Use of plant fruit shape control gene cmfsi8

By identifying and cloning the melon fruit shape control gene CmFSI8, constructing an overexpression vector, and verifying its fruit shape regulation function in Arabidopsis thaliana, the problem of melon fruit shape improvement was solved, and rapid and efficient improvement of melon breeding was achieved.

CN115677840BActive Publication Date: 2025-12-05BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202110856421.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-07-28
Publication Date
2025-12-05
Estimated Expiration
2041-07-28

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively screen and utilize melon fruit shape QTLs, resulting in difficulties in improving fruit shape in traditional hybridization breeding and failing to meet market demand for high-quality melons.

Method used

By identifying and cloning the single-gene locus CmFSI8 that controls fruit shape, an overexpression vector was constructed and transformed into Arabidopsis thaliana, demonstrating its significant effect on fruit shape in Arabidopsis thaliana, and then applied to melon breeding.

Benefits of technology

This approach enables the improvement of melon fruit shape through molecular methods, promotes the integration of traditional hybridization breeding and molecular breeding, and rapidly obtains new high-quality melon varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0003184169510000011
    Figure HDA0003184169510000011
  • Figure HDA0003184169510000012
    Figure HDA0003184169510000012
  • Figure HDA0003184169510000013
    Figure HDA0003184169510000013
Patent Text Reader

Abstract

The application discloses application of a plant fruit shape control gene CmFSI8. The application provides application of a protein CmFSI8 in a-f; a, changing plant fruit shape; b, inhibiting elongation of a plant organ; c, shortening plant leaf length; d, reducing the length-width ratio of a plant leaf; e, reducing plant plant height; and f, reducing fruit length of a plant. A gene CmFSI8 for controlling melon fruit shape is separated. Overexpression of the gene in Arabidopsis thaliana by means of construction of a transformation vector can significantly cause the leaf of the Arabidopsis thaliana to be round and short, the silique to be short, and the plant to be dwarfed, and the gene plays a role in inhibiting elongation of an organ. The trait control gene of the application provides a new gene resource for melon fruit shape control, and is expected to change the fruit shape of melon through conventional means and genetic engineering technology, and has important application value in breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering, in particular to the application of a plant fruit shape control gene CmFSI8. BACKGROUND

[0002] Cucumis melo L. is an annual herb of the Cucurbitaceae family and is an important economic crop widely planted worldwide. Fruit shape is not only an important horticultural trait affecting yield, but also the most intuitive appearance quality trait when consumers make choices, which will directly affect the value of goods due to the diversification of consumer preferences. Therefore, it is necessary to carry out genetic research on fruit shape.

[0003] At present, many domestic and foreign units have carried out genetic research on the fruit shape of Cucumis melo L. Studies have shown that the genetic law of fruit shape of Cucumis melo L. is relatively complex, which may be limited by the genetic background of the research material (the selection of materials is mostly round and oval), and the fruit shape shows a quantitative genetic pattern (quantitative trait loci, QTL) controlled by multiple genes, and is affected by hormone levels, environmental conditions, fruiting node position, etc. At the same time, some studies have shown that fruit shape will be affected by the sex determination gene a (Perin et al., 2002; Pereira et al., 2018; Pan et al., 2020). The identified fruit shape QTLs have not been subjected to gene cloning and gene function research, and are affected by genetic effects and genetic backgrounds. These QTLs are difficult to effectively screen in offspring through phenotypic observation in traditional hybrid breeding, making it difficult to directly utilize. Therefore, by continuing to screen genetic materials with large differences in background and fruit shape, identifying and cloning single gene genetic loci controlling fruit shape, and revealing the potential molecular genetic mechanism of fruit shape regulation, it has important research significance and research value to clarify the development mechanism of fruit, utilize molecular means to improve the fruit shape of Cucumis melo L., promote the organic combination of traditional hybrid breeding and molecular breeding, accelerate the breeding process of Cucumis melo L., and better meet the needs of the public for high-quality Cucumis melo L. SUMMARY

[0004] An object of the present application is to provide the use of protein CmFSI8 and biological materials thereof.

