Xylosonic peptide compound and its application in anti-parasitic drugs

Abstract

The application belongs to the field of natural medicines, and particularly relates to cyclic peptide natural products-xylonic acid peptides and the use thereof in the preparation of anti-parasitic drugs. Specifically, 12 cyclic peptide natural products containing xylonic acid structural units are disclosed, which exhibit different degrees of anti-parasitic activity in biological activity tests and have wide application value.

Description

Technical Field

[0001] This invention belongs to the field of natural medicines, specifically relating to a new type of cyclic peptide natural product—xylosin—and its use in the preparation of antiparasitic drugs. Background Technology

[0002] Polypeptides are an important family of natural products. Based on differences in biosynthesis, natural polypeptide products can be divided into ribosomal peptides (ribosomal peptides). ri bosomally synthesized and p ost-translationally modified p Ribosomal peptides (RiPPs) and non-ribosomal peptides (NRPs) are broadly classified into two categories. The biosynthesis of RiPPs begins with the assembly of a precursor peptide of 20-100 amino acids by ribosomes. This process involves a series of post-translational modifications (such as the formation of thioether bonds, thiazole / thiazoline rings, head-tail cyclization, etc.) and pruning steps to generate the final natural ribosomal peptide product. The basic building blocks of these peptides are 20 natural amino acids, but complex post-translational modifications endow them with rich chemical structural diversity. Unlike ribosomal peptides, the basic backbone of non-ribosomal peptide natural products is formed by specific non-ribosomal peptide synthases (NRPs). n on- r ibosomal p eptide s Nonribosomal peptides (NRPSs) are biosynthesized. A typical NRPS consists of multiple catalytic modules, each containing catalytic units such as an adenylation (A) domain, a thiolation (T) domain, and a condensation (C) domain. In addition to the 20 natural amino acids, nonribosomal peptide structures can also contain specialized assembly units such as α-hydroxy acids, β-amino acids, and short-chain fatty acids. These specialized assembly units not only ensure the good chemical and biological stability of nonribosomal peptides but also endow them with excellent biological activity and unique modes of action. Many blockbuster clinical drugs, such as the antibacterial vancomycin and daptomycin, the antifungal echinocandin, the antitumor bleomycin, and the antiparasitic emetic, are all natural products of nonribosomal peptides containing specialized assembly units in their structures.

[0003] It is noteworthy that most marketed and potentially druggable peptide natural products possess cyclic structures with head-to-tail linkages, terminal-side chain linkages, or side chain-to-side chain linkages. Studies have shown that cyclization can significantly restrict conformational changes in molecules, enhancing both peptide stability and affinity for their targets. These characteristics make cyclic peptides more promising for drug development than linear peptides. Fungi are an important source of cyclic peptide bioactive natural products; however, discovering novel cyclic peptide drugs using traditional activity-based screening methods is becoming increasingly difficult, and few cyclic peptide natural drugs have been marketed in recent years. Summary of the Invention

[0004] This invention utilizes MALDI-TOF-MS and UHPLC-HRESI-TOF-MS to screen three fungal strains capable of producing novel cyclic peptide natural products. After large-scale fermentation and chromatographic purification, 12 cyclic peptide compounds (compounds 1–12) containing xylan acid units in their structures were obtained. The structures of compounds 1–12 have not been previously reported.

[0005] Therefore, the first object of the present invention is to provide a new class of cyclic peptide compounds—xylosinol peptides or pharmaceutically acceptable salts thereof, characterized by compounds having the following chemical structure:

[0006]

[0007] The xyloside peptides of this invention have been shown in in vitro antiparasitic activity experiments to have a significant inhibitory effect on the growth of Plasmodium falciparum 3D7. Compounds 1 and 11 exhibited the strongest activity, with a half-maximal inhibitory concentration (IC50) of [missing value]. 50 The concentrations (values) reached 13.5 and 10.0 μM (Table 6), indicating that xyloside has excellent antiparasitic activity and broad application prospects.

[0008] Accordingly, the present invention provides the use of the xylan peptide or a pharmaceutically acceptable salt thereof in the preparation of antiparasitic drugs. Therefore, antiparasitic agents containing the above-mentioned xylan peptide are also provided. Preferably, the antiparasitic effect refers to killing Plasmodium falciparum.

