Photoelectrochemical aptamer sensor and its preparation method and application

Abstract

The present invention discloses a method and application of a photoelectrochemical aptamer sensor for aflatoxin B1 based on the synthesis of Er-MOF@AuNPs composite materials using ionic liquids. First, a PIMBImBr ionic liquid is prepared. Then, the ionic liquid is used as a ligand. The metal Er 3+ As the coordination center, Er‑MOF nanospheres were successfully synthesized. Then, the Er‑MOF@AuNPs composite material was prepared by in situ reduction of chloroauric acid. Based on the Er‑MOF@AuNPs composite material as a photoelectric material modified electrode, the hairpin DNA (hDNA) was covalently bound to Au‑S, and the gold nano-modified aflatoxin B1 aptamer (AuNPs‑Apt) was specifically recognized by the complementary base sequence on the hairpin DNA to construct a photoelectrochemical aptamer sensor, and white light was used as the excitation light source to achieve highly selective and sensitive detection of aflatoxin B1.

Description

Technical Field

[0001] The present invention belongs to the field of novel nano-functional materials and photoelectric sensing technology, and relates to a photoelectrochemical aptamer sensor and a preparation method and application thereof, and in particular to a method and application of constructing an aflatoxin B1 photoelectrochemical aptamer sensor based on ionic liquid synthesized Er-MOF@AuNPs composite material. Background Art

[0002] Mycotoxins are secondary metabolites produced by filamentous fungi in high temperature and high humidity environments. Crops are susceptible to fungal infection during planting, harvesting, processing, transportation and storage, and then enter the human body to cause serious nephrotoxicity, carcinogenicity, teratogenicity and other hazards. There are many types of mycotoxins, mainly including aflatoxins, ochratoxins, fumonisins, and zearalenone. Among them, aflatoxin B1 (AFB1) is classified as a Group I carcinogen by the International Agency for Research on Cancer.

[0003] Traditional methods for detecting AFB1 mainly include high-performance liquid chromatography, enzyme-linked immunosorbent assay, and liquid chromatography-mass spectrometry. Although these methods are highly selective, they require expensive instruments, well-trained professionals, and cumbersome procedures. In order to overcome the above shortcomings, it is urgent to design a simple, fast, effective, sensitive, and selective photoelectrochemical aptamer detection method.

[0004] Photoelectrochemical sensors usually use light as the excitation source and photocurrent as the detection signal. They have low background signals, high sensitivity and low cost, and are therefore widely used in the fields of DNA biosensing, immunosensing, cell analysis, etc. Although the research on photoelectrochemical sensors has made great progress, they still face the following difficulties: (1) the photoelectric active materials have a large energy band gap; (2) the photoelectric conversion efficiency is not high. Therefore, it is an effective solution to improve the sensitivity of photoelectrochemical sensors by selecting suitable photoelectric active materials and implementing signal amplification strategies. Summary of the invention

[0005] In order to improve the problems existing in the existing photoelectric sensor technology for detecting fungal toxins, the present invention provides a photoelectrochemical aptamer sensor constructed based on Er-MOF@AuNPs composite material and its preparation method and application, which realizes sensitive, specific and efficient detection of aflatoxin B1.

[0006] In order to achieve the above-mentioned invention object, the present invention adopts the following technical scheme:

[0007] The present invention provides a compound having a structure shown in Formula I:

[0008]

[0009] The present invention also provides a method for preparing a compound having a structure as shown in Formula I, comprising reacting Compound 2 with a base to prepare the compound having a structure as shown in Formula I;

[0010] The compound 2 has the following structure:

[0011]

[0012] According to an embodiment of the present invention, the molar ratio of the compound 2 to the base is 1:(1-10), exemplified by 1:1, 1:3, 1:5, 1:9, 1:10.

[0013] According to an embodiment of the present invention, the base may be selected from KOH, NaOH.

[0014] According to an embodiment of the present invention, the preparation method can be carried out in the presence of a solvent. For example, the solvent can be selected from ethanol and water, preferably a mixed solvent of ethanol and water. Exemplarily, the volume ratio of ethanol to water is (1 to 5): 1, exemplarily 1: 1, 2: 1, 4: 1, 5: 1.

[0015] According to an embodiment of the present invention, the preparation method further comprises the step of separating a solid product from the reaction mixture after the reaction is completed. For example, the reaction solution is poured into water, filtered, washed with water, and the filter cake is collected to obtain a compound of the structure shown in Formula I.

[0016] Preferably, the synthetic route of the compound of formula I is as follows:

[0017]

[0018] According to an embodiment of the present invention, the compound 2 is prepared by the following method, comprising: reacting compound 1 with methyl 4-bromomethylbenzoate to obtain the compound 2;

[0019] The compound 1 has the following structure:

[0020]

[0021] According to one embodiment of the present invention, the above reaction can be carried out in the presence of a solvent such as an organic solvent. For example, the organic solvent can be selected from acetonitrile.

[0022] According to an embodiment of the present invention, the molar ratio of compound 1 to methyl 4-bromomethylbenzoate is 1:(1-5), exemplified by 1:1, 1:2, and 1:5.

[0023] According to an embodiment of the present invention, the preparation method further comprises the step of separating a solid product from the reaction mixture after the reaction is completed. For example, the reaction solution is poured into anhydrous ether, filtered, washed with anhydrous ether, and the filter cake is collected to obtain compound 2.

[0024] Preferably, the synthetic route of compound 2 is as follows:

[0025]

[0026] According to an embodiment of the present invention, the compound 1 is prepared by the following method, comprising: reacting phenanthrenequinone, 4-(imidazol-1-yl)benzaldehyde, 5-aminoisophthalic acid methyl ester and thiomorpholine to obtain compound 1.

[0027] Preferably, the reaction molar ratio of phenanthrenequinone, 4-(imidazol-1-yl)benzaldehyde, 5-aminoisophthalic acid methyl ester and thiomorpholine is 1:1:(2-4), exemplified by 1:1:2, 1:1:3, and 1:1:4.

[0028] Preferably, the preparation method of compound 1 can be carried out in the presence of a solvent such as an organic solvent. For example, the organic solvent can be selected from glacial acetic acid.