[0005] The present application provides the use of any one of the following 1) to 3) (protein CmFSI8 and biological materials thereof) in the following a to f:

[0006] 1) protein CmFSI8;

[0007] 2) a nucleic acid molecule encoding protein CmFSI8;

[0008] 3) a recombinant vector, an expression cassette or a recombinant bacterium containing a nucleic acid molecule encoding the protein CmFSI8;

[0009] The protein CmFSI8 is as follows (1) or (2) or (3):

[0010] (1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing;

[0011] (2) a co-expressed protein obtained by connecting a molecular tag to the N-terminus or / and C-terminus of (1);

[0012] (3) a protein having the same function obtained by substitution and / or deletion and / or addition of one or several amino acid residues in (1);

[0013] a) changing the fruit shape of a plant;

[0014] b) inhibiting the elongation of a plant organ;

[0015] c) shortening the length of a plant leaf;

[0016] d) reducing the aspect ratio of a plant leaf;

[0017] e) reducing the plant height of a plant;

[0018] f) reducing the fruit length of a plant.

[0019] The nucleic acid molecule encoding the protein CmFSI8 is a DNA molecule of any one of the following 1) to 4):

[0020] 1) a DNA molecule consisting of the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing;

[0021] 2) a co-expressed nucleic acid molecule obtained by connecting a tag-encoding gene to the end of the sequence shown in 1);

[0022] 3) a DNA molecule having 75% or more identity with the nucleotide sequence defined in 1) and encoding the protein CmFSI8;

[0023] 4) a DNA molecule hybridizing to the nucleotide sequence defined in 1) under stringent conditions and encoding the protein CmFSI8.

[0024] The use of the above-mentioned substance in breeding a plant having at least one of the following phenotypes: changed fruit shape, shortened plant organ, shortened length of a plant leaf, reduced aspect ratio of a plant leaf, reduced plant height, and reduced fruit length is also within the scope of the present application.

[0025] Another object of the present application is to provide a method for producing a transgenic plant having changed fruit shape.

[0026] The method provided by the present application is as follows 1) or 2):

[0027] 1) the method comprises the following steps: increasing the content and / or activity of CmFSI8 protein in the plant of interest, to obtain a transgenic plant with changed fruit shape;

[0028] 2) the method comprises the following steps: increasing the expression of the nucleic acid molecule encoding CmFSI8 protein in the plant of interest, to obtain a transgenic plant with changed fruit shape.

[0029] In the above method, the transgenic plant with changed fruit shape has at least one of the following characteristics:

[0030] 1) compared with the wild type plant, the elongation of the organ of the transgenic plant is inhibited;

[0031] 2) the length of the leaf of the transgenic plant is shorter than that of the wild type plant;

[0032] 4) the length-width ratio of the leaf of the transgenic plant is smaller than that of the wild type plant;

[0033] 5) the plant height of the transgenic plant is smaller than that of the wild type plant;

[0034] 6) the length of the fruit of the transgenic plant is smaller than that of the wild type plant.

[0035] In the above method, the increase of the content and / or activity of the above CmFSI8 protein in the plant of interest, or the increase of the expression of the nucleic acid molecule encoding the above CmFSI8 protein in the plant of interest, is that the nucleic acid molecule encoding CmFSI8 protein is introduced into the plant of interest.

[0036] In the above, the plant is a monocotyledon or a dicotyledon, and in the embodiments of the present application, the plant is preferably Arabidopsis thaliana, Cucumis melo and the like.

[0037] The length of the leaf is specifically the length of the leaf in the longitudinal direction, and in the embodiments of the present application, it is specifically the length of the rosette leaf of Arabidopsis thaliana;

[0038] The length of the fruit is specifically the length of the fruit in the longitudinal direction, and in the embodiments of the present application, it is specifically the length of the silique of Arabidopsis thaliana.