[0009] The present invention also provides a pharmaceutical composition for the prevention or treatment of parasites, characterized in that it comprises the aforementioned cyclic peptide natural product xylanoic acid peptide or a pharmaceutically acceptable salt as an active ingredient. Preferably, the parasite is Plasmodium. More preferably, the Plasmodium is Plasmodium falciparum.

[0010] In addition, the present invention also provides a method for extracting the compounds of the present invention from three fungal strains capable of producing novel cyclic peptide natural products. Specifically, as follows:

[0011] Paramyrothecium sp. XJ0827 (accession number CGMCC No. 40144), Paramyrothecium roridum NRRL 2183, or Paramyrothecium roridum MN131194 were cultured in solid culture medium.

[0012] The culture medium carrying the bacteria was cut into small pieces and extracted with 90% ethanol by ultrasound, preferably for 0.5 hours each time, repeated 3 times;

[0013] After filtration, the supernatant extract was collected, concentrated, and then loaded onto the sample using a wet method. After the sample was completely adsorbed by the macroporous adsorption resin, it was eluted sequentially with water, 50% methanol / water, and methanol.

[0014] The compounds were separated and purified by semi-preparative high-performance liquid chromatography, using acetonitrile-water (containing 0.1% formic acid) as the mobile phase with isocratic elution (v / v, 65:35) at a flow rate of 2.5 mL / min, to obtain compounds 1, 2 and 3; or compound 4; or compounds 5, 6, 7, 8, 9, 10, 11 and 12.

[0015] The strain involved in this invention, XJ0827, is classified as Paramyrothecium sp. and was deposited on March 9, 2022, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 40144. Detailed Implementation

[0016] The following embodiments are further illustrations of the present invention and are not intended to limit the invention.

[0017] Example 1: Preparation and structural analysis of compounds 1–12 of the present invention

[0018] 1.1 Instruments and Materials

[0019] The fungal strain Paramyrothecium sp. CGMCC No. 40144 used in the experiment was isolated from soil samples from northern Xinjiang. The specific isolation process was as follows: 1 g of soil sample was weighed, 9 mL of ddH2O was added, and the mixture was vortexed for 30 s to prepare a 10⁻⁶ solution. -1 Soil suspensions of varying concentrations were prepared by gradient dilution to a concentration of 10. -2 10 -3The suspension was prepared. Bengal red agar (0.5% peptone, 1% glucose, 0.1% potassium dihydrogen phosphate, 2% agar, 0.05% magnesium sulfate, 0.003% Bengal red, 0.033% chloramphenicol) was used for strain screening. Three biological replicates were performed for each concentration. The sample number, concentration, and date were recorded for each plate. The plates were incubated statically at 28°C, observed daily, and colonies were promptly removed and transferred to potato dextran agar (PDA) medium (0.4% potato starch, 2% glucose, 1.5% agar powder). After 2-3 subcultures, duplicate strains were excluded based on morphology. Among them, strain XJ0827 was identified as a fungus of the genus Paramyrothecium after ITS sequence sequencing. It is currently deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number Paramyrothecium sp. CGMCC No. 40144 and deposit date of March 9, 2022.

[0020] The strain was identified, and the ITS sequencing results are as follows:

[0021] GGGGCTTTCGAGTTACAACTCCCACCCTTTGTGACCTTACCTATCGTTGCTTCG GCGGGATCGCCCCGGCGCCTTCGGGCCCGGAACCAGGCGCCCGCCGGAGGCCCCAAACTCTTATGTCTTTAGTGGTTTTCTCCTCTGAGTGACACATAAACAAATAAATAAAAAC TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATA AGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAGGCCCCCAGT GCCTGGCGTTGGGGATCGGCGTGGGCGGCGACGGCTCTCCGGAGCCCGAGCCAATGCCTGCCGGCCCCGAAATTCAGTGGCGGTCTCGCTGTAGTCCCCCTCTGCGTAGTAGCA CAACTCGCATTGGAGCTCGGCGGTGGCCATGCCGTAAAACACCCCACTTCTGAAAGT TGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA A.