[0029] Preferably, the preparation method of the compound 1 can be carried out in the presence of a catalyst. Preferably, the molar ratio of the catalyst to phenanthrenequinone is 1:(10-50), exemplified by 1:10, 1:20, 1:50.

[0030] For example, the catalyst may be selected from ammonium acetate.

[0031] Preferably, the preparation method further comprises adding a base for neutralization. For example, the base is aqueous ammonia.

[0032] Preferably, the preparation method further comprises the step of separating the product from the reaction mixture after the reaction is completed. For example, extracting with dichloromethane and collecting the organic layer liquid. Further, the preparation method further comprises the step of purifying the product. For example, the purification can be separated by column chromatography. Preferably, the eluent separated by the column chromatography is dichloromethane / methanol=(40-60):1 (v / v), exemplified by 40:1, 50:1, 60:1.

[0033] Preferably, the synthetic route of compound 1 is as follows:

[0034]

[0035] According to an embodiment of the present invention, the method for preparing the compound having the structure shown in Formula I comprises the following steps:

[0036] (1) In the presence of a catalyst, phenanthrenequinone, 4-(imidazol-1-yl)benzaldehyde, 5-aminoisophthalic acid methyl ester and thiomorpholine are reacted with ammonium acetate as a solvent to synthesize compound 1; the structural formula of compound 1 is as follows:

[0037]

[0038] (2) Compound 2 is synthesized from Compound 1 and methyl 4-bromomethylbenzoate using acetonitrile as solvent; the structural formula of Compound 2 is as follows:

[0039]

[0040] (3) Compound 2 is used to synthesize a compound of formula I in the presence of a base using ethanol and water as solvent;

[0041] The reaction scheme of the compound of formula I is as follows:

[0042]

[0043] The present invention also provides the use of the compound with the structure shown in Formula I in the preparation of a photoelectrochemical aptamer sensor.

[0044] The present invention also provides a composite material, which comprises Er-MOF and gold nanoparticles located on the surface of Er-MOF.

[0045] According to an embodiment of the present invention, the Er-MOF surface is modified with a compound having a structure shown in Formula I. Preferably, the Er-MOF is a nanosphere. For example, the particle size of the Er-MOF is 80-120 nm.

[0046] According to an embodiment of the present invention, the gold nanoparticles are gold nanoparticles (AuNPs). Preferably, the particle size of the gold nanoparticles is 5-20 nm, and exemplarily 15 nm.

[0047] The present invention also provides a method for preparing the composite material, comprising reacting Er-MOF and gold nanoparticles to prepare the composite material.

[0048] According to an embodiment of the present invention, the reaction is carried out in the presence of HAuCl4 and NaBH4. Preferably, the HAuCl4 and NaBH4 are added to the reaction system in the form of solutions. For example, aqueous solutions of HAuCl4 and NaBH4 are prepared respectively, and then Er-MOF is reacted with the HAuCl4 solution, and then reacted with the NaBH4 solution to obtain the composite material.

[0049] According to an embodiment of the present invention, the reaction ratio of Er-MOF, HAuCl4, and NaBH4 is 1 mg:(10-30) μmol:(0.5-2) μmol, exemplified by 1 mg:10 μmol:0.5 μmol, 1 mg:20 μmol:1 μmol, and 1 mg:30 μmol:2 mmol.

[0050] Preferably, the reaction of Er-MOF and HAuCl4 solution is carried out in an ice bath; the reaction time is 2 to 4 h, exemplified by 2 h, 3 h, and 4 h.

[0051] According to an embodiment of the present invention, the preparation method further comprises a process of performing solid-liquid separation on the reaction system to obtain a reaction product. For example, the solid-liquid separation can be performed by means known in the art, such as centrifugation.

[0052] According to an embodiment of the present invention, the preparation method further comprises washing the reaction product obtained by solid-liquid separation. For example, the washing solvent is water. For another example, the washing times may be one, two or more times, preferably three times.

[0053] According to an embodiment of the present invention, the method for preparing Er-MOF comprises reacting a compound having a structure shown in Formula I with an Er source and polyvinyl pyrrolidone in a mixed solvent of ethanol and DMF to obtain Er-MOF.

[0054] Preferably, the molar ratio of the compound of the structure shown in Formula I to the Er source is 1:(1-5), exemplified by 1:1, 1:2, and 1:5.

[0055] Preferably, the Er source may be selected from ErCl3·6H2O, for example.

[0056] Preferably, the mass ratio of the compound of the structure represented by Formula I to polyvinyl pyrrolidone is 1:(2-10), exemplified by 1:2, 1:5, and 1:10.

[0057] Preferably, in the mixed solvent of ethanol and DMF, the volume ratio of ethanol to DMF is 1:(1-5), exemplified by 1:1, 1:3, 1:5.

[0058] Preferably, the reaction temperature is 160-200°C, exemplified by 160°C, 180°C, 200°C; the reaction time is 24-72h, exemplified by 24h, 48h, 72h.

[0059] Preferably, the preparation method further comprises the step of separating the Er-MOF solid product from the reaction mixture after the reaction is completed. For example, centrifugation. For another example, the centrifugation speed can be 6000-12000 rpm, exemplified by 6000 rpm, 8000 rpm, 10000 rpm, and 12000 rpm.

[0060] Preferably, the preparation method further comprises washing and drying the separated product. For example, the separated product is centrifugally washed with ethanol and distilled water in sequence until the supernatant is clear.

[0061] The present invention also provides application of the composite material in preparing a photoelectrochemical aptamer sensor.

[0062] The present invention also provides a photoelectrochemical aptamer sensor, which comprises the Er-MOF@AuNPs composite material.

[0063] According to an embodiment of the present invention, the sensor further comprises a gold nanoparticle-modified aflatoxin B1 aptamer (AuNPs-Apt) and a hairpin DNA; the Er-MOF@AuNPs composite material and the gold nanoparticle-modified aflatoxin B1 aptamer are respectively connected to the two ends of the hairpin DNA.

[0064] According to an embodiment of the present invention, the sequence of the aflatoxin B1 aptamer (Apt) is 5'-GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA-(CH2)6-SH-3'.

