Engineered Bacteria Containing barstar Gene and Its Application in Cloning of barnase Gene

By inserting the expression elements of the barstar gene into the genome of the engineered bacteria, using CRISPR-Cas9 technology to neutralize Barnase toxicity, the problem of low success rate of barnase gene cloning was solved, and efficient and stable barnase gene cloning and plasmid construction was achieved.

CN115698271BActive Publication Date: 2025-07-18NANJING GENSCRIPT BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202180041549.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2020-06-12
Filing Date
2021-06-11
Publication Date
2025-07-18
Estimated Expiration
2041-06-11

AI Technical Summary

Technical Problem

The existing barnase gene cloning technology has a low success rate, which cannot meet downstream applications, lacks general intron sequences, and cannot achieve efficient cloning of barnase genes.

Method used

The expression elements of the barstar gene are inserted into the genome of the engineered bacteria through CRISPR-Cas9 technology, so that the Barstar expressed on the genome can neutralize the Barnase toxicity expressed on the plasmid, thereby achieving stable cloning of the barnase gene.

Benefits of technology

The efficient and stable cloning of the barnase gene is achieved, simplified the plasmid construction process, improved the success rate, and shortened the time and cost of gene synthesis and cloning.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115698271B_ABST
    Figure CN115698271B_ABST
Patent Text Reader

Abstract

An engineered bacterium containing the barstar gene and its application in cloning the barnase gene are provided. Among them, the chromosomal genome of the engineered bacterium contains the barstar gene, and the engineered bacterium can be used to clone the barnase gene. A method for cloning the barnase gene is also provided, including transforming a plasmid containing the barnase gene into the above-mentioned engineered bacterium for culture and amplification.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and particularly relates to an engineered bacterium containing the barstar gene, a method for constructing the same, and the application of the engineered bacterium in the cloning of ribonuclease barnase gene. Background Art

[0002] Barnase is a 12kD extracellular small molecule ribonuclease produced by Bacillus amyloliquefaciens. It can degrade RNA in cells and has strong toxicity. In the genome of Bacillus amyloliquefaciens, there is also a specific antagonist gene barstar of barnase. Its product (10kD) can specifically bind to Barnase in a ratio of 1:1 to form a highly stable complex, thereby making the Barnase expressed by bacteria lose its enzyme activity. [1] Taking advantage of the characteristic that its expression in specific cells will cause cell death, scientists used plant fertility or disease resistance-related promoters to regulate the activity of barnase in cells, thereby achieving male sterility and improved disease resistance in plants. Therefore, this gene has wide applications in agricultural production. [2] In addition, Barnase also has many other important biological functions, such as controlling tumor angiogenesis, killing tumor cells, and inhibiting the replication of viruses (including HIV virus), etc. [3] The above characteristics make barnase a common element in plasmid sequences and are applied in various experiments.

[0003] Common methods for cloning the barnase gene in Escherichia coli are as follows. One is direct cloning by PCR. Primers are designed according to the barnase coding region sequence, and the barnase sequence is directly amplified from the total DNA of Bacillus amyloliquefaciens and then cloned into a vector. [4,5] The disadvantage of this method is that due to the toxic effect of Barnase, the obtained gene always has mutations, and the probability of obtaining the correct sequence is extremely low. The second is protective cloning, in which the barnase gene is cloned under the protection of the barstar gene. Usually, barnase and barstar are cloned on the same plasmid vector. [6] The disadvantage of this method is that there is an extra barstar gene on the final plasmid, which affects subsequent downstream applications. The third is to insert an intron sequence into the barnase gene, so that the barnase expressed in Escherichia coli contains additional sequences and loses its toxicity, while its activity is restored after removing the intron sequence in eukaryotic cells. [7] The disadvantage of this method is that there is no intron sequence common to eukaryotic cells.

[0004] 1. Hartley, R.W., Barnase and barstar. Expression of its cloned inhibitor permits expression of a cloned ribonuclease. J Mol Biol, 1988. 202(4): p. 913-5.

[0005] 2. Mariani, C., et al., A chimaeric ribonuclease-inhibitor gene restores fertility to male sterile plants. Nature, 1992. 357(6377): p. 384-387.

[0006] 3. Leuchtenberger, S., et al., Conditional cell ablation by stringent tetracycline-dependent regulation of barnase in mammalian cells. Nucleic Acids Res, 2001. 29(16): p. E76.

[0007] 4. Paddon, C.J. and R.W. Hartley, Expression of Bacillus amyloliquefaciens extracellular ribonuclease (barnase) in Escherichia coli following an inactivating mutation. Gene, 1987. 53(1): p. 11-9.

[0008] 5. Liu Yule, et al., Cloning and sequence analysis of nuclease BN and SN genes. Microbiology China, 1992. 4: p. 200-203.

[0009] 6. Deyev, S., Waibel, R., Lebedenko, E. et al. Design of multivalent complexes using the barnase·barstar module. Nat Biotechnol 21, 1486–1492 (2003).

[0010] 7. Sun Lulu, Functional Reconstruction of Split Barnase Toxic Protein Mediated by Inteins. Master's Thesis of Southwest University. 2012. Summary of the Invention

[0011] Due to the disadvantages of the aforementioned barnase cloning technology, such as low success rate, inability to meet downstream applications, and lack of a common intron sequence, all scenarios of barnase gene cloning cannot be achieved. The present invention genetically modifies conventional engineering bacteria through CRISPR-Cas9 technology. An expression element of the barstar gene is inserted into the genome of the engineering bacteria, so that the Barstar expressed on the genome can neutralize the toxic effect of the Barnase expressed on the plasmid, thereby enabling the smooth completion of gene synthesis, plasmid construction, and plasmid extraction.

[0012] On the one hand, the present invention provides an engineering bacterium, characterized in that the chromosomal genome of the engineering bacterium contains the barstar gene, and the engineering bacterium can be used for cloning the barnase gene.

[0013] The barstar gene in the present invention contains the nucleotide sequence shown in SEQ ID NO: 1, or a sequence with at least 80% identity to the nucleotide sequence shown in SEQ ID NO: 1. In some embodiments, the barstar gene contains a sequence with at least 80%, at least 85%, at least 87%, at least 89%, at least 91%, at least 93%, at least 95%, at least 97%, or at least 99% identity to the nucleotide sequence shown in SEQ ID NO: 1. In some other embodiments, the barstar gene contains a sequence with at least 91% identity to the nucleotide sequence shown in SEQ ID NO: 1. In some embodiments, the barstar gene contains a sequence with at least 93% identity to the nucleotide sequence shown in SEQ ID NO: 1. In some other embodiments, the barstar gene contains a sequence with at least 95% identity to the nucleotide sequence shown in SEQ ID NO: 1. In some embodiments, the barstar gene contains a sequence with at least 97% identity to the nucleotide sequence shown in SEQ ID NO: 1. In some other embodiments, the barstar gene contains a sequence with at least 99% identity to the nucleotide sequence shown in SEQ ID NO: 1. In some embodiments, the barstar gene contains the nucleotide sequence shown in SEQ ID NO: 1. In a specific embodiment, the nucleotide sequence of the barstar gene is as shown in SEQ ID NO: 1.