[0022] Paramyrothecium roridum NRRL 2183 and Paramyrothecium roridum MN131194 were purchased from Agriculture Research Service Culture Collection (USA) and Guangzhou Muen Biotechnology Co., Ltd., respectively. Analytical grade methanol and ethanol used in the experiments were produced by Sinopharm Chemical Reagent Co., Ltd. Chromatographic grade methanol, acetonitrile, and formic acid were produced by Fisher Chemical. D101 macroporous adsorption resin was produced by Shanghai Maclean Biochemical Technology Co., Ltd. CHROMATOREX C18 MB 100-40 / 75 reversed-phase silica gel packing was produced by Fuji Silicon Chemical Co., Ltd. (Japan). ZORBOX Eclipse Plus C18 reversed-phase analytical ultra-high performance liquid chromatography column (2.1 mm × 50 mm, 1.8 μm) and ZORBOX RX-C18 reversed-phase semi-preparative high performance liquid chromatography column (9.4 mm × 250 mm, 5 μm) were purchased from Agilent Technologies, Inc. (USA). The BUCHI R-300 rotary evaporator, BUCHI I-300 touchscreen central control unit, BUCHI V-300 PTFE membrane vacuum pump, and BUCHI B-300 electric thermostatic water bath were all manufactured by BUCHI GmbH, Switzerland. The cryogenic coolant circulation pump was manufactured by Shanghai Zhixin Experimental Instrument Technology Co., Ltd. The analytical high-performance liquid chromatograph (Agilent 1290 Infinity II), the semi-preparative high-performance liquid chromatograph (Agilent 1260 Infinity II), the HRESI-TOF mass spectrometer (Agilent 6530), and the 600MHz nuclear magnetic resonance spectrometer (Agilent DD2) were manufactured by Agilent Technologies, Inc., USA. The AutoFlex MALDI-TOF mass spectrometer was manufactured by Bruker GmbH, Germany. The deuterated reagents used in the nuclear magnetic resonance spectroscopy were manufactured by Cambridge I.L. (CIL), Inc., USA.

[0023] 1.2 Isolation and purification of compounds 1–12

[0024] Paramyrothecium sp. CGMCC No. 40144 was activated on PDA medium and statically cultured at 28°C for 5 days. Fungal spores were collected with sterile water and diluted to 1×10⁻⁶. 6 / mL concentration. The spore solution was inoculated into 12L of PDA medium and statically cultured at 28℃ for 14 days. The fermentation medium was collected, and the medium carrying the cells was cut into small pieces and placed in a 10L extraction vessel. An equal volume of 90% ethanol was used for ultrasonic extraction for 0.5h each time, repeated 3 times. After filtration, the supernatant extract was collected and concentrated to 1L. Wet loading was performed, and after the sample was completely adsorbed by the macroporous adsorption resin, gradient elution was performed sequentially with water, 50% methanol / water, and methanol, with each gradient elution consisting of 3 column volumes, each column volume being 2.5L. The methanol fraction (4.7g) was subjected to gradient elution by medium-pressure reversed-phase ODS column chromatography (methanol / water, v / v, 50:50→100:0) to obtain 6 fractions Fr.A–Fr.F. Detection of these fractions using MALDI-TOF-MS and analytical high-performance liquid chromatography revealed that xylose peptides were entirely concentrated in fraction Fr.E (750mg). The compounds were separated and purified by semi-preparative high performance liquid chromatography with a UV detection wavelength of 210 nm. The mobile phase was acetonitrile-water (containing 0.1% formic acid) with isocratic elution (v / v, 65:35) at a flow rate of 2.5 mL / min, yielding compounds 1 (51 mg), 2 (13 mg), and 3 (7 mg).

[0025] Paramyrothecium roridum NRRL 2183 was fermented on a large scale using the same method. After similar solvent extraction and column chromatography separation, the xylosin peptide component Fr.E (970 mg) was obtained. This was then purified by semi-preparative high-performance liquid chromatography (HPLC) at a UV detection wavelength of 210 nm, using methanol-water (containing 0.1% formic acid) as the mobile phase with isocratic elution (v / v, 75:25) at a flow rate of 2.5 mL / min, yielding compound 4 (11 mg).

[0026] The same method was used for large-scale fermentation of Paramyrothecium roridum MN131194. After similar solvent extraction and column chromatography separation, the xylosin peptide component Fr.E (580 mg) was obtained. This was then purified by semi-preparative high-performance liquid chromatography (HPLC) at a UV detection wavelength of 210 nm using acetonitrile-water (containing 0.1% formic acid) as the mobile phase (v / v, 65:35; v / v, 55:45) at a flow rate of 2.5 mL / min, yielding compounds 5 (2 mg), 6 (8 mg), 7 (3 mg), 8 (3 mg), 9 (3 mg), 10 (3 mg), 11 (26 mg), and 12 (2 mg).