[0065] According to an embodiment of the present invention, the sequence of the hairpin DNA is SH-(CH2)6-GCACATACGCATGCTCCCTTTACGCTT TTTTTTTACAGAGAGACAACACGTGGCGTATGTGC.

[0066] According to an embodiment of the present invention, the gold nanoparticle-modified aflatoxin B1 aptamer is prepared by reacting gold nanoparticles with aflatoxin B1 aptamer under the action of a TCEP reducing agent.

[0067] Preferably, the reaction molar ratio of aflatoxin B1 aptamer to gold nanoparticles is (1-10):1, exemplified by 1:1, 5:1, 8:1, and 10:1.

[0068] Preferably, the reaction molar ratio of aflatoxin B1 aptamer to TCEP is 1:(50-200), exemplified by 1:50, 1:100, and 1:200.

[0069] Preferably, the gold nanoparticles are prepared by reducing HAuCl4 with trisodium citrate.

[0070] The present invention also provides a method for preparing the above-mentioned photoelectrochemical aptamer sensor, comprising covalently coupling the Er-MOF@AuNPs composite material with a gold nanoparticle-modified aflatoxin B1 aptamer (AuNPs-Apt) and a hairpin DNA to prepare the photoelectrochemical aptamer sensor.

[0071] The present invention also provides the use of the above-mentioned photoelectrochemical aptamer sensor in detecting aflatoxin B1, a target object to be detected.

[0072] The present invention also provides a method for detecting aflatoxin B1 using the above-mentioned photoelectrochemical aptamer sensor, which comprises mixing aflatoxin B1, a target object to be detected, with the photoelectrochemical aptamer sensor.

[0073] According to an embodiment of the present invention, the method further comprises mixing the sample to be tested containing the target to be tested with the photoelectrochemical aptamer sensor, measuring the photocurrent intensity of the photoelectrochemical aptamer sensor, and calculating the concentration of the target to be tested.

[0074] Preferably, the concentration of the target to be detected is calculated by substituting into a concentration-dependent standard curve of the target to be detected.

[0075] According to an embodiment of the present invention, the method further comprises preparing solutions of the target substance to be detected with different concentrations.

[0076] According to an embodiment of the present invention, the method specifically comprises the following steps:

[0077] 1) Modify the Er-MOF@AuNPs composite material on the electrode;

[0078] 2) modifying the hairpin DNA on the electrode obtained in step 1);

[0079] 3) modifying the aflatoxin B1 aptamer modified with gold nanoparticles on the electrode obtained in step 2);

[0080] 4) preparing aflatoxin B1 solutions of different concentrations;

[0081] 5) Draw a concentration-dependent standard curve of the target substance to be tested;

[0082] Preferably, the steps for drawing the concentration-dependent standard curve of the target to be detected are as follows: mix the photoelectrochemical aptamer sensor prepared in step 3) with the target solution of known concentration prepared in step 4), incubate, and measure the photocurrent intensity of the photoelectrochemical aptamer sensor respectively, and use the photocurrent difference before and after binding to the target aflatoxin B1 (ΔI=I-I0) as the vertical coordinate and the logarithm of the concentration of the target solution as the horizontal coordinate to draw a concentration-dependent standard curve of the target to be detected.

[0083] 6) Detecting the concentration of the target substance to be tested;

[0084] The photoelectrochemical aptamer sensor prepared in step 3) is mixed with a solution of the target to be measured with an unknown concentration, incubated, and the photocurrent intensity of the photoelectrochemical aptamer sensor is measured and substituted into the concentration-dependent standard curve of the target to be measured drawn in step 5) to obtain the concentration of the target to be measured.

[0085] According to an exemplary embodiment of the present invention, the concentration of the aflatoxin B1 solution is greater than 0 and less than or equal to 20 ng mL -1 , preferably 0.005-20 ng mL -1 .

[0086] The present invention also provides the use of the above detection method, which is used for the detection of aflatoxin B1;

[0087] Preferably, the detection method is used for the detection of aflatoxin B1 in food.

[0088] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0089] (1) The present invention uses Er-MOF@AuNPs as the photoelectric active material, and its excellent electrical conductivity and small energy band gap can effectively improve the photoelectric efficiency. The aptamer capture substrate is prepared by fixing the hairpin DNA by Au-S covalent bond. As a rigid two-dimensional structure, the hairpin DNA has good stability and anti-interference, and can effectively reduce the sensor background signal. The gold nanoparticle-modified aptamer (AuNPs-Apt) can achieve specific binding with the hairpin DNA through base complementary pairing. The signal amplification is achieved by utilizing the advantages of the excellent electrical conductivity and large specific surface area of ​​gold nanoparticles. The photoelectrochemical aptamer sensor in the present invention has the advantages of low cost, high sensitivity, high selectivity, etc., and can achieve rapid and sensitive detection of fungal toxins in the visible light region, effectively overcoming the shortcomings of traditional detection methods.

[0090] (2) The present invention successfully synthesized a new type of polycarboxyl ionic liquid (PIMBImBr ionic liquid), which has good coordination ability with metals. At the same time, the present invention first proposed to use PIMBImBr ionic liquid as a ligand and to react with metal Er3+ Synthesis of new MOF nanomaterials.

[0091] (3) The present invention uses Er-MOF@AuNPs as the photoelectric material, which has a large specific surface area, good electrical conductivity, and a narrower energy band gap, and can effectively improve the detection sensitivity.

[0092] (4) The present invention utilizes aflatoxin B1 aptamers modified with gold nanoparticles to achieve signal amplification and improve detection sensitivity through the surface plasmon resonance effect and conductive properties of gold nanoparticles.

[0093] (5) The present invention utilizes hairpin DNA as the aptamer capture substrate, and its rigid two-dimensional structure has good stability and anti-interference properties, which can effectively reduce the sensor background signal.

[0094] (6) The sensor prepared by the present invention has the advantages of low cost, high sensitivity, high selectivity, etc., and can achieve rapid and sensitive detection of aflatoxin B1 in the visible light region, which can effectively overcome the shortcomings of traditional detection methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0095] Figure 1 (A) and (B) are respectively the hydrogen nuclear magnetic resonance spectrum and the Fourier transform infrared spectrum of the PIMBImBr ionic liquid of the present invention.