[0014] In some embodiments, the barstar gene is derived from Bacillus amyloliquefaciens.

[0015] In some embodiments, the chromosomal genome of the engineered bacterium comprises an expression element containing the barstar gene. The barstar gene expression element comprises a promoter and a terminator. In some embodiments, the barstar gene expression element contains a constitutively expressed promoter. In some embodiments, the promoter contained in the barstar gene expression element is selected from one or more of the EM7, recA, trp, araBAD, TEF1, GAL1, GAL10, lac, psbA, T7 or tacP promoters; the terminator contained in the barstar gene expression element is selected from one or more of the MrrnB T1, T7Te, rrnBT1, rrnBT2, rrnB1 or rrnB2 terminators. Preferably, the promoter is the EM7 promoter, and the terminators are the MrrnB T1 terminator and the T7Te terminator.

[0016] In some embodiments, the barstar gene expression element contains the nucleotide sequence shown in SEQ ID NO:2, or a sequence having at least 80% identity with the nucleotide sequence shown in SEQ ID NO:2. In other embodiments, the barstar gene expression element contains a sequence having at least 80%, at least 85%, at least 87%, at least 89%, at least 91%, at least 93%, at least 95%, at least 97% or at least 99% identity with the nucleotide sequence shown in SEQ ID NO:2. In some embodiments, the barstar gene expression element contains a sequence having at least 91% identity with the nucleotide sequence shown in SEQ ID NO:2. In other embodiments, the barstar gene expression element contains a sequence having at least 93% identity with the nucleotide sequence shown in SEQ ID NO:2. In some embodiments, the barstar gene expression element contains a sequence having at least 95% identity with the nucleotide sequence shown in SEQ ID NO:2. In other embodiments, the barstar gene expression element contains a sequence having at least 97% identity with the nucleotide sequence shown in SEQ ID NO:2. In some embodiments, the barstar gene expression element contains a sequence having at least 99% identity with the nucleotide sequence shown in SEQ ID NO:2. In other embodiments, the barstar gene expression element contains the nucleotide sequence shown in SEQ ID NO:2. In a specific embodiment, the nucleotide sequence of the barstar gene expression element is as shown in SEQ ID NO:2.

[0017] In some embodiments, the engineered bacterium is selected from bacteria or fungi; preferably, the bacteria are selected from Escherichia coli or Bacillus subtilis, and the fungi are selected from yeasts; more preferably, the Escherichia coli are selected from TOP10F, JM108, DH5a, stbl3, JM109, DH10b, EPI300 or EPI400. In some embodiments, the engineered bacterium is Escherichia coli. In some other embodiments, the engineered bacterium is Bacillus subtilis. In some embodiments, the Escherichia coli engineered bacterium is selected from TOP10F, JM108, DH5a, stbl3, JM109, DH10b, EPI300 or EPI400. In some specific embodiments, the engineered bacterium is selected from TOP10F or JM108. In one embodiment, the engineered bacterium is TOP10F. In another embodiment, the engineered bacterium is JM108.

[0018] In some embodiments, the barstar gene is cloned downstream of the lacZ, recA, araD, dam, galE, galU, malA, ompT, tonA, rha or CyaA gene in the chromosome of the Escherichia coli engineered bacterium; preferably cloned downstream of the CyaA gene in the chromosome of the Escherichia coli engineered bacterium. In some embodiments, the barstar gene is cloned downstream of the CyaA gene in the chromosome of the Escherichia coli engineered bacterium.

[0019] In some embodiments, the barstar gene expression element is cloned downstream of the lacZ, recA, araD, dam, galE, galU, malA, ompT, tonA, rha or CyaA gene in the chromosome of the Escherichia coli engineered bacterium; preferably cloned downstream of the CyaA gene in the chromosome of the Escherichia coli engineered bacterium. In some other embodiments, the barstar gene expression element is cloned downstream of the CyaA gene in the chromosome of the Escherichia coli engineered bacterium.

[0020] On the other hand, the present invention provides a method for preparing an engineered bacterium, characterized in that the barstar gene is cloned into the chromosomal genome of the engineered bacterium by gene editing technology.

[0021] In the preparation method provided by the present invention, the barstar gene comprises the nucleotide sequence shown in SEQ ID NO: 1, or a sequence having at least 80% identity with the nucleotide sequence shown in SEQ ID NO: 1. In some embodiments, the barstar gene comprises a sequence having at least 80%, at least 85%, at least 87%, at least 89%, at least 91%, at least 93%, at least 95%, at least 97% or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 1. In some other embodiments, the barstar gene comprises a sequence having at least 91% identity with the nucleotide sequence shown in SEQ ID NO: 1. In some embodiments, the barstar gene comprises a sequence having at least 93% identity with the nucleotide sequence shown in SEQ ID NO: 1. In some other embodiments, the barstar gene comprises a sequence having at least 95% identity with the nucleotide sequence shown in SEQ ID NO: 1. In some embodiments, the barstar gene comprises a sequence having at least 97% identity with the nucleotide sequence shown in SEQ ID NO: 1. In some other embodiments, the barstar gene comprises a sequence having at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 1. In some embodiments, the barstar gene comprises the nucleotide sequence shown in SEQ ID NO: 1. In a specific embodiment, the nucleotide sequence of the barstar gene is as shown in SEQ ID NO: 1.

[0022] In some embodiments, the engineered bacterial chromosomal genome further includes an expression element containing the barstar gene cloned by gene editing technology, and the barstar gene expression element comprises a promoter and a terminator. In some embodiments, the promoter comprised in the barstar gene expression element is selected from one or more of the EM7, recA, trp, araBAD, TEF1, GAL1, GAL10, lac, psbA, T7 or tacP promoters; the terminator comprised in the barstar gene expression element is selected from one or more of the MrrnB T1, T7Te, rrnBT1, rrnBT2, rrnB1 or rrnB2 terminators. Preferably, the promoter is the EM7 promoter, and the terminators are the MrrnB T1 terminator and the T7Te terminator.