[0039] The present application uses flat-round fruit shape inbred line HP22 and long fruit shape inbred line B8 as hybrid parents, determines that ORF3 in the positioning interval is the CmFSI8 candidate target gene by preparing hybrid F2 population combining BSA-seq and gene mapping cloning method, constructs the overexpression vector of the gene and transforms wild type Arabidopsis thaliana, which can cause Arabidopsis thaliana to produce phenotypes such as round leaf and short silique. It is proved that the application of the gene can produce new melon varieties with round fruit.

[0040] By means of the technical scheme, the application has at least the following obvious beneficial effects:

[0041] (1) The application provides a melon gene (nucleotide sequence as shown in sequence 1) and a protein (amino acid sequence as shown in sequence 2) encoded by the gene.

[0042] (2) Overexpression of the CmFSI8 gene in Arabidopsis thaliana can cause the Arabidopsis thaliana to have shorter pods. Thus, the gene has the function of controlling fruit shape. In the future, by means of conventional crossing, molecular marker assisted selection or genetic engineering, the CmFSI8 gene is introduced into melon, which can improve the fruit shape of melon, and has important theoretical and application value. BRIEF DESCRIPTION OF DRAWINGS

[0043] Figure 1 is the distribution of the Euclidean distance (ED correlation value) of the SNP site of the gene on the chromosome.

[0044] Figure 2 is the fine mapping of the CmFSI8 gene.

[0045] Figure 3 is the molecular identification of the transgenic plant.

[0046] Figure 4 is the phenotype analysis of the transgenic Arabidopsis thaliana. DETAILED DESCRIPTION

[0047] The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0048] The materials, reagents and the like used in the following examples can be obtained from commercial channels unless otherwise specified.

[0049] The following examples are only for further illustration of the application and do not limit the application. In the examples, the experimental methods used are conventional methods unless otherwise specified; the reagents and the like used can be obtained through commercial channels.

[0050] The application will be further described in detail in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application.

[0051] The long fruit variety B8 in the following examples is described in: Ma J, Li C, Huang Y T, Xie Y L, Cheng L L, Wang J. Fine mapping and candidate gene analysis of the melon seed coat color control gene CmSC1 [J]. Chinese Journal of Agricultural Sciences, 2021, 54(10): 2167-2178. The biological material can be obtained from the applicant, and is only used for repeating the related experiments of the application, and cannot be used for other purposes.

[0052] The flat round fruit variety HP22 in the following examples is described in: Ma J, Li CC, Zhang Q, Wang J. Genetic analysis and marker development of melon yellow seed coat [J]. Acta Horticulturae, 2019, 46(S1): 2700 and Ma J, Li CC, Huang YT, Xie YL, Cheng LL, Wang J. Fine mapping and candidate gene analysis of CmSC1, a gene controlling melon seed coat color [J]. Chinese Journal of Agricultural Sciences, 2021, 54(10): 2167-2178. The biological material is available to the public from the applicant, and is only used for repeating the relevant experiments of the present application, and cannot be used for other purposes.

[0053] Example 1, Cloning of CmFSI8 gene

[0054] I. Identification and fine mapping of CmFSI8 gene

[0055] F1 generation was obtained by crossing B8 and HP22, and F2 generation was obtained by selfing F1 generation. A total of 1122 plants of F2 generation were planted, and the data showed that the number of long (medium) fruit shape (fruit shape index FSI>1) single plants: round (flat round) fruit shape (FSI≦1) = 870:252, showing Mendelian genetic segregation ratio of 3:1 (χ 2 0.05 <3.84), indicating that the fruit shape gene is controlled by a single gene. From the F2 genetic population, 30 single plants with fruit shape index greater than 3 and 30 single plants with fruit shape index less than 1 were selected respectively to extract genomic DNA, and the DNA of each single plant was mixed to construct the FL and FS pools. The two parents and the constructed pool were sequenced by Illumina HiSeq with a sequencing depth of 30X. Based on the SNP between the offspring pool and the parents, according to the Euclidean Distance algorithm (ED), only one candidate region associated with the trait was associated on chromosome 8, and the interval physical location with a correlation threshold greater than 3.5 was 26.46-29.82 Mb, with a total length of 3.06 Mb( Figure 1 ), and the tentative gene name controlling the trait was CmFSI8 (Cucumis melo Fruit Sharp Index 8).