[0096] Figure 2 This is a field emission scanning electron microscope image of the Er-MOF of the present invention.

[0097] Figure 3 It is the ultraviolet diffuse reflectance spectrum diagram and energy band gap diagram of Er-MOF of the present invention.

[0098] Figure 4 It is a transmission electron microscope image of the Er-MOF@AuNPs composite material of the present invention.

[0099] Figure 5 It is the element mapping diagram of the Er-MOF@AuNPs composite material of the present invention.

[0100] Figure 6 It is an X-ray photoelectron spectrum of the Er-MOF@AuNPs composite material of the present invention.

[0101] Figure 7 is a transmission electron microscopy image of the AuNPs of the present invention.

[0102] Figure 8 (a) and (b) are the ultraviolet absorption spectra of AuNPs and AuNPs-Apt of the present invention, respectively.

[0103] Fig. 9This is a schematic diagram of the preparation process of the photoelectrochemical aptamer sensor for aflatoxin B1 of the present invention.

[0104] Fig.10 (a), (b), (c), (d), (e), and (f) are the AC impedance diagrams of bare GCE, Er-MOF@AuNPs / GCE, hDNA / Er-MOF@AuNPs / GCE, BSA / hDNA / Er-MOF@AuNPs / GCE, AuNPs-Apt / BSA / hDNA / Er-MOF@AuNPs / GCE, and AFB1 / AuNPs-Apt / BSA / hDNA / Er-MOF@AuNPs / GCE during the preparation of the photoelectrochemical aptamer sensor of the present invention, respectively.

[0105] Fig.11 (a), (b), (c), (d), (e), and (f) are the photocurrent-time response curves of bare GCE, Er-MOF@AuNPs / GCE, hDNA / Er-MOF@AuNPs / GCE, BSA / hDNA / Er-MOF@AuNPs / GCE, AuNPs-Apt / BSA / hDNA / Er-MOF@AuNPs / GCE, and AFB1 / AuNPs-Apt / BSA / hDNA / Er-MOF@AuNPs / GCE in the preparation process of the photoelectrochemical aptamer sensor of the present invention, respectively.

[0106] Fig.12 The graph is a relationship between the photocurrent response of the photoelectrochemical aptamer sensor of the present invention and the ascorbic acid concentration.

[0107] Fig.13 The graph is a relationship between the photocurrent response of the photoelectrochemical aptamer sensor of the present invention and the incubation time of aflatoxin B1.

[0108] Fig.14 (A) and (B) are respectively a photocurrent response diagram of the photoelectrochemical aptamer sensor prepared by the present invention to different concentrations of aflatoxin B1 and a linear relationship curve of the sensor's response to aflatoxin B1.

[0109] Fig.15 The anti-interference performance experimental results of the photoelectrochemical aptamer sensor prepared in the present invention.

[0110] Fig.16 (A) and (B) are the storage stability and photoelectric stability experimental results of the photoelectrochemical aptamer sensor prepared in the present invention.

[0111] Fig.17 These are the reproducibility experimental results of the photoelectrochemical aptamer sensor prepared in the present invention. DETAILED DESCRIPTION

[0112] The technical scheme of the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only exemplary descriptions and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are included in the scope that the present invention is intended to protect.

[0113] Unless otherwise specified, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods.

[0114] Example 1

[0115] The preparation method of PIMBImBr ionic liquid comprises the steps:

[0116] (1) Phenanthrenequinone (1.041 g, 5 mmol), 4-(imidazol-1-yl)benzaldehyde (0.861 g, 5 mmol), methyl 5-aminoisophthalate (2.091, 10 mmol), and ammonium acetate (0.0385 g, 0.5 mmol) were dissolved in 150 mL of glacial acetic acid and reacted at 130° C. for 3 h under the protection of nitrogen. After the reaction was completed, ammonia water was added to neutralize the mixture, and then extracted with dichloromethane, the organic layer liquid was collected, and column chromatography was performed for separation and purification (eluent: dichloromethane: methanol = 50:1, v / v).

[0117] (2) The product (600 mg, 1.1 mmol) obtained in step (1) and methyl 4-bromomethylbenzoate (506.8 mg, 2.2 mmol) were placed in a 50 mL single-necked flask, 50 mL of acetonitrile was added to dissolve, and heated under reflux at 85° C. for 48 h. After the reaction was completed, anhydrous ether was added to the reaction solution, and a precipitate was immediately generated and filtered, and washed with anhydrous ether three times, and the filter cake was collected.

[0118] (3) The product obtained in step (2) (570 mg, 0.58 mmol) was placed in a 50 mL single-necked flask, potassium hydroxide (292.3 mg, 5.22 mmol) was added, 20 mL of ethanol and distilled water (v:v=4:1) were added as solvents, and the mixture was reacted at 80°C for 4 h. After the reaction, the solvent was suspended to dryness, and 40 mL of distilled water was added to dissolve the mixture, and the pH was adjusted to 1-2 with concentrated hydrochloric acid, and a precipitate was immediately generated. The mixture was filtered and washed with distilled water for 3 times, and then the filter cake was collected and vacuum dried to obtain the target product, PIMBImBr ionic liquid.

[0119] Figure 1 (A) is the hydrogen nuclear magnetic resonance spectrum of the PIMBImBr ionic liquid prepared in this example, 1HNMR (600MHz, DMSO-d6) δ: 13.44 (s, 3H, COOH), 8.97–8.91 (m, 2H), 8.91–8.85 (m, 2H), 8.73 (q, J=1.6Hz , 1H), 8.68 (dd, J=7.9, 1.4Hz, 1H), 8.35 (d, J=1.6Hz, 2H), 7.78 (ddd, J=8.0, 6.9, 1.1Hz, 2H), 7.68 (ddd , J = 8.4, 7.0, 1.5 Hz, 2H), 7.54 (ddd, J = 8.3, 7.0, 1.3 Hz, 2H), 7.43–7.30 (m, 3H), 7.24–7.14 (m, 3H), 7.00 (dd, J = 8.4, 1.2 Hz, 2H), 6.51–6.46 (m, 2H). The chemical shift values ​​of the spectrum and the types and contents of hydrogen atoms in the molecule confirm that the present invention successfully synthesized the PIMBImBr ionic liquid.