[0027] 1.3 Structural analysis of compounds 1–12

[0028] The structures of compounds 1–12 were identified by resolving high-resolution mass spectrometry, one-dimensional and two-dimensional nuclear magnetic resonance spectra as follows:

[0029]

[0030] The structural identification data of compounds 1–12 are as follows:

[0031] Compound 1: White powder, UV(CH3OH)λ max (logε)205(4.53)nm, 1H and 1C NMR data are shown in Table 1, HRESIMS m / z 1120.6295 [M+H] + (calcd forC 54 H 90 N9O 16 ,1120.6500).

[0032] Compound 2: white powder, UV(CH3OH)λ max (logε)205(4.41)nm, 1H and 1C NMR data are shown in Table 1, HRESIMS m / z 1120.6294 [M+H] + (calcd forC 54 H 90 N9O 16 ,1120.6500).

[0033] Compound 3: white powder. UV(CH3OH)λ max (logε)205(4.54)nm, the proton and carbon NMR spectra are shown in Table 1, HRESIMS m / z 1120.6288 [M+H] + (calcd forC 54 H 90 N9O 16 ,1120.6500).

[0034] Compound 4: white powder. UV(CH3OH)λ max (logε)205(4.40)nm, 1H and 1C NMR data are shown in Table 2, HRESIMS m / z 1084.6676 [M+H] + (calcd forC 52 H 94 N9O 15 ,1084.6863).

[0035] Compound 5: White powder, UV (CH3OH)λ max(logε)205(4.40)nm, 1H and 1C NMR data are shown in Table 3, HRESIMS m / z 1100.5845 [M+Na] + (calcd for C 51 H 83 N9O 16 Na, 1100.5850).

[0036] Compound 6: White powder UV(CH3OH)λ max (logε)205(4.53)nm, 1H and 1C NMR data are shown in Table 3, HRESIMS m / z 1114.6050 [M+Na] + (calcd forC 52 H 85 N9O 16 Na, 1114.6006).

[0037] Compound 7: White powder, UV(CH3OH)λ max (logε)205(4.34)nm, 1H and 1C NMR data are shown in Table 3, HRESIMS m / z 1114.6044 [M+Na] + (calcd forC 52 H 85 N9O 16 Na, 1114.6006).

[0038] Compound 8: White powder, UV(CH3OH)λ max (logε)205(4.46)nm, 1H and 1C NMR data are shown in Table 4, HRESIMS m / z 1128.6219 [M+Na] + (calcd forC 53 H 87 N9O 16 Na, 1128.6163).

[0039] Compound 9: White powder, UV(CH3OH)λ max (logε)205(4.42)nm, 1H and 1C NMR data are shown in Table 4, HRESIMS m / z 1114.6055 [M+Na] + (calcd forC 52 H 85 N9O 16 Na, 1114.6006).

[0040] Compound 10: White powder, UV (CH3OH)λ max (logε)205(4.40)nm, 1H and 1C NMR data are shown in Table 4, HRESIMS m / z 1128.6173 [M+Na] + (calcd for C 53 H 87 N9O 16 Na, 1128.6163).

[0041] Compound 11: White powder, UV(CH3OH)λ max (logε)205(4.43)nm, 1H and 1C NMR data are shown in Table 5, HRESIMS m / z 1128.7036 [M+H] + (calcd forC 54 H 98 N9O 16 ,1128.7126).

[0042] Compound 12: white powder. UV(CH3OH)λ max (logε)205(4.62)nm, 1H and 1C NMR data are shown in Table 5, HRESIMS m / z 1128.7115 [M+H] + (calcd forC 54 H 98 N9O 16 ,1128.7126).

[0043] Table 1. NMR data of compounds 1–3 (test solvent: CD3OD)

[0044]

[0045]

[0046] a The proton and carbon NMR spectra were recorded at 600 MHz and 150 MHz, respectively.

[0047] b Multiple peaks due to signal overlap

[0048] Table 2. NMR data of compound 4 (test solvent: CD3OH)

[0049]

[0050] aThe proton and carbon NMR spectra were recorded at 600 MHz and 150 MHz, respectively.

