of two or more of human thrombin, bovine thrombin, rabbit thrombin, mouse thrombin, sheep thrombin and thrombin from other species.

5. The stem cell-loaded hydrogel preparation according to claim 1, wherein The concentration of thrombin in solution B is 20-50 U / mL.

6. The stem cell-loaded hydrogel preparation according to claim 1, wherein The antifibrinolytic agents described in step (2) are aprotinin and tranexamic acid; the concentration of aprotinin in solution B is 1000~10000U / mL, and the concentration of tranexamic acid in solution B is 0.1~10mg / mL.

7. The stem cell-loaded hydrogel preparation according to claim 1, wherein In step (3), every 1×10 6 Each stem cell is resuspended in 20-100 μL of 5-20 mg / mL fibrinogen solution.

8. The stem cell-loaded hydrogel preparation according to claim 1, wherein The stem cells include bone marrow mesenchymal stem cells, umbilical cord mesenchymal stem cells, adipose mesenchymal stem cells, placental mesenchymal stem cells, amniotic membrane mesenchymal stem cells, dental pulp mesenchymal stem cells or muscle-derived stem cells.

9. The stem cell-loaded hydrogel preparation according to claim 1, wherein When the solutions are mixed, the volume ratio of solution A:solution B is 1:0.01-10.

10. The stem cell-loaded hydrogel preparation according to claim 9, wherein The volume ratio of solution A:solution B is 1:0.1~5.

11. The stem cell-loaded hydrogel preparation according to claim 1, wherein The hydrogel-forming matrix material may also include one or a mixture of two or more of fibrin, collagen, hyaluronic acid, alginic acid, agarose, chitosan, polyethylene, polyethylene glycol, and acrylic acid.

12. Use of the stem cell-loaded hydrogel preparation according to claim 1 in the preparation of a medicament for promoting wound healing.

Images