[0023] In some embodiments, the barstar gene expression element comprises the nucleotide sequence shown in SEQ ID NO:2, or a sequence having at least 80% identity with the nucleotide sequence shown in SEQ ID NO:2. In some other embodiments, the barstar gene expression element comprises a sequence having at least 80%, at least 85%, at least 87%, at least 89%, at least 91%, at least 93%, at least 95%, at least 97% or at least 99% identity with the nucleotide sequence shown in SEQ ID NO:2. In some embodiments, the barstar gene expression element comprises a sequence having at least 91% identity with the nucleotide sequence shown in SEQ ID NO:2. In some other embodiments, the barstar gene expression element comprises a sequence having at least 93% identity with the nucleotide sequence shown in SEQ ID NO:2. In some embodiments, the barstar gene expression element comprises a sequence having at least 95% identity with the nucleotide sequence shown in SEQ ID NO:2. In some other embodiments, the barstar gene expression element comprises a sequence having at least 97% identity with the nucleotide sequence shown in SEQ ID NO:2. In some embodiments, the barstar gene expression element comprises a sequence having at least 99% identity with the nucleotide sequence shown in SEQ ID NO:2. In some other embodiments, the barstar gene expression element comprises the nucleotide sequence shown in SEQ ID NO:2. In a specific embodiment, the nucleotide sequence of the barstar gene expression element is as shown in SEQ ID NO:2.

[0024] In the preparation method provided by the present invention, the gene editing technology is selected from CRISPR-Cas9 technology, zinc finger nuclease technology or transcription activator-like effector nuclease technology. Preferably, the gene editing technology is CRISPR-Cas9 technology.

[0025] In the preparation method provided by the present invention, the gene editing technology is CRISPR-Cas9 technology, and it comprises the following steps:

[0026] (1) Synthesize the left and right homologous arm sequences and the barstar gene expression element sequence, and insert the synthesized sequences into the pTarget plasmid containing the gRNA sequence, wherein the left and right homologous arm sequences are respectively a sequence on the left and right sides of the barstar gene cloned to the gene target sequence of the engineering bacteria;

[0027] (2) Co-transfect the plasmid obtained in step (1) and the pCas9 plasmid into the engineering bacteria cells, and culture and incubate;

[0028] (3) The engineered bacteria cultured in step (2) are subjected to resistance screening to obtain strains in which the barstar gene is integrated into the chromosomal genome of the engineered bacteria.

[0029] In the method of the present invention, the engineered bacteria are Escherichia coli or Bacillus subtilis; preferably, the engineered bacteria are selected from TOP10F, JM108, DH5a, stbl3, JM109, DH10b, EPI300 or EPI400; more preferably, the engineered bacteria are TOP10F or JM108. In some embodiments, the engineered bacteria are Escherichia coli. In other embodiments, the engineered bacteria are Bacillus subtilis. In some embodiments, the Escherichia coli engineered bacteria are selected from TOP10F, JM108, DH5a, stbl3, JM109, DH10b, EPI300 or EPI400. In some specific embodiments, the engineered bacteria are selected from TOP10F or JM108. In one embodiment, the engineered bacteria are TOP10F. In another embodiment, the engineered bacteria are JM108. In some embodiments, the barstar gene is cloned downstream of the lacZ, recA, araD, dam, galE, galU, malA, ompT, tonA, rha or CyaA gene in the chromosomal of the Escherichia coli engineered bacteria. In some embodiments, the barstar gene is cloned downstream of the CyaA gene in the chromosomal of the Escherichia coli engineered bacteria. In other embodiments, the barstar gene expression element is cloned downstream of the lacZ, recA, araD, dam, galE, galU, malA, ompT, tonA, rha or CyaA gene in the chromosomal of the Escherichia coli engineered bacteria. In other embodiments, the barstar gene expression element is cloned downstream of the CyaA gene in the chromosomal of the Escherichia coli engineered bacteria. In some embodiments, the gene target sequence to which the barstar gene is cloned into the Escherichia coli engineered bacteria is selected from the downstream sequences of the lacZ, recA, araD, dam, galE, galU, malA, ompT, tonA, rha or CyaA gene; preferably, the target sequence cloned into the gene of the Escherichia coli engineered bacteria is the downstream sequence of the CyaA gene.

[0030] In some embodiments, the gRNA in step (1) is designed according to the gene locus where the barstar gene is cloned into the engineered bacterium. Among them, the targeting sequence of the gRNA in step (1) (the barstar gene is cloned into the gene target sequence of the engineered bacterium) is a 1-200 bp sequence downstream of the stop codon of the CyaA gene on the genome of the Escherichia coli engineered bacterium. Preferably, the targeting sequence of the gRNA in step (1) is a 1-100 bp sequence downstream of the stop codon of the CyaA gene on the genome of the Escherichia coli engineered bacterium. More preferably, the targeting sequence of the gRNA in step (1) is a 1-50 bp sequence downstream of the stop codon of the CyaA gene on the genome of the Escherichia coli engineered bacterium. In some specific embodiments, the targeting sequence of the gRNA in step (1) is a 10-30 bp sequence downstream of the stop codon of the CyaA gene on the genome of the Escherichia coli engineered bacterium. Among them, the sequence adjacent to the 3' end of the targeting sequence of the gRNA is NGG. In some embodiments, the sequence length of the gRNA in step (1) is 10-30 bp, preferably, the sequence length of the gRNA is 20 bp. In some embodiments, the gRNA includes at least 1 sequence, preferably at least 2 sequences, more preferably 3 sequences. In some other embodiments, the gRNA contains a sequence with at least 80% identity to the nucleotide sequence shown in SEQ ID NO: 7, 8, or / and 9. In some embodiments, the gRNA contains a sequence with at least 80%, at least 85%, at least 87%, at least 89%, at least 91%, at least 93%, at least 95%, at least 97%, or at least 99% identity to the nucleotide sequence shown in SEQ ID NO: 7, 8, or / and 9. In a specific embodiment, the gRNA contains the nucleotide sequences shown in SEQ ID NO: 7, 8, and 9.

[0031] In some embodiments, the pTarget plasmid containing the gRNA sequence in step (1) is obtained by mutating and amplifying using the empty vector pTarget plasmid as a template. In some other embodiments, the left and right homologous arm sequences in step (1) are obtained by amplifying the 50-500 bp sequences on both sides of the target sequence of the engineered bacterium. In some embodiments, after the synthesized left and right homologous sequences are amplified and fused with the barstar gene expression element sequence, they are inserted into the pTarget plasmid containing the gRNA sequence. Specifically, step (1) includes: a. Mutating and amplifying using the empty vector pTarget plasmid as a template to obtain a pTarget plasmid containing the gRNA; b. Selecting 50-500 bp sequences on both sides of the target sequence of the gRNA for PCR amplification to obtain the left and right homologous arm sequences for homologous recombination; c. Fusing the homologous arm sequences and the barstar expression element sequence, and then inserting them into the pTarget-gRNA plasmid. After sequencing verification, a pTarget plasmid containing the gRNA and the barstar expression element sequence is obtained. More specifically, step (1) includes performing site-directed mutagenesis amplification using the empty vector pTarget plasmid as a template to obtain a pTarget plasmid containing the gRNA, and then selecting 500 bp sequences on both sides of the target sequence of the gRNA on the genome of the engineered bacterium for PCR amplification to obtain the left and right homologous arm sequences for homologous recombination; fusing the homologous arm sequences and the barstar expression element sequence by PCR, and inserting the obtained product into the pTarget-sgRNA plasmid through the EcoRI-HindIII restriction enzyme site. After sequencing verification, a pTarget plasmid containing the gRNA and the barstar expression element sequence is obtained.