[0051] b Multiple peaks due to signal overlap

[0052] Table 3. NMR data of compounds 5–7 (test solvent: deuterated dimethyl sulfoxide)

[0053]

[0054]

[0055]

[0056] a The proton and carbon NMR spectra were recorded at 600 MHz and 150 MHz, respectively.

[0057] b Multiple peaks due to signal overlap

[0058] Table 4. NMR data of compounds 8–10 (test solvent: deuterated dimethyl sulfoxide)

[0059]

[0060]

[0061] a The proton and carbon NMR spectra were recorded at 600 MHz and 150 MHz, respectively.

[0062] b Multiple peaks due to signal overlap

[0063] Table 5. NMR data of compounds 11 and 12 (test solvent: deuterated dimethyl sulfoxide)

[0064]

[0065]

[0066] a The proton and carbon NMR spectra were recorded at 600 MHz and 150 MHz, respectively.

[0067] b Multiple peaks due to signal overlap

[0068] Example 2: Antimalarial activity tests of compounds 1-12

[0069] 2.1 Instruments and Materials

[0070] Plasmodium falciparum 3D7 was provided by the Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences. Human type O erythrocytes were obtained from volunteers. Fat-rich bovine serum albumin (Albumax I) and RPMI 1640 culture medium containing 25 mM HEPES were purchased from Gibco. Hypoxanthine was purchased from Sigma-Aldrich. SYBR Green-I dye was manufactured by Thermo Fisher Scientific. Sorbitol, sodium bicarbonate, and other chemical reagents were manufactured by Shanghai Aladdin Reagent Co., Ltd. The microplate reader was a Genois Microplate Reader manufactured by Tecan Genios.

[0071] 2.2 Evaluation of in vitro antimalarial activity

[0072] A complete culture medium containing 25 mM HEPES was prepared by adding 50 mg / L hypoxanthine, 2.1 g / L sodium bicarbonate, and 0.5% Albumax I to RPMI 1640 medium, adjusting the pH to 7.2–7.4, and used to culture *P. falciparum* 3D7. Synchronized *Plasmodium falciparum* parasites were generated by adding 5% sorbitol and diluted with complete culture medium containing human type "O" erythrocytes to a concentration of 2% hematocrit and 0.5% cytotoxicity. 90 μL of this solution was added to the wells of a 96-well plate. Unparalleled human type "O" erythrocytes with a 4% hematocrit served as the control group. The test compound was prepared as a 10 mM DMSO stock solution, serially diluted with complete culture medium, and added to 96-well plates to a final concentration of 0–10 mM. -5 M. After incubation at 37℃ for 48 hours, staining with SYBR green-I dye was performed. After incubation in the dark for 2 hours, data were read using a microplate reader. The excitation and emission wavelengths were set to 485nm and 535nm, respectively. The fluorescence values ​​of each experimental well were generated by subtracting the background readings of the blank wells. Each sample was set with 3 replicate wells, and the experiment was repeated 3 times. The final average value was calculated. The growth inhibition rate of each compound against Plasmodium falciparum was calculated using the following formula, and the half-maximal inhibitory concentration (IC50) was then calculated using SPSS (17.0) software. 50 value).

[0073] The results are shown in Table 6, where IC 50 Represented by Mean±SD.

[0074]

[0075] Table 6. In vitro antimalarial activity of some xyloside peptides

[0076]