[0056] To further fine map the CmFSI8 gene, according to the preliminary positioning results of BSA-seq and the genomic sequencing data of the parents, a pair of InDel markers ID1 and ID2 were developed at the positions of 26.47 Mb and 32.38 Mb of the reference genome, respectively, and genotyping analysis was performed on 782 offspring single plants (including 464 F2 single plants, 262 BC1F1 single plants, and 56 BC2F1 single plants) using the two pairs of molecular markers, and 45 and 76 recombinant individuals were detected, respectively. Figure 2). Then, 12 pairs of InDel markers were developed between markers ID1 and ID2, and finally the CmFSI8 gene was located in the 53.7 kb interval between markers S1 and S2 Figure 2

[0057] II. Candidate gene analysis of CmFSI8

[0058] According to the genomic annotation information of melon DHL92 v3.5 (http: / / cucurbitgenomics.org / organism / 3), there were 3 annotated genes ORF1, ORF2 and ORF3 in the 53.7 kb locating interval Figure 2 ), in which ORF1 encoded Cobyric acid synthase, ORF2 encoded Ty3-gypsy retrotransposon protein, and ORF3 encoded transcription repressor ovate family protein 1 (OFP1); while according to the genomic annotation information of reference genome v3.6 (http: / / cucurbitgenomics.org / organism / 18), there was only one annotated gene ORF3 in the 53.7 kb locating interval. Because the transcription repressor of OFP type was reported to be related to fruit shape in crops such as Arabidopsis, tomato and peach, the ORF3 gene was taken as the candidate gene of CmFSI8.

[0059] III. Sequence analysis of CmFSI8 gene

[0060] In order to isolate the CmFSI8 gene, the reference genomic sequence of the gene (MELO3C025206) was obtained from the melon reference genome sequence database, and the annotation of the gene showed that the coding region was 996 bp in length without intron. The specific primers of the candidate gene (FSI8-F: CCGATGAGAAATCACAAGTTCCGTT; FSI-R: AAATCAAAGAGGTGGAGGAGAAGGT) were designed by using online software Primer-BLAST (http: / / www.ncbi.nlm.nih.gov / ). The total RNA was extracted from the ovary on the day of flowering after grinding in liquid nitrogen according to the method provided by the plant RNA extraction kit (0416-50GK type, Beijing Huaiyueyang Biological Technology Co., Ltd.). About 5 μg of RNA was used to synthesize cDNA by using the PrimeScript RT reagent Kit (Perfect Real Time) of Beijing Quanshijin Biological Technology Co., Ltd. The cDNA was used as the template to amplify the coding region of the candidate gene by PCR, and the PCR product was cloned into the pMD18-T vector (TaKaRa) to construct the recombinant plasmid pMD18-T-FSI8. The sequence of the cloned gene was verified by sequencing, and the sequence of the cloned gene was consistent with the sequence of the reference gene in the database. ​One-Step gDNA Removal and cDNA Synthesis SuperMix kit was used to synthesize cDNA. The candidate gene sequence was amplified from B8 and HP22 by PCR method with high-fidelity KOD enzyme (TOYOBO).

[0061] PCR amplification method of candidate gene sequence: using cDNA of B8 and HP22 as templates, respectively, and using primers FSI8-F and FSI8-R to amplify the coding region fragment of CmFSI8 gene.

[0062] The PCR reaction system is as follows: 2x PCR Buffer for KOD FX 25 μL, 10 μL dNTPs (2 mmol / L each), 2 μL primers (10 μmol / L, FSI8-F + FSI8-R), 1 μL KOD FX enzyme (1 U / μL, TOYOBO), 2 μL cDNA template, and ddH2O to 50 μL. The amplification reaction conditions are as follows: 94°C pre-denaturation for 2 min; 98°C denaturation for 10 s, 59°C annealing for 30 s, 68°C extension for 1 min, 35 cycles; 68°C extension for 5 min, 16°C storage. The PCR amplification product was sent to Beijing Bomeide Science and Technology Development Co., Ltd. for sequencing, and the obtained sequence was spliced and aligned using DNAMAN software. According to the sequencing results, it was found that there was a single base difference (C441T) in the coding region of the gene in the parent HP22, and there were three base differences (C441T, C531T, T753A) in the coding region of the gene in the parent B8, and these mutations did not cause changes in amino acids, i.e. the coding protein sequence of the gene in B8 and HP22 was identical.