[0032] In some embodiments, the plasmids obtained in step (1) and the pCas9 plasmid in step (2) each contain at least one resistance gene. In some specific embodiments, the resistance genes of the plasmid containing the gRNA and the pCas9 plasmid are respectively selected from the spectinomycin resistance gene, kanamycin resistance gene, chloramphenicol resistance gene or ampicillin resistance gene. In a specific embodiment, the plasmid containing the gRNA contains the spectinomycin resistance gene, and the pCas9 plasmid contains the kanamycin resistance gene.

[0033] In some embodiments, step (2) includes: at 30 °C, first electrotransform the pCas9 plasmid with the first resistance into the engineered bacteria, then screen the strain that has successfully transformed the pCas9 plasmid in the medium containing the first resistance, activate the strain overnight in the liquid medium containing the first resistance, then transfer it to the liquid medium containing the first resistance at a ratio of 1:100 - 1000 (V:V), after culturing for a period of time, add 1:1 - 100 (V:V) of 1 ml of arabinose to induce the cells to continue growing until the OD600 reaches 0.4 - 0.6, centrifuge the bacterial solution at 4 °C to precipitate, discard the supernatant, wash and resuspend the strain with 1% - 80% glycerol, then add the pTarget plasmid with the second resistance obtained in step (1) for electrotransformation, and add liquid medium for activation after electrotransformation; then culture the strain overnight in the medium containing the first resistance and the second resistance, and finally perform PCR bacterial inspection to screen out the positive strain with the barstar gene introduced into the genome. Wherein the first resistance and the second resistance are selected from the spectinomycin resistance gene, kanamycin resistance gene, chloramphenicol resistance gene or ampicillin resistance gene.

[0034] In some embodiments, step (2) includes: at 30 °C, first electrotransform the pCas9 plasmid with Kan resistance into the engineered bacteria, then screen the strain that has successfully transformed the pCas9 plasmid in the medium containing Kan, activate the strain overnight in the liquid medium containing Kan, then transfer it to the liquid medium containing Kan at a ratio of 1:200 - 800 (V:V), after culturing for a period of time, add 1:100 (V:V) of 1 ml of arabinose to induce the cells to continue growing until the OD600 reaches 0.4 - 0.6, centrifuge the bacterial solution at 4 °C to precipitate, discard the supernatant, wash and resuspend the strain with 10% glycerol, then add the pTarget plasmid with Spec resistance obtained in step (1) for electrotransformation, and add liquid medium for activation after electrotransformation; then culture the strain overnight in the medium containing Kan and Spec, and finally perform PCR bacterial inspection to screen out the positive strain with the barstar gene introduced into the genome.

[0035] In some embodiments, step (2) includes electrotransforming the pCas9 plasmid with Kan resistance into Escherichia coli at a temperature of 30°C. Subsequently, strains that have successfully received the pCas9 plasmid are screened in a medium containing Kan. The strains are activated overnight in a liquid medium containing Kan, then transferred to a liquid medium containing Kan at a ratio of 1:400 (V:V). After culturing for a period of time, 1 ml of arabinose at a ratio of 1:100 (V:V) is added to induce the cells to continue growing until the OD600 reaches 0.4 - 0.6. The bacterial solution is centrifuged and precipitated at 4°C, the supernatant is removed, the strain is washed with 10% glycerol and resuspended. Then, the pTarget plasmid with Spec resistance obtained in step (1) is added for electrotransformation, and after electrotransformation, a liquid medium is added for activation. The strain is then cultured overnight in a medium containing both Kan and Spec, and finally, PCR bacterial inspection is performed to screen for positive strains in which the barstar gene has been introduced into the genome.

[0036] In some embodiments, step (2) includes electrotransforming the pCas9 plasmid with Kan resistance into TOP10F or JM108 at a temperature of 30°C. Subsequently, strains that have successfully received the pCas9 plasmid are screened in a medium containing Kan. The strains are activated overnight in a liquid medium containing Kan, then transferred to a liquid medium containing Kan at a ratio of 1:400 (V:V). After culturing for a period of time, 600 1 ml of arabinose at a ratio of 1:100 (V:V) is added to induce the cells to continue growing until the OD reaches 0.4 - 0.6. The bacterial solution is centrifuged and precipitated at 4°C, the supernatant is removed, the strain is washed with 10% glycerol and resuspended. Then, the pTarget plasmid with Spec resistance obtained in step (1) is added for electrotransformation, and after electrotransformation, a liquid medium is added for activation. The strain is then cultured overnight in a medium containing both Kan and Spec, and finally, PCR bacterial inspection is performed to screen for positive strains in which the barstar gene has been introduced into the genome.

[0037] In some embodiments, the resistance screening in step (3) refers to screening for engineered strains in which the barstar gene has been integrated into the chromosomal genome through a double - resistance medium. In some embodiments, the resistance screening in step (3) is to screen for engineered strains in which the barstar gene has been integrated into the chromosomal genome through a medium containing one or both of the resistances of Kan or Spec.

[0038] In some embodiments, step (3) includes picking a single colony of the positive engineered bacteria obtained in step (2) and inoculating it into a medium containing a first resistance, adding 0.1 - 1 mM IPTG to induce the strain to express, then inoculating the strain into two kinds of media containing the first resistance and the second resistance respectively. After culturing at 30 °C, select the strain that cannot grow in the medium containing the second resistance but can grow normally in the medium containing the first resistance, which is the strain with the pTarget plasmid eliminated. Then inoculate the strain into a medium without resistance multiple times. After culturing at 37 °C, then inoculate the strain into two kinds of media containing the first resistance and the second resistance respectively. When the strain does not grow in both of these two media, the engineered strain with pCas9 and pTarget eliminated is obtained.

[0039] In some embodiments, step (3) includes picking a single colony of the positive engineered bacteria obtained in step (2) and inoculating it into a medium containing Kan, adding 0.1 - 0.8 mM IPTG to induce the strain to express, then inoculating the strain into two kinds of media containing Spec and Kan respectively. After culturing at 30 °C, select the strain that cannot grow in the medium containing Spec but can grow normally in the medium containing Kan, which is the strain with the pTarget plasmid eliminated. Then inoculate the strain into a liquid medium without resistance multiple times. After culturing at 37 °C, then inoculate the strain into two kinds of media containing Kan and Spec respectively. When the strain does not grow in both of these two media, the engineered strain with pCas9 and pTarget eliminated is obtained.