[0120] Figure 1 (B) is the Fourier infrared spectrum of the PIMBImBr ionic liquid prepared in this example, where 3430 cm -1 The vibration peak of OH in water molecules is at 1708 cm -1 The vibration peak at 1605 cm-1 is attributed to the characteristic peak of -COOH functional group. -1 and 1500cm -1 The two bands at 1452 cm are the stretching vibration peaks of the benzene ring skeleton. -1 and 1239cm -1 The peak at 758 cm is the skeleton stretching vibration peak of C=C and C=N in the imidazole ring. -1 and 722cm -1 It is attributed to the in-plane bending vibration of =CN-CH= and -CH=CH-N in the imidazole ring. The infrared spectrum proves that the present invention has successfully prepared the PIMBImBr ionic liquid.

[0121] Example 2

[0122] The preparation method of Er-MOF comprises the following steps:

[0123] The PIMBImBr ionic liquid (40 mg, 0.04 mmol) prepared in Example 1, ErCl3·6H2O (30.5 mg, 0.08 mmol), and polyvinyl pyrrolidone (200 mg) were added to a 25 mL polytetrafluoroethylene-lined stainless steel container, and 12 mL of ethanol and DMF solution (v:v=1:3) were added, stirred and dissolved, and then placed in an oven and heated to 180°C for 24 h. At a speed of 12000 rpm, the mixture was centrifuged and washed with anhydrous ethanol and distilled water in turn until the supernatant was clear. Er-MOF solid was obtained under vacuum drying at 60°C.

[0124] Figure 2 This is a scanning electron microscope characterization image of the Er-MOF nanospheres prepared in this example. From the results in the figure, it can be seen that the prepared Er-MOF is spherical with a diameter of about 80-120 nm.

[0125] Figure 3 It is the ultraviolet diffuse reflectance spectrum and energy band gap diagram of the Er-MOF nanospheres prepared in this embodiment. It can be seen from the figure that the material has good absorption and a narrow energy band gap (1.59 eV) in the visible light region, which proves that the material has good photoelectric conversion performance and is helpful to improve the photoelectric conversion efficiency of the sensor.

[0126] Example 3

[0127] The preparation method of Er-MOF@AuNPs composite material comprises the following steps:

[0128] Weigh 20 mg of Er-MOF prepared in Example 2 into a 25 mL eggplant-shaped bottle and evacuate for 30 min. Under negative pressure, inject 20 mL of 20 mM HAuCl4 solution into it and disperse it evenly by ultrasonication. Stir for 3 h under ice bath conditions, collect solids by centrifugation, and then disperse the solids in 10 mL of ultrapure water. Add 2 mL of 0.01 M NaBH4 solution under vigorous stirring, react for 30 s, and stop the reaction when the solution color turns black. Wash with ultrapure water by centrifugation 3 times, collect the black solids to obtain the Er-MOF@AuNPs composite material.

[0129] Figure 4 3 is a transmission electron micrograph of the Er-MOF@AuNPs composite material prepared in this example; it can be seen from the figure that a large number of gold nanoparticles are evenly distributed on the surface of the Er-MOF nanospheres, wherein the size of the gold nanoparticles is about 15 nm.

[0130] Figure 5is the element mapping diagram of the Er-MOF@AuNPs composite material prepared in this embodiment; the element mapping image confirms the uniform distribution of Au, Er, C, N and O elements in the entire Er-MOF@AuNPs nanocomposite material, thereby indicating that AuNPs were successfully synthesized on the Er-MOF surface.

[0131] Figure 6 84.8eV (Au 4f 7 / 2 ) and 88.0 eV (Au 4f 5 / 2 ) are attributed to gold nanoparticles. The peaks at 284.8 eV, 400 eV, and 532 eV correspond to the energy levels of C1s, N1s, and O1s.

[0132] Example 4

[0133] The preparation method of gold nanoparticles comprises the following steps:

[0134] Add 2 mL of 1% HAuCl4 solution and 48 mL of ultrapure water into a 100 mL round-bottom flask and heat to 100°C with rapid stirring. Add 5 mL of 38.8 mM trisodium citrate solution and continue stirring for 10 min until the solution turns wine red. Stop the reaction and cool to room temperature.

[0135] Figure 7 3 is a transmission electron micrograph of the AuNPs prepared in this example; it can be seen from the figure that the AuNPs prepared in this example are spherical, with uniform particle size and a particle size of about 15 nm.

[0136] Example 5

[0137] The preparation process of gold nanoparticle-modified aflatoxin B1 aptamer is as follows:

[0138] 10 μL of AFB1 aptamer solution (100 μM) was mixed with 2 μL of TCEP reducing agent (50 mM) and reacted on a shaker at room temperature for 2 h to open the disulfide bonds in the AFB1 aptamer. The activated AFB1 aptamer solution (10 μL) was added to 2 mL of 0.1 μM AuNPs solution prepared in Example 4, and after incubation at 4°C for 12 h, sodium chloride solution (1 M) was added at a rate of 120 μL / h to finally make the concentration of sodium chloride reach 0.5 M. After standing and incubating for 12 h, the AuNPs-modified AFB1 aptamer (AuNPs-Apt) was obtained, which was separated by centrifugation, washed with ultrapure water, dispersed in a Tris-HCl (10 mM, pH = 7.4) buffer solution, and stored at 4°C for use.

[0139] Figure 8 (a) and (b) are the UV absorption spectra of AuNPs and AuNPs-Apt, respectively. The absorption peak of AuNPs is located at 520nm through UV-visible characteristic absorption characterization. The AFB1 aptamer is fixed on AuNPs through Au-S bonds to obtain the AuNPs-modified AFB1 aptamer (AuNPs-Apt). After the AFB1 aptamer is labeled with AuNPs, the UV-visible absorption peak of AuNPs-Apt is red-shifted to 525nm, and the absorption peak of the aptamer appears at 257nm, proving that the aptamer has been successfully modified by AuNPs.