[0063] The nucleotide sequence of CmFSI8 gene derived from parent HP22 is sequence 1 in the sequence listing; CmFSI8 gene encodes CmFSI8 protein, and the amino acid sequence thereof is sequence 2 in the sequence listing.

[0064] Example 2, function of CmFSI8 gene

[0065] I. Verification of overexpression of CmFSI8 gene in Arabidopsis thaliana

[0066] Firstly, the plant expression vector pCMBIA1305.1 was modified in the application, and the strong expression promoter CaMV35S was inserted. Then the CmFSI8 gene was connected downstream of the CaMV35S promoter to drive high expression of the CmFSI8 gene. Subsequently, the vector was transformed into Agrobacterium GV3101, and wild-type Arabidopsis thaliana (Col-0) was transformed by dipping flowers to obtain transgenic seeds.

[0067] 1. Construction of overexpression vector

[0068] According to the reference genome sequence, the specific primers of the gene were designed by primer design software (CmFSI8-OE-F: GGTCCCGGGGGATCC CCGATGAGAAATCACAAGTTCCGTT; CmFSI8-OE-R: GCCGCTTTAAGATCTAAA TCAAAGAGGTGGAGGAGAAGGT, the underlined part is the recombination sequence for ligation, and the italic sequence is the restriction enzyme cleavage site).

[0069] The full length of CmFSI8 gene coding region derived from HP22 parent was amplified by PCR method described in Example 1 using high-fidelity KOD enzyme (TOYOBO). The PCR product was identified and purified by agarose gel electrophoresis and stored for later use. The purified PCR product was ligated to pCAMBIA1305 vector (Beijing Xinghuayuetiang Biotechnology Co., Ltd., VECT0160) which was digested with BamHI / BglII and purified for recovery using Clonetech PCR Cloning system (TaKaRa).

[0070] The recombinant vector is a vector obtained by replacing the fragment between the BamHI and BglII cleavage sites of pCAMBIA1305 vector with the CmFSI8 gene shown in SEQ ID NO: 1, and is named pCAMBIA1305-CmFSI8.

[0071] 2. Recombinant bacteria

[0072] The above-mentioned recombinant vector pCAMBIA1305-CmFSI8 was transformed into Agrobacterium strain GV3101 by heat shock method to obtain recombinant bacteria.

[0073] 3. Genetic transformation of Arabidopsis thaliana

[0074] 1) Preparation of Arabidopsis thaliana recipient material

[0075] Wild-type Arabidopsis thaliana (Col-0, Beijing Xinghuayuetiang Biotechnology Co., Ltd., NRR00220) was sown on 1 / 2MS medium, and after 7 days, it was transplanted into soil and grown in a 25°C growth chamber (16h light / 8h darkness). When the main stem of Arabidopsis thaliana reached 15cm in length, flowers were opened and 1-2 siliques were grown, it could be used for transformation experiments.

[0076] 2) Transformation of Arabidopsis thaliana recipient material

[0077] The recombinant bacteria obtained in the above step 2 were inoculated into 5 ml LB liquid medium (containing kanamycin 50 mg / L, rifampicin 50 mg / L) and cultured at 28°C with 250 rpm shaking overnight. The bacteria were collected and suspended in 5% sucrose (0.2% sillwet 77) to prepare a transformation solution which was placed in a petri dish. The flower buds and siliques of Arabidopsis thaliana receptor material which had already bloomed were cut off, the inflorescences were put into the transformation solution for 15 s, the excess transformation solution was shaken off, and the inflorescences were placed on the side, kept away from light and moisturized for 24 h. The transformed plants were placed on a culture rack to continue growing. After one week, the plants were transformed again in the same way. After the seeds of the transformed plants matured, T1 generation seeds were collected.