[0040] In some embodiments, step (3) includes picking a single colony of Escherichia coli obtained in step (2) and inoculating it into an LB medium containing Kan, adding 0.5 mM IPTG to induce the strain to express, then inoculating the bacterial solution into two kinds of LB media containing Spec and Kan respectively. After culturing at 30 °C, select the strain that cannot grow in the medium containing Spec but can grow normally in the medium containing Kan, which is the strain with the pTarget plasmid eliminated. Then inoculate the strain into an LB medium without resistance multiple times. After culturing at 37 °C, then inoculate the strain into two kinds of LB media containing Kan and Spec respectively. When the strain does not grow in both of these two media, the engineered strain with pCas9 and pTarget eliminated is obtained.

[0041] In some embodiments, step (3), preferably, includes picking single colonies of TOP10F or JM108 obtained in step (2), inoculating them into LB medium containing Kan, adding 0.5 mM IPTG to induce strain expression, then culturing the strains in two kinds of LB media containing Spec and containing Kan at 30 °C, and selecting the strains that cannot grow in the medium containing Spec but can grow normally in the medium containing Kan, which are the strains with the pTarget plasmid eliminated. Then inoculate the strains into LB liquid medium without resistance and culture them at 37 °C, and then inoculate the strains into two kinds of LB media containing Kan and containing Spec respectively. When the strains do not grow in both media, the engineered strains with pCas9 and pTarget eliminated are obtained.

[0042] On the other hand, the present invention provides a method for cloning the barnase gene, characterized in that the method includes transfecting a plasmid containing the barnase gene into the above-mentioned engineered bacteria for culturing and amplification.

[0043] The present invention also provides a method for cloning the barnase gene, characterized in that the method includes transforming a plasmid containing the barnase gene into the engineered bacteria prepared by the above method for culturing and amplification.

[0044] In the above method for cloning the barnase gene, it further includes screening the engineered bacteria transformed with the barnase gene through a double-resistant medium. In some embodiments, the engineered bacteria transformed with the barnase gene are obtained by screening through a Kan-resistant and / or Spe-resistant medium. Preferably, the engineered bacteria transformed with the barnase gene are obtained by screening through a Kan-resistant and Spe-resistant medium.

[0045] In some embodiments, the method further includes plasmid extraction from the amplified and cultured engineered bacteria.

[0046] In some other embodiments, the method further includes sequence verification of the extracted plasmid.

[0047] In some embodiments, the plasmid containing the barnase gene is selected from prokaryotic expression vectors pET, pGEX series, yeast vectors pRS, pESC series, plant vectors pCAMBIA series, eukaryotic expression vectors pcDNA3.1 series, pUC57, U9041-1 or U9041-12. In some preferred embodiments, the plasmid containing the barnase gene is pUC57, U9041-1 or U9041-12.

[0048] Term Explanation

[0049] In the present invention, the "engineered bacterium" can be any prokaryotic or eukaryotic microbial cell. Prokaryotic microbial cells can be bacteria, including but not limited to Escherichia coli and Bacillus subtilis. Eukaryotic microbial cells include but are not limited to yeast and Aspergillus. In some embodiments of the present invention, the engineered bacterium is Escherichia coli or Bacillus subtilis. Among them, Escherichia coli can be selected from TOP10F, JM108, DH5a, stbl3, JM109, DH10b, EPI300 or EPI400. In a specific embodiment of the present invention, the engineered bacterium is TOP10F or JM108.

[0050] The term "Donor sequence" or "donor sequence" refers to an artificially constructed sequence in homologous recombination, which contains homologous sequences of a certain length (such as 50 - 500 bp) upstream and downstream of the target site, so that the target site inserts or deletes a sequence through homologous recombination.

[0051] The "homologous arm sequence" in the present invention refers to a DNA fragment with the same sequence as the upstream and downstream of the target sequence, which is the region for recognizing the target sequence and undergoing homologous recombination, and generally has a length of 50 - 500 bp.

[0052] The term "vector" is used herein to refer to a nucleic acid molecule that can transfer or transport another nucleic acid molecule. The transferred nucleic acid is usually ligated to the vector nucleic acid molecule, for example, inserted into the vector nucleic acid molecule. The vector can include sequences that direct autonomous replication in a cell, or can include sequences sufficient to allow integration into the host cell DNA. Useful vectors include, for example, plasmids (such as DNA plasmids or RNA plasmids), transposons, cosmids, bacterial artificial chromosomes, and viral vectors.

[0053] The term "transfection" refers to the transfer of a polynucleotide or other bioactive compound from outside the cell to inside the cell such that the polynucleotide or bioactive compound is functional. Examples of transfection reagents for delivering polynucleotides to cells in vitro include but are not limited to: liposomes, lipids, polyamines, calcium phosphate precipitates, histones, polyaziridines, and amphoteric polyelectrolyte complexes and combinations thereof. Many in vitro transfection reagents are cationic, which allows the reagent to bind or form a complex with the negatively charged nucleic acid through electrostatic interaction.

[0054] "Co - transfection" refers to the transfer of two or more plasmids into the same competent cell. Commonly used transfection methods in the art, including electroporation, chemical transfection and other methods, can be used to simultaneously transfer two or more plasmids into the same competent cell. In the present invention, the electroporation method is preferably used to transfer two or more plasmids into the same competent cell.

[0055] The term "competent cell" refers to a cell that is induced by physical and chemical methods to absorb DNA molecules in the surrounding environment, making it in a physiological state that is most suitable for taking up and accommodating foreign DNA.

[0056] In the present invention, gRNA refers to a guide RNA of about 20 nt, which can bind to the DNA at the targeted editing site in the form of base complementarity, so that the Cas9 protein can stably bind to the targeted site and perform base cleavage.

[0057] The term "resistance screening" means that recipient bacteria without an antibiotic resistance gene cannot grow in a culture medium containing an antibiotic. Only after a vector carrying an antibiotic resistance gene enters the recipient bacteria can the recipient bacteria grow. In the present invention, the antibiotic resistance gene can be a conventional vector resistance gene in the art, such as a spectinomycin resistance gene, a kanamycin resistance gene, an ampicillin resistance gene, or a hygromycin resistance gene, etc. For example, after a plasmid carrying a kanamycin resistance gene is transfected into recipient bacteria such as Escherichia coli, the recipient bacteria that originally did not carry the kanamycin resistance gene and the recipient bacteria into which the kanamycin resistance gene has been transferred are cultured simultaneously on a culture medium containing kanamycin. Only the recipient bacteria containing the kanamycin resistance gene can grow and thus be screened out. "Double resistance screening" means that one or more vectors transfected into recipient bacteria contain two antibiotic resistance genes. Similarly, recipient bacteria transfected with vectors containing two antibiotic resistance genes can be screened out on a culture medium containing two antibiotics.