[0140] Example 6

[0141] like Fig. 9 As shown, a method for constructing a photoelectrochemical aptamer sensor based on Er-MOF@AuNPs to detect aflatoxin B1 comprises the following steps:

[0142] (1) A glassy carbon electrode with a diameter of 3 mm was polished with alumina and cleaned with dilute nitric acid, anhydrous ethanol, and ultrapure water by ultrasonic cleaning (bare GCE);

[0143] (2) After the electrode was dried, 6 μL of 8 mg mL -1 The Er-MOF@AuNPs composite material was dried in an oven at 37° (Er-MOF@AuNPs / GCE);

[0144] (3) 6 μL of 4 μM hairpin DNA was added and incubated at 4 °C for 30 min (hDNA / Er-MOF@AuNPs / GCE), followed by 1% bovine serum albumin (BSA) solution to block nonspecific binding sites on the electrode surface, and the electrode was rinsed with PBS buffer solution at pH 7.4 and dried in a refrigerator at 4 °C (BSA / hDNA / Er-MOF@AuNPs / GCE);

[0145] (4) Continue to drop 6 μL of 0.5 μM gold nanoparticle-modified aflatoxin B1 aptamer solution (AuNPs-Apt), and wash away the unfixed aptamer with a PBS buffer solution with a pH of 7.4 to obtain the AuNPs-Apt / BSA / hDNA / Er-MOF@AuNPs / GCE modified electrode, that is, the photoelectrochemical aptamer sensor is successfully prepared, which can be used for the detection of aflatoxin B1;

[0146] (3) The AuNPs-Apt / BSA / hDNA / Er-MOF@AuNPs / GCE modified electrodes were placed in different concentrations of aflatoxin B1 standard solutions, with concentrations of: 0.005 ng mL -1 , 0.01ng mL -1 , 0.05ng mL -1 , 0.1ngmL -1 , 0.5ng mL -1 , 1ng mL -1 , 5ng mL -1 , 10ng mL -1 , 20ng mL -1 , incubated at 4 °C for 30 min, and then washed with 0.01 M PBS buffer solution with a pH of 7.4 to obtain the AFB1 / AuNPs-Apt / BSA / hDNA / Er-MOF@AuNPs / GCE modified electrode, which is a photoelectrochemical aptamer sensor combined with aflatoxin B1.

[0147] (6) Conducting photoelectrochemical test: Using a 5W white light lamp as the excitation light source, the three-electrode system was used for the test: the photoelectrochemical aptamer sensor prepared in step (4) was used as the working electrode, the Hg / Hg2Cl2 electrode (saturated KCl) was used as the reference electrode, and the platinum wire electrode was used as the counter electrode. The photocurrent was measured by a CHI660E electrochemical workstation (Shanghai Chenhua Instrument Co., Ltd.). The test was carried out in a 0.1M PB buffer solution (pH=7.0) containing 0.05M ascorbic acid, and the working curve was drawn based on the relationship between the obtained photocurrent value and the concentration of the aflatoxin B1 standard solution using the it test method.

[0148] Fig.10 (a), (b), (c), (d), (e), and (f) are impedance diagrams measured for different composite modified electrodes in this embodiment 6, respectively. As can be seen from the figure, after modification with Er-MOF@AuNPs on the bare electrode (GCE), the impedance value increases slightly (b in the figure). After hDNA is further modified to the electrode through the Au-S bond (c in the figure), and BSA blocks the nonspecific binding site (d in the figure), the impedance value increases continuously. After the introduction of AuNPs-Apt, the electron transfer blocking phenomenon is more obvious, so the impedance value increases slightly (e in the figure). After identifying aflatoxin B1, AuNPs-Apt is released from the electrode surface, the steric hindrance is reduced, and its impedance value decreases (f in the figure). The above results show that the present invention successfully prepares a photoelectrochemical aptamer sensor for detecting aflatoxin B1.

[0149] Fig.11(a), (b), (c), (d), (e), and (f) are respectively the photocurrent-time response diagrams measured by the electrodes modified with different composite materials in this Example 6. After the Au-NPs@Er-MOF nanocomposite material is modified on the electrode surface, the photocurrent is significantly improved (b in the figure). With the fixation of hDNA (c in the figure) and the specific blocking of the residual sites by BSA (d in the figure), the photocurrent decreases successively. With the introduction of AuNPs-Apt into the electrode, the photocurrent increases (e in the figure) because AuNPs has good electrical conductivity and surface plasmon resonance effect. When the sensor recognizes AFB1, AuNPs-Apt is released from the electrode surface and the photocurrent decreases (f in the figure). This shows that the present invention has successfully prepared a photoelectrochemical aptamer sensor for detecting aflatoxin B1.

[0150] Fig.12 It is a curve diagram of the relationship between the photocurrent response of the Er-MOF@AuNPs / GCE modified electrode and the ascorbic acid concentration in step (2) of Example 6 of the present invention; It can be seen from the figure that as the ascorbic acid concentration increases from 0 to 0.05M, the photocurrent of the Er-MOF@AuNPs / GCE modified electrode gradually increases. Since ascorbic acid acts as an electron donor, appropriately increasing the concentration of ascorbic acid will increase the possibility of capturing holes. When the ascorbic acid concentration is 0.05M, the photocurrent of the Er-MOF@AuNPs / GCE modified electrode reaches a maximum value. However, after the concentration increases from 0.05M to 0.25M, the excessively high concentration of ascorbic acid will hinder electron transfer, thereby having a negative impact on the photocurrent response. Therefore, the present invention selects 0.05M as the optimal concentration of ascorbic acid.

[0151] Fig.13 The relationship between the incubation time and photocurrent response of aflatoxin B1 in step (4) of Example 6 of the present invention is shown in the figure. As can be seen from the results in the figure, with the increase of incubation time, the photocurrent difference before and after the AuNPs-Apt / BSA / hDNA / Er-MOF@AuNPs / GCE modified electrode recognizes aflatoxin B1 gradually increases, and the photocurrent difference reaches the maximum at 30 minutes. Therefore, the optimal incubation time for aflatoxin B1 is 30 minutes.