[0078] 3) Screening of transgenic positive seedlings

[0079] The T1 generation seeds were sowed on 1 / 2MS medium (containing 25 mg / L hygromycin) after sterilization, placed in a refrigerator at 4°C for 3 d for vernalization, and after 10 d, the seedlings with long roots were transplanted into soil to obtain T1 generation CmFSI8 transformed Arabidopsis thaliana plants.

[0080] The leaves were taken for PCR identification as follows, and the phenotype was observed.

[0081] The genomic DNA of the leaves of the T1 generation CmFSI8 transformed Arabidopsis thaliana plants was extracted by CTAB method, the genomic DNA of wild-type Arabidopsis thaliana was used as negative control, and the constructed plasmid pCAMBIA1305-CmFSI8 was used as positive control, PCR identification was performed by using primers TS-F and TS-R, and the size of the target fragment was 433 bp. The sequences of the primers used were TS-F: GAACAAAGAAAGTTGCGGGGAAT, and TS-R: GATAATCATCGCAAGACCGGCA.

[0082] The PCR reaction system was as follows: 2x PCR Buffer for KOD FX 25 μL, 10 μL dNTPs (2 mmol / L each), 2 μL primers (10 μmol / L, TS-F+TS-R), 1 μL KOD FX enzyme (1 U / μL, TOYOBO), 2 μL DNA template, and ddH2O to 50 μL. The amplification reaction conditions were as follows: 94°C pre-denaturation for 2 min; 98°C denaturation for 10 s, 59°C annealing for 30 s, 68°C extension for 1 min, 35 cycles; 68°C extension for 5 min, and 16°C preservation. The PCR product was detected by 1.5% agarose gel, and the gel imaging system was used for photographing.

[0083] The results are shown in Table 1. Figure 3As shown, lane 1 is plasmid DNA, lane 2 is wild type WT, lanes 3-12 are T1 generation CmFSI8 transgenic Arabidopsis plants; M: 1 kb DNA ladder, it can be seen that lanes 3-10 can amplify the 433 bp target fragment of the plant as a positive T1 generation CmFSI8 transgenic Arabidopsis plant.

[0084] 4. Phenotype identification

[0085] The phenotypes of the above positive T1 generation CmFSI8 transgenic Arabidopsis plants (#OE1, #OE2, #OE3) were observed, and wild type Arabidopsis (WT) was used as a control. Five leaves or siliques were measured for each strain, and the experiment was repeated three times, and the results were averaged.

[0086] The results are shown in Figure 4 A: wild type Arabidopsis plants and positive T1 generation CmFSI8 transgenic Arabidopsis plants on the 30th day after sowing (the day of sowing is recorded as the 1st day); B: wild type Arabidopsis plants and positive T1 generation CmFSI8 transgenic Arabidopsis plants on the 40th day after sowing (the day of sowing is recorded as the 1st day); C: rosette leaf phenotype of wild type Arabidopsis plants and positive T1 generation CmFSI8 transgenic Arabidopsis plants on the 40th day after sowing (the day of sowing is recorded as the 1st day); D: siliques phenotype of wild type Arabidopsis plants and positive T1 generation CmFSI8 transgenic Arabidopsis plants on the 50th day after sowing (the day of sowing is recorded as the 1st day); E: statistical analysis of rosette leaf and siliques of wild type Arabidopsis plants and positive T1 generation CmFSI8 transgenic Arabidopsis plants on the 50th day after sowing (the day of sowing is recorded as the 1st day); it can be seen that compared with wild type Arabidopsis, the rosette leaf length of positive T1 generation CmFSI8 transgenic Arabidopsis is significantly shorter, the leaf length-width ratio is smaller, the plant grows slowly and becomes shorter, and the siliques length is significantly shorter.

[0087] It is shown that CmFSI8 gene significantly inhibits the elongation of organs, which indirectly indicates that it will cause changes in fruit shape in melon.