[0058] The term "CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)" or "clustered regularly interspaced short palindromic repeats" is a family of special DNA repeat sequences widely present in the genomes of bacteria and archaea. The gene sequence of the CRISPR-Cas system consists of three parts, including tracrRNA, Cas genes, and the CRISPR locus composed of repeat sequences and spacer sequences. Among them, the repeat sequence is about 21-48 bp in length and is a highly conserved sequence. The spacer sequence is about 26-72 bp in length and is generally considered to come from exogenous nucleic acids such as plasmids and phages, and is the main element for recognizing target genes; the Cas genes encode Cas proteins with nuclease functions, and tracrRNA plays a role in connecting the transcription product crRNA of the CRISPR locus and the Cas protein. During the operation of the CRISPR-Cas system, the spacer sequence is transcribed into crRNA, and crRNA forms a double-stranded secondary structure with tracrRNA, that is, sgRNA. The sgRNA forms a complex with the Cas protein. The sgRNA specifically recognizes the gene locus, and the Cas protein exerts nuclease activity for gene cleavage. Based on this principle, by designing different spacer sequences, gene editing operations such as gene knockout, insertion, modification, and repair can be performed on specific gene sites. Currently, three types of CRISPR-Cas systems have been discovered, namely type I, type II, and type III. Among them, the type I system contains the characteristic Cas3 protein, and the type III system contains the characteristic Cas10 protein. However, the CRISPR structures in these two systems are complex and both include multiple interacting Cas proteins. It is difficult to perform molecular biology operations at the present stage, which limits their application in gene editing. The type II system only contains one Cas9 protein, with simple molecular operations and a basically clear mechanism of action. Therefore, the type II CRISPR-Cas system is widely used. Some studies have shown that by using a mutant form of Cas9 (which only cleaves single-stranded DNA) and two adjacent guide RNAs, it is possible to significantly improve the fidelity of the cleavage site of the system. The main application in this invention is the CRISPR-Cas type II system, that is, the CRISPR-Cas9 technology.

[0059] The term "Zinc-finger nucleases (ZFNs)" refers to artificially engineered restriction enzymes, which are formed by fusing the DNA-binding domain of the zinc-finger structure and the DNA-cleaving domain. "Zinc-finger nuclease technology" can genetically engineer the zinc-finger domain to make zinc-finger nucleases target specific DNA sequences in complex genomes. With the help of the endogenous DNA repair mechanism, zinc-finger nucleases can precisely modify the genomes of higher animals. Each zinc-finger nuclease (ZFN) consists of two functional domains: a.) DNA-binding domain: composed of a tandem array of double-finger modules, each module recognizing a unique hexamer (6bp) DNA sequence. The double-finger modules are spliced together to form a zinc-finger protein, and each protein has a specificity of ≥24bp; b.) DNA-cleaving domain: composed of the nuclease domain of Fok I. When the DNA-binding domain and the DNA-cleaving domain are fused together, highly specific "genomic scissors" are produced.

[0060] The term "Transcription activator-like effector nucleases technology (TALENs)" refers to an enzyme that can target and modify specific DNA sequences. It uses TAL (transcription activator-like) effectors, a natural protein secreted by plant bacteria, to recognize specific DNA base pairs. TAL effectors can be designed to recognize and bind to all target DNA sequences. Attaching a nuclease to the TAL effector generates TALENs. TAL effector nucleases can bind to DNA and cleave the DNA strand at specific sites, thereby introducing new genetic material.

[0061] When referring to sequences, the term "Sequence Identity" (also known as "sequence homology") refers to the degree of identity between two sequences (such as a query sequence and a reference sequence), usually expressed as a percentage. Generally, before calculating the percentage identity between two sequences, sequence alignment is performed and gaps (if any) are introduced. If at a certain alignment position, the bases or amino acids in the two sequences are the same, the two sequences are considered identical or matched at that position; if the bases or amino acids in the two sequences are different, they are considered non-identical or mismatched at that position. In some algorithms, the number of matching positions is divided by the total number of positions in the alignment window to obtain the sequence identity. In other algorithms, the number of gaps and / or the length of the gaps are also taken into account. For the purposes of the present invention, the publicly available alignment software BLAST (available at the website ncbi.nlm.nih.gov) can be used to obtain the best sequence alignment and calculate the sequence identity between two sequences by using the default settings.

[0062] Beneficial technical effects

[0063] Genetically engineered bacteria, such as TOP10F (Barstar) and JM108 (Barstar), can be used for the cloning of plasmids related to the barnase gene, providing a rapid and stable solution for the synthesis of barnase-related genes and plasmid construction. The engineered bacteria constructed in the present invention can be directly used for the construction of plasmids related to the barnase gene without the aid of other auxiliary elements; and the cloning success rate is much higher than previous technical methods, greatly shortening the time and cost of gene synthesis and cloning. Description of the Drawings

[0064] Figure 1 For the design scheme of gRNA, gRNA-1, gRNA-2 and gRNA-3 respectively target the sequences ~50 bp downstream of the stop codon of the CyaA terminator on the Escherichia coli genome;

[0065] Figure 2 For the barstar expression element, it contains the EM7 promoter, the coding sequence of Barstar, rrnBT1 and T7Te terminator;

[0066] Figure 3 For the flow chart of the construction of the dual plasmid system, the synthesized Donor sequence is cloned into the pTarget plasmid to obtain the Donor plasmid, and then it forms a dual plasmid system with pCas9;

[0067] Figure 4 For the flow chart of the genome editing of Escherichia coli, the Donor plasmid and the pCas9 plasmid are co-transfected into Escherichia coli, the Donor sequence is integrated into the chromosomal DNA of Escherichia coli, and the pCas9 plasmid is eliminated by culture;

[0068] Figure 5 For the plate diagram of the plasmid transformation experiment containing the barnase gene, Figure 5 A is the plate diagram after the three plasmids containing barnase (pUC57-barnase, U9041-1, U9041-12) are respectively transformed into TOP10F and TOP10F (Barstar);

[0069] Figure 5 B is the plate diagram after the three plasmids containing barnase (pUC57-barnase, U9041-1, U9041-12) are respectively transformed into JM108 and JM108 (Barstar), where TOP10F and JM108 are used as transformation control groups;

[0070] Figure 6It is an electrophoresis diagram for the restriction enzyme digestion verification of the barnase plasmid. The correctly sequenced TOP10F Barstar#1 and #2, JM08 Barstar#1 and #2 were digested with HindIII and XbaI and then electrophoresed. Lanes 1, 4, 7, 10, 12, 15, 18, and 21 are 300 ng of the plasmid before digestion; Lanes 2, 5, 8, 11, 13, 16, 19, and 22 are 300 ng of the plasmid after digestion with (HindIII + XbaI); Lanes 3, 6, 9, 14, 17, and 20 are DNA Marker (M), and the corresponding band sizes are shown in the molecular weight marker on the right. Detailed implementation manners

[0071] The following specific examples illustrate the implementation manners of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific implementation manners. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0072] When the embodiments give a numerical range, it should be understood that unless otherwise specified in the present invention, any value at both ends of each numerical range and any value between the two ends can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field of the present invention. In addition to the specific methods, devices, and materials used in the embodiments, according to the knowledge of those skilled in the technical field of the present invention and the description of the present invention, any methods, devices, and materials similar or equivalent to the methods, devices, and materials described in the embodiments of the present invention can also be used to implement the present invention.