[0077] As described above, the xyloside peptide of this invention has been shown in in vitro antiparasitic activity experiments to have a significant inhibitory effect on the growth of Plasmodium falciparum 3D7. Compounds 1 and 11 exhibited the strongest activity, with a half-maximal inhibitory concentration (IC50) of [missing value]. 50 The values ​​(IC50) reached 13.5 and 10.0 μM, lower than the positive control drug artemisinin (0.008 μM). Structurally, compounds 1 and 11 belong to the cyclic peptide class, while artemisinin belongs to the sesquiterpene lactone class. Therefore, the significant structural differences may lead to distinctly different antimalarial mechanisms, resulting in varying degrees of antimalarial activity. Furthermore, compounds 1–3 are cyclization position isomers, with the α, γ, and δ hydroxyl groups of xylomic acid participating in the formation of the lactone ring, respectively. Considering their respective antimalarial activities, the cyclization with the α-hydroxyl group exhibits superior activity compared to the cyclization with the γ and δ hydroxyl groups. The IC50 values ​​for compounds 2 and 3 are significantly higher. 50 The values ​​reached 20.9 and 23.7 μM, respectively. This phenomenon also occurred in compounds 8 and 9, which are cyclization position isomers. 50 The concentrations reached 25.5 and >50 μM, respectively, indicating that cyclization at different positions of the hydroxyl groups in xylanic acid can lead to differences in antimalarial activity. Finally, from an amino acid composition perspective, the fifth and sixth amino acids in the structure of the most active xylanic acid peptide 11 differ significantly from those of other xylanic acid peptides (except compound 4), while the remaining amino acid sequences are relatively conserved. Therefore, retaining these two amino acids and modifying the structure of 11 could potentially yield xylanic acid peptide derivatives with even stronger antimalarial activity. In conclusion, xylanic acid peptides possess excellent antiparasitic activity and have broad application prospects. <110> Institute of Biotechnology, Chinese Academy of Agricultural Sciences <120> Xyloyl peptide compounds and their application in antiparasitic drugs <160> 1 <210> 1 <211> 572 <212> DNA <213> Paramyrothecium sp. <400> 1 GGGGCTTTCGAGTTACAACTCCCACCCTTTGTGACCTTACCTATCGTTGCTTCGGCGGGATCGCCCC GGCGCCTTCGGGCCCGGAACCAGGCGCCCGCCGGAGGCCCCAAACTCTTATGTCTTTAGTGGTTTTCTCCTCTGAG TGACACATAAACAAATAAATAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATG CGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGG GCATGCCTGTTCGAGCGTCATTTCAACCCTCAGGCCCCCAGTGCCTGGCGTTGGGGATCGGCGTGGGCGGCGACGGCTC TCCGGAGCCCGAGCCAATGCCTGCCGGCCCCGAAATTCAGTGGCGGTCTCGCTGTAGTCCCCCTCTGCGTAGTAGCACA ACTCGCATTGGAGCTCGGCGGTGGCCATGCCGTAAAACACCCCACTTCTGAAAGTTGACCTCGGATCAGGTAGGAATAC CCGCTGAACTTAAGCATATCAATAAGCGGAGGAA 572

Claims

1. A cyclic peptide natural product xylanoic acid peptide or a pharmaceutically acceptable salt thereof, characterized in that, The cyclic peptide natural product xyloside is compound 11 of the following formula:

2. The use of the cyclic peptide natural product xylanoic acid peptide or a pharmaceutically acceptable salt thereof as described in claim 1 in the preparation of a drug for the prevention or treatment of parasites; wherein the parasite is Plasmodium.

3. The application as described in claim 2, characterized in that, The malaria parasite in question is Plasmodium falciparum.

4. A pharmaceutical composition for the prevention or treatment of parasites, characterized in that, It includes xylanoic acid peptide, a cyclic peptide natural product as described in claim 1, or a pharmaceutically acceptable salt thereof, as an active ingredient; the parasite is Plasmodium.

5. The pharmaceutical composition according to claim 4, characterized in that, The malaria parasite in question is Plasmodium falciparum.

6. The use of a fungal strain, Paramyrothecium sp., in the preparation of the cyclic peptide natural product xylanoic acid peptide as described in claim 1, characterized in that, The fungal strain has the accession number CGMCC No. 40144.

7. A method for preparing the cyclic peptide natural product xylan acid peptide as described in claim 1, characterized in that, It was isolated from strains Paramyrothecium sp. CGMCC No. 40144, Paramyrothecium roridum NRRL 2183, or Paramyrothecium roridum MN131194.

8. The method as described in claim 7, characterized in that, The strain was cultured in a solid culture medium; the culture medium carrying the bacterial cells was cut into small pieces and extracted with ethanol by ultrasonication for 0.5 h each time, repeated 3 times. After filtration, the supernatant extract was collected, concentrated, and then loaded onto the sample using a wet method. After the sample was completely adsorbed by the macroporous adsorption resin, it was eluted sequentially with water, 50% methanol / water, and methanol. Compound 11 was obtained by separation and purification by semi-preparative high performance liquid chromatography, using acetonitrile-water containing 0.1% formic acid as the mobile phase with a v / v ratio of 65:35 and a flow rate of 2.5 mL / min.

9. The method as described in claim 8, characterized in that, The ultrasonic extraction of ethanol was performed using 90% ethanol.

Images