[0088] The above examples are only exemplary descriptions of the present application, but the embodiments of the present application are not limited by the above examples of varieties or materials, and any changes, modifications, substitutions, combinations, simplifications made without deviating from the spirit and principles of the present application are equivalent replacement methods and fall within the scope of the present application. SEQUENCE LISTING <110> Beijing Academy of Agricultural and Forestry Sciences, Huaibei Normal University <120> Application of plant fruit shape control gene CmFSI8 <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 996 <212> DNA <213> Cucumis melo L. <400> 1 atgagaaatc acaagttccg tttctccgac atgataccca acgcctggtt ttacaaactc 60 aaagaaattg gcggcgcctc cagaccaaaa tctttccgtt ccaacaaaaa ccctcaccac 120 ccacctccac ctcccccgcc ctccaaacac aaacaaccac cccctcctcc tccccactct 180 cgttccagaa aatcttacta tttcactaga caactcgaat ccaacgatgc ctacttcgtc 240 aattcccctc caccgtcgcc tccgcttcta ccggtaccaa tccccccgag aaagtcaaca 300 aaacaactca aaccaggaag aaaacaaacg agttcccggt cctccgccaa gctcctcagc 360 tcctcctccg tcggctgcag ctgccacaca acggcggaat ctatctggac aaaatccgat 420 tctcctccag aattctccac ttcaccctcc gacacctccc ctgatttccg aactgacaaa 480 atcctcactg ccgaagcatc caaacacttc gagcacgaca tcgtaatcga cgtatcgtcg 540 aattactcca acaatgccgt catcggcgcc tttgacgaac tggaactccc gccgatcatc 600 acgaaacaga ggaagaaaac agagacaaaa cagagaacga cgacgacaac gacggcagga 660 acaaagaaag ttgcggggaa ttccccgggc gtacggctgc ggattcactc cccgaaaatt 720 gggtaccgga aaatgggagg gaggaaaagc gtttcgtcac ggcggagctt gtcggagagt 780 ttagcgataa tgaaatcatc gtacgatcca caaaaggact tcagagaatc aatggtggag 840 atgattgttg agaataacat taggggttcg aaagaattgg aagatcttct tgcatgttat 900 ctgtgtttga acgccgatga atatcatgat cttattatca aagtttttaa gcagatctgg 960 tttgatctta cgcaaccttc tcctccacct ctttga 996 <210> 2 <211> 331 <212> PRT <213> Muskmelon (Cucumis melo L.) <400> 2 Met Arg Asn His Lys Phe Arg Phe Ser Asp Met Ile Pro Asn Ala Trp 1 5 10 15 Phe Tyr Lys Leu Lys Glu Ile Gly Gly Ala Ser Arg Pro Lys Ser Phe 20 25 30 Arg Ser Asn Lys Asn Pro His His Pro Pro Pro Pro Pro Pro Pro Ser 35 40 45 Lys His Lys Gln Pro Pro Pro Pro Pro Pro His Ser Arg Ser Arg Lys 50 55 60 Ser Tyr Tyr Phe Thr Arg Gln Leu Glu Ser Asn Asp Ala Tyr Phe Val 65 70 75 80 Asn Ser Pro Pro Pro Ser Pro Pro Leu Leu Pro Val Pro Ile Pro Pro 85 90 95 Arg Lys Ser Thr Lys Gln Leu Lys Pro Gly Arg Lys Gln Thr Ser Ser 100 105 110 Arg Ser Ser Ala Lys Leu Leu Ser Ser Ser Ser Val Gly Cys Ser Cys 115 120 125 His Thr Thr Ala Glu Ser Ile Trp Thr Lys Ser Asp Ser Pro Pro Glu 130 135 140 Phe Ser Thr Ser Pro Ser Asp Thr Ser Pro Asp Phe Arg Thr Asp Lys 145 150 155 160 Ile Leu Thr Ala Glu Ala Ser Lys His Phe Glu His Asp Ile Val Ile 165 170 175 Asp Val Ser Ser Asn Tyr Ser Asn Asn Ala Val Ile Gly Ala Phe Asp 180 185 190 Glu Leu Glu Leu Pro Pro Ile Ile Thr Lys Gln Arg Lys Lys Thr Glu 195 200 205 Thr Lys Gin Arg Thr Thr Thr Thr Thr Thr Ala Gly Thr Lys Lys Val 210 215 220 Ala Gly Asn Ser Pro Gly Val Arg Leu Arg Ile His Ser Pro Lys Ile 225 230 235 240 Gly Tyr Arg Lys Met Gly Gly Arg Lys Ser Val Ser Ser Arg Arg Ser 245 250 255 Leu Ser Glu Ser Leu Ala Ile Met Lys Ser Ser Tyr Asp Pro Gin Lys 260 265 270 Asp Phe Arg Glu Ser Met Val Glu Met Ile Val Glu Asn Asn Ile Arg 275 280 285 Gly Ser Lys Glu Leu Glu Asp Leu Leu Ala Cys Tyr Leu Cys Leu Asn 290 295 300 Ala Asp Glu Tyr His Asp Leu Ile Ile Lys Val Phe Lys Gin Ile Trp 305 310 315 320 Phe Asp Leu Thr Gin Pro Ser Pro Pro Pro Leu 325 330