[0152] Example 7

[0153] The present invention uses the photocurrent-time method to investigate the photocurrent response of the photoelectrochemical aptamer sensor in Example 6 to different concentrations of aflatoxin B1. Fig.14 (A) and (B) are the photocurrent response of the photoelectrochemical aptamer sensor prepared in Example 6 to different concentrations of aflatoxin B1 and the linear relationship curve of the sensor's aflatoxin B1 response. It can be seen from the figure that when the concentration of aflatoxin B1 is 0.005 ng mL-1 ~10ng mL -1 Within the range, as the concentration of aflatoxin B1 increases, AuNPs-Apt and aflatoxin B1 are specifically recognized, causing AuNPs-Apt to detach from the sensor surface. Therefore, the photocurrent difference before and after binding to aflatoxin B1 (ΔI = I-I0) gradually increases, and the relationship between ΔI and the logarithm of the concentration of aflatoxin B1 [lg C AFB1 (ng mL -1 )] shows a good linear relationship, and the linear equation is: ΔI=52.44lg C AFB1 (ng mL -1 )+138.27(R 2 =0.995), the detection limit was 19.59 fg mL -1 (S / N=3). This indicates that the sensor prepared by the present invention has a wider detection range and a lower detection limit for aflatoxin B1, and can be used for specific and highly sensitive detection of aflatoxin B1.

[0154] Example 8

[0155] Selectivity is one of the important indicators to measure the practicality of photoelectrochemical sensors. The present invention evaluates the selectivity of the sensor by using common interfering substances ochratoxin (OTA), zearalenone (ZEN), and deoxynivalenol (DON) for interference experiments. The AuNPs-Apt / BSA / hDNA / Er-MOF@AuNPs / GCE modified electrode prepared in step (4) of Example 6 was used for 100ng mL -1 OTA, ZEN, and DON were tested independently, and the results are as follows Fig.15 As shown in the figure, the photocurrent response of AuNPs-Apt / BSA / hDNA / Er-MOF@AuNPs / GCE modified electrode to all interferents is weak, almost the same as the blank group. -1 AFB1 was mixed with 100 ng mL -1 OTA, ZEN, and DON were mixed, and the sensor (AuNPs-Apt / BSA / hDNA / Er-MOF@AuNPs / GCE modified electrode prepared in step (4) of Example 6) was incubated in different mixtures for 30 minutes before photoelectric detection. Compared with the photocurrent response of incubating a single AFB1, the photocurrent did not change significantly after incubating the mixture of AFB1 and the interferent, indicating that the sensor has good selectivity for AFB1.

[0156] In order to investigate the storage stability of the sensor, six AuNPs-Apt / BSA / hDNA / Er-MOF@AuNPs / GCE modified electrodes prepared in step (4) of Example 6 were stored at 4°C for one week and used to detect 10 ng mL -1 AFB1. Fig.16 As shown in (A), the sensor retains more than 94% of the initial photocurrent response, indicating that the sensor has good stability.

[0157] In order to evaluate the photoelectric stability of the sensor, AFB1 / AuNPs-Apt / BSA / hDNA / Er-MOF@AuNPs / GCE was excited continuously for 15 times under white light. Fig.16 As shown in (B), it can be seen from the figure that the photocurrent has no significant change, which shows that the sensor prepared by the present invention has good photoelectric stability.

[0158] In order to evaluate the reproducibility of the sensor, six AuNPs-Apt / BSA / hDNA / Er-MOF@AuNPs / GCE electrodes were prepared independently and the concentrations of AuNPs-Apt / BSA / hDNA / Er-MOF@AuNPs / GCE were 10 ng mL -1 After incubation in AFB1 solution for 30 min, the photocurrent test was performed. Fig.17 As shown, the relative standard deviation (RSD) of the test results (511nA, 545nA, 537nA, 513nA, 492nA, 500nA) is 4.01%, which indicates that the sensor of the present invention has good reproducibility.

[0159] Example 9

[0160] In order to investigate the accuracy of the photoelectrochemical aptamer sensor prepared by the present invention in the analysis of real samples, -1 , 0.5ng mL -1 and 1.0 ng mL -1 The results are shown in Table 1. The recoveries of AFB1 at different concentrations were 101%, 105.4%, and 96.7%, respectively. The RSDs of the parallel determination results were all less than 3%. This proves that the sensor prepared by the present invention has good accuracy and can be used for accurate analysis of aflatoxin B1 in actual samples.

[0161] Table 1 Recovery experiment of AFB1 in corn samples

[0162]

[0163] The above is an explanation of the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A compound having a structure shown in formula I:

2. The method for preparing the compound of formula (I) according to claim 1, characterized in that: The preparation method comprises reacting compound 2 with a base to prepare the compound having a structure as shown in formula I above; The compound 2 has the following structure:

3. The preparation method according to claim 2, characterized in that: The molar ratio of the compound 2 to the base is 1:(1-10); And / or, the base is selected from KOH, NaOH; And / or, the synthetic route of the compound of formula I is as follows:

4. The preparation method according to claim 2, characterized in that: The compound 2 is prepared by the following method, including: reacting the compound 1 with methyl 4-bromomethylbenzoate to obtain the compound 2; The compound 1 has the following structure:

5. The preparation method according to claim 4, characterized in that: The molar ratio of the compound 1 to methyl 4-bromomethylbenzoate is 1:(1-5); And / or, the synthetic route of compound 2 is as follows:

6. The preparation method according to claim 4 or 5, characterized in that: The compound 1 is prepared by the following method, including: reacting phenanthrenequinone, 4-(imidazol-1-yl)benzaldehyde, 5-aminoisophthalic acid methyl ester and thiomorpholine to obtain compound 1; The reaction molar ratio of phenanthrenequinone, 4-(imidazol-1-yl)benzaldehyde, 5-aminoisophthalic acid methyl ester and thiomorpholine is 1:1:(2-4); The synthetic route of the compound 1 is as follows:

7. Use of the compound of formula I as claimed in claim 1 and / or the compound of formula I prepared by the preparation method according to any one of claims 2 to 6 in the preparation of photoelectrochemical aptamer sensors.