[0073] In the present invention, the Barstar gene was inserted into the genomes of TOP10F (Invitrogen, C303003) and JM108 (ATCC, 47107 TM ) Escherichia coli using CRISPR-Cas9 technology, realizing the plasmid cloning related to the Barnase gene in these two genetically modified Escherichia coli. The present invention is realized through the following technical route: First, the two Escherichia coli were genetically modified to insert the barstar expression element; then, the transformation effect of the plasmid containing the barnase gene was tested in the genetically modified Escherichia coli.

[0074] Example 1 Strain modification

[0075] 1 Plasmid construction

[0076] 1.1 Select 3 gRNA target sequences of 20 bp within 10 - 30 bp downstream of the stop codon of the CyaA gene in the Escherichia coli genome to be inserted. These 3 gRNAs target the sequence ~50 bp downstream of the CyaA terminator codon on the Escherichia coli genome, and the sequence adjacent to the 3' end of the target sequence is NGG, as Figure 1 shown. Use the empty vector pTarget plasmid (from Jiang et al., 2015, Applied and Environmental Microbiology) as a template for site-directed mutagenesis amplification to obtain the correct pTarget-sgRNA plasmid (which contains the Spectinomycin (Spec) resistance gene).

[0077] gRNA-1: GCCGGAAAGCGAGGCTTATC (SEQ ID NO:7)

[0078] gRNA-2: GCCGGATAAGCCTCGCTTTC (SEQ ID NO:8)

[0079] gRNA-3: TTTCCGCTAAGATTGCATGC (SEQ ID NO:9)

[0080] 1.2 Select sequences of approximately 500 bp on the left and right of the gRNA target sequence on the Escherichia coli genome for PCR amplification to obtain the left and right homologous arm sequences for homologous recombination; synthesize the barstar expression element sequence, including the EM7 promoter sequence, the coding sequence of barstar, and the MrrnB T1 and T7Te terminator sequences, see Figure 2 .

[0081] 1.3 Fuse the homologous arm sequences and the barstar expression element sequence by overlapping PCR, and insert the resulting full-length PCR product into the pTarget-sgRNA plasmid through the EcoRI-HindIII restriction sites. After Sanger sequencing verification, obtain the pTarget-sgRNA-donor plasmid containing the gRNA and donor (donor) sequence (i.e., homologous arm sequence + barstar expression element sequence).

[0082] 2 Preparation of pCas9 competent cells and co-transformation of plasmids

[0083] 1.1 Electrotransform the pCas plasmid (from Jiang et.al, 2015, Applied and Environmental Microbiology) into competent cells of TOP10F and JM108. Since pCas is a temperature-sensitive plasmid, the activation and culture temperatures during electrotransformation need to be set at 30 °C. Use the universal primers Cas9-F and Cas9-R to perform PCR bacterial inspection on the clones after plating, and preserve the bacteria after obtaining positive clones for the next step. The sequences of the universal primers are as follows:

[0084] Cas9-F: actagccagcatccgtttacga (SEQ ID NO:10)

[0085] Cas9-R: tgcgcaaagtattgtccatgcc (SEQ ID NO:11)

[0086] 2.2 Since the pCas plasmid contains the kanamycin (Kan) resistance gene, after separately streaking the positive clone strains (pCas in TOP10F and pCas in JM108) obtained in the previous step on kanamycin (Kanamycin, Kan) plates to obtain single colonies, pick single colonies and activate them overnight in LB liquid medium containing Kan.

[0087] 2.2 Transfer the bacteria cultured overnight to a new 15 ml centrifuge tube at a ratio of 1:400 (V:V). There is 4 ml (LB + Kan) culture medium in the tube, and place it on a shaker for culture (30 °C, 200 rpm).

[0088] 2.3 Culture for about 2 - 3 hours, and take it out when the cell concentration OD 600 is about 0.2. Add 1 mL of arabinose at a ratio of 1:100 (V:V) to induce the cells to continue growing until the cell concentration OD 600 is about 0.5. Pre-cool the single tube on ice to prepare for making competent cells (pre-cool the centrifuge in advance to 4 °C), transfer it to a 1.5 ml centrifuge tube, and centrifuge at 4000 rpm for 4 min to remove the supernatant.

[0089] 2.4 After washing three times with 10% glycerol, suspend it with 100 μL of 10% glycerol; add 200 ng of the pTarget-sgRNA-donor plasmid and mix well (operate on ice throughout the process).

[0090] 2.5 Adjust the BioRad electroporator (Bio-Rad Gene Pulser, 165-2660) to mode E2 (KV: 2.49V). Pre-cool the electroporation cuvette in advance. Slowly add the competent cells mixed with the product to avoid air bubbles. After electroporation, add LB liquid medium and activate at 30°C for 1 h.

[0091] 2.6 After activation, collect the bacterial cells and centrifuge at 4000 rpm for 4 min. Discard the supernatant and leave 100 μL to coat on a double-antibody plate containing kanamycin and spectinomycin (Spec). Place it in an incubator at 30°C and culture overnight.

[0092] 2.7 Design PCR primers for the target gene region to be knocked in, and perform PCR bacterial detection on the single colonies on the plate to screen for positive clones. The bacterial detection primers (F1+R2) are used to detect whether there is an insertion in the target gene region on the genome; the primers (F1+R1) are used to detect whether Barstar is inserted into the target region of the genome.

[0093] F1: ATTCTCGGCAAAATGCATCAGGACG (SEQ ID NO:12)

[0094] R1: TTATGAAGTCTGAAAAGTGAGGAAA (SEQ ID NO:13)

[0095] R2: TCTTCATCAACTACCTCCTAT (SEQ ID NO:14)

[0096] 2.8 Gel-extract the (F1+R1) PCR product of the screened positive clone and verify it by Sanger sequencing. Preserve the bacterial strain of the clone with correct sequencing for the next step.

[0097] 3 Plasmid elimination

[0098] 3.1 Streak the positive clone with correct sequencing on a double-antibody plate of Kan and Spec and culture overnight at 30°C.

[0099] 3.2 Pick a single colony and inoculate it into a 15 ml centrifuge tube containing 4 ml (LB+Kan), and add 4 μL of 0.5 mM IPTG for induction. Shake the bacteria overnight at 30°C.

[0100] 3.3 Streak the bacterial solution from the previous step on an (LB+Kan) plate and culture overnight at 30°C.