Claims

1. Use of any one of 1) - 3) in a-e; 1) protein CmFSI8; 2) nucleic acid molecule encoding protein CmFSI8; 3) recombinant vector, expression cassette or recombinant bacteria containing nucleic acid molecule encoding protein CmFSI8; said protein CmFSI8 is as follows (1) or (2): (1) protein consisting of amino acid sequence shown in SEQ ID NO: 2 in the sequence listing; (2) co-expressed protein obtained by linking molecular tag to N terminal or / and C terminal of (1); a) changing fruit shape of plant; b) shortening leaf length of plant; c) reducing leaf aspect ratio of plant; d) reducing plant height of plant; e) reducing fruit length of plant; said plant is Arabidopsis thaliana.

2. Use according to claim 1, wherein: said nucleic acid molecule encoding protein CmFSI8 is DNA molecule of any one of 1) - 2): 1) DNA molecule consisting of nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing; 2) co-expressed nucleic acid molecule obtained by linking tag encoding gene to terminal of sequence shown in 1).

3. Use of the substance in claim 1 or 2 in breeding plant having at least one of the following phenotypes: changed fruit shape, shortened leaf length, reduced leaf aspect ratio, reduced plant height and / or reduced fruit length; said plant is Arabidopsis thaliana.

4. A method for preparing transgenic plant with changed fruit shape, which is as follows 1) or 2): 1) said method comprises the following steps: increasing content and / or activity of CmFSI8 protein in target plant, to obtain transgenic plant with changed fruit shape; 2) said method comprises the following steps: increasing expression of nucleic acid molecule encoding CmFSI8 protein in target plant, to obtain transgenic plant with changed fruit shape; said plant is Arabidopsis thaliana; said protein CmFSI8 is as follows (1) or (2): (1) protein consisting of amino acid sequence shown in SEQ ID NO: 2 in the sequence listing; (2) co-expressed protein obtained by linking molecular tag to N terminal or / and C terminal of (1); said transgenic plant with changed fruit shape has at least one of the following characteristics: 1) leaf length of said transgenic plant is shorter than that of said wild type plant; 2) leaf aspect ratio of said transgenic plant is smaller than that of said wild type plant; 3) plant height of said transgenic plant is smaller than that of said wild type plant; 4) fruit length of said transgenic plant is smaller than that of said wild type plant.

5. Method according to claim 4, wherein: said increasing content and / or activity of CmFSI8 protein in target plant, or, said increasing expression of nucleic acid molecule encoding CmFSI8 protein in target plant, is introducing said nucleic acid molecule encoding CmFSI8 protein into said target plant.

Citation Information

Patent Citations

  • Sesame capsule length regulation gene Siofp1 and application thereof

    CN117106796A