8. A composite material, characterized in that The composite material comprises Er-MOF and gold nanoparticles located on the surface of Er-MOF, and the surface of Er-MOF is modified with a compound of the structure shown in formula I according to claim 1 and / or a compound of the structure shown in formula I prepared by the preparation method according to any one of claims 2-6.

9. The composite material according to claim 8, characterized in that The Er-MOF is a nanosphere, and the particle size of the Er-MOF is 80-120 nm; And / or, the gold nanoparticles are gold nanoparticles (AuNPs), and the particle size of the gold nanoparticles is 5-20 nm.

10. The method for preparing the composite material according to claim 8 or 9, characterized in that: The preparation method comprises reacting Er-MOF and gold nanoparticles to prepare the composite material.

11. The preparation method according to claim 10, characterized in that: The reaction is carried out in the presence of HAuCl4 and NaBH4, and the HAuCl4 and NaBH4 are added to the reaction system in the form of solutions. Aqueous solutions of HAuCl4 and NaBH4 are prepared respectively, and then Er-MOF is reacted with the HAuCl4 solution, and then with the NaBH4 solution to obtain the composite material.

12. The preparation method according to claim 11, characterized in that: The reaction ratio of Er-MOF, HAuCl4, and NaBH4 is 1 mg: (10-30) μmol: (0.5-2) μmol; And / or, the reaction of Er-MOF and HAuCl4 solution is carried out in an ice bath; the reaction time is 2 to 4 hours.

13. The preparation method according to claim 11, characterized in that: The preparation method of the Er-MOF comprises reacting a compound having a structure shown in formula I with an Er source and polyvinyl pyrrolidone in a mixed solvent of ethanol and DMF to obtain the Er-MOF.

14. The preparation method according to claim 13, characterized in that: The molar ratio of the compound of the structure shown in Formula I to the Er source is 1:(1-5); And / or, the Er source is selected from ErCl3·6H2O; And / or, the mass ratio of the compound of the structure represented by formula I to polyvinyl pyrrolidone is 1:(2-10); and / or, in a mixed solvent of ethanol and DMF, the volume ratio of ethanol to DMF is 1:(1-5); And / or, the reaction temperature is 160-200° C.; the reaction time is 24-72 hours.

15. Use of the composite material according to claim 8 or 9 and / or the composite material prepared by the preparation method according to any one of claims 10 to 14 in preparing a photoelectrochemical aptamer sensor.

16. A photoelectrochemical aptamer sensor, characterized in that: It comprises the composite material according to claim 8 or 9 and / or the Er-MOF@AuNPs composite material prepared by the preparation method according to any one of claims 10-14.

17. The photoelectrochemical aptasensor according to claim 16, characterized in that: The sensor also includes a gold nanoparticle-modified aflatoxin B1 aptamer (AuNPs-Apt) and a hairpin DNA; the Er-MOF@AuNPs composite material and the gold nanoparticle-modified aflatoxin B1 aptamer are respectively connected to the two ends of the hairpin DNA.

18. The photoelectrochemical aptasensor according to claim 17, characterized in that: The sequence of the aflatoxin B1 aptamer (Apt) is 5'-GTTGGGCACGTG TTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCA CA-(CH2)6-SH-3'.

19. The photoelectrochemical aptasensor according to claim 17, characterized in that: The hairpin DNA is SH-(CH2)6-GCACATACGCATGCTCCCTTTACGCTT TTTTT TTACAGAGAGACAACACACGTGGCGTATGTGC.

20. The photoelectrochemical aptasensor according to claim 17, characterized in that: The gold nanoparticle-modified aflatoxin B1 aptamer is prepared by reacting the gold nanoparticles with the aflatoxin B1 aptamer under the action of a TCEP reducing agent; The reaction molar ratio of aflatoxin B1 aptamer and gold nanoparticles is (1-10):1; The reaction molar ratio of aflatoxin B1 aptamer to TCEP is 1:(50-200).

21. Use of the photoelectrochemical aptamer sensor according to any one of claims 16 to 20 in detecting aflatoxin B1 as a target substance to be detected.

22. The method for detecting aflatoxin B1 using a photoelectrochemical aptamer sensor according to any one of claims 16 to 20, characterized in that: The method comprises mixing aflatoxin B1, a target object to be detected, with the photoelectrochemical aptamer sensor.

23. The method of claim 22, wherein: The method further comprises mixing a sample to be tested containing the target to be tested with the photoelectrochemical aptamer sensor, measuring the photocurrent intensity of the photoelectrochemical aptamer sensor, and calculating the concentration of the target to be tested; The concentration of the target to be measured is calculated by substituting the concentration-dependent standard curve of the target to be measured; The method further comprises preparing solutions of the target substance to be detected with different concentrations.

24. The method of claim 22, wherein: The method specifically comprises the following steps: 1) Modify the Er-MOF@AuNPs composite material on the electrode; 2) modifying the hairpin DNA on the electrode obtained in step 1); 3) modifying the aflatoxin B1 aptamer modified with gold nanoparticles on the electrode obtained in step 2); 4) preparing aflatoxin B1 solutions of different concentrations; 5) Draw a concentration-dependent standard curve of the target substance to be tested; The steps of drawing the concentration-dependent standard curve of the target to be detected are as follows: the photoelectrochemical aptamer sensor prepared in step 3) is mixed with the target solution of known concentration prepared in step 4), incubated, and the photocurrent intensity of the photoelectrochemical aptamer sensor is measured respectively, and the photocurrent difference before and after binding to the target aflatoxin B1 (ΔI=I-I0) is used as the ordinate, and the logarithm of the concentration of the target solution is used as the abscissa, to draw a concentration-dependent standard curve of the target to be detected; 6) Detecting the concentration of the target substance to be measured; The photoelectrochemical aptamer sensor prepared in step 3) is mixed with a solution of the target to be measured with an unknown concentration, incubated, and the photocurrent intensity of the photoelectrochemical aptamer sensor is measured and substituted into the concentration-dependent standard curve of the target to be measured drawn in step 5) to obtain the concentration of the target to be measured.

25. Use of the detection method according to any one of claims 22 to 24, for the detection of aflatoxin B1.

Images