[0101] 3.4 Pick monoclonal colonies and shake the bacteria in (LB + Kan) liquid medium. Culture at 30 °C until it becomes turbid. Streak the bacterial solution on (LB + Kan) plates and (LB + Spec) plates respectively, and culture overnight at 30 °C. If no growth is observed on the (LB + Spec) plate while normal growth occurs on the (LB + Kan) plate, it indicates the successful elimination of the pTarget-sgRNA-donor plasmid.

[0102] 3.5 Inoculate the positive clones with the successfully eliminated pTarget-sgRNA-donor plasmid into antibiotic-free LB liquid medium and shake the bacteria at 37 °C, then streak on an antibiotic-free plate.

[0103] 3.6 Pick single colonies on the antibiotic-free plate, shake the bacteria in antibiotic-free LB liquid medium at 37 °C. Streak the obtained bacterial solution on (LB + Kan) and (LB + Spec) plates respectively, and no growth is observed after culturing at 30 °C, indicating the successful elimination of both the pTarget-sgRNA-donor plasmid and the pCas plasmid.

[0104] 3.7 Perform PCR amplification on the final positive clones using primers (F1 + R2). After recovering the PCR products, verify by Sanger sequencing. After correct sequencing, preserve the bacterial strains for the next experiment.

[0105] Example 2 Transformation Test of Plasmids Containing the barnase Gene

[0106] 1. For Escherichia coli cells of the transformed TOP10F(Barstar) and JM108(Barstar), prepare transformation-competent cells according to the steps 2.2 to 2.4 in Example 1.

[0107] 2. Two test plasmids (U9041-1 and U9041-12, containing the Kan resistance gene, and the full sequences are shown in SEQ ID NO:4 and 5) containing barnase (sequence information is shown in SEQ ID NO:3) and the control plasmid pUC57-barnase (sequence information is shown in SEQ ID NO:6) are respectively transformed into TOP10F and JM108, as well as the transformed TOP10F(Barstar) and JM108(Barstar) competent cells, and cultured overnight at 37 °C on (LB + Kan) plates.

[0108] 3. Observe the number of colonies grown on the transformed plates and take photos for record, as Figure 5As shown, the plasmid pUC57-barnase containing barnase, U9041-1, and U9041-12 were transformed into the Escherichia coli cells of the modified TOP10F(Barstar) and JM108(Barstar), and the Escherichia coli could grow normally to produce colonies; while after these 3 plasmids were transformed into the control group cells, no colonies were produced (U9041-1) or only a small number of colonies were produced (U9041-12). See the following table for the number of plate clone colonies of the three plasmids transfected into the modified Escherichia coli cells and the control group cells.

[0109] TOP10F TOP10F-barstar JM108 JM108-barstar pUC57-barnase No clone spots <![CDATA[>10 3 > No clone spots <![CDATA[>10 3 > U9041-1 No clone spots <![CDATA[>10 3 > No clone spots <![CDATA[~10 2 > U9041-12 <50 <![CDATA[>10 3 > No clone spots <![CDATA[>10 3 >

[0110] 4. Randomly pick 8 single colony clones on the plates of TOP10F(Barstar) and JM108(Barstar). After shaking the bacteria overnight, extract the plasmids using the Axygen kit (Corning, AP-MN-P-250), and then verify the plasmids by sequencing. The sequencing results show that the barnase gene is 100% correct.

[0111] 5. Select 1 plasmid each from TOP10F Barstar and JM08 Barstar with correct sequencing and perform restriction enzyme digestion verification with HindIII and XbaI. Theoretically, U9041-1 produces 3886bp and 1644bp bands; U9041-12 produces 3886bp and 801bp bands. Among them, the 3886bp band is the same vector sequence band after restriction enzyme digestion, and the 644bp and 801bp bands are the bands including the "Barnase+Halo-tag" and "Barnase" sequences respectively, as Figure 6 The results of the electrophoresis diagram after restriction enzyme digestion show that the restriction enzyme digestion is completely correct.

[0112] Sequence information:

[0113] SEQ ID NO.1: barstar gene

[0114]

[0115] SEQ ID NO.2: barstar expression element sequence

[0116]

[0117] The bold underlined part represents the barstar ORF sequence

[0118] SEQ ID NO.3: barnase gene

[0119]

[0120] SEQ ID NO.4: Complete sequence of plasmid U9041-1

[0121]

[0122]

[0123]

[0124] The bold and underlined part represents the barnase gene

[0125] SEQ ID NO.5: Complete sequence of plasmid U9041-12

[0126]

[0127]

[0128] The bold and underlined part represents the barnase gene

[0129] SEQ ID NO.6: Complete sequence of plasmid pUC57-barnase

[0130]

[0131]

[0132] The bold and underlined part represents the barnase gene SEQUENCE LISTING <110> Nanjing GenScript Biotech Co., Ltd. <120> Engineered bacteria containing barstar gene and its application in cloning of barnase gene <130> RS-C20202P1 <150> CN202010534573.8 <151> 2020-06-12 <160> 14 <170> PatentIn version 3.5 <210> 1 <211> 276 <212> DNA <213> Artificial Sequence <220> <223> barstar gene <400> 1 atgaagaaag cggtgatcaa cggcgagcaa atccgtagca ttagcgacct gcaccagacc 60 ctgaagaaag aactggcgct gccggagtac tatggtgaaa acctggacgc gctgtgggat 120 gcgctgaccg gttgggtgga gtacccgctg gttctggagt ggcgtcagtt cgaacaaagc 180 aagcagctga ccgagaacgg tgcggaaagc gtgctgcaag tttttcgtga ggcgaaagcg 240 gaaggcgcgg atattaccat cattctgagc taataa 276 <210> 2 <211> 505 <212> DNA <213> Artificial Sequence <220> <223> barstar expression element sequence <400> 2 gttgacaatt aatcatcggc atagtatatc ggcatagtat aatacgacaa ggtgaggaac 60 taaaccattt aataggaggt agttgatgaa gaaagcggtg atcaacggcg agcaaatccg 120 tagcattagc gacctgcacc agaccctgaa gaaagaactg gcgctgccgg agtactatgg 180 tgaaaacctg gacgcgctgt gggatgcgct gaccggttgg gtggagtacc cgctggttct 240 ggagtggcgt cagttcgaac aaagcaagca gctgaccgag aacggtgcgg aaagcgtgct 300 gcaagttttt cgtgaggcga aagcggaagg cgcggatatt accatcattc tgagctaata 360 ataaccaggc atcaaataaa acgaaaggct cagtcgaaag actgggcctt tcgttttatc 420 tgttgtttgt cggtgaacgc tctctactag agtcacactg gctcaccttc gggtgggcct 480 ttctgcgttt atactgtaca agtag 505 <210> 3 <211> 336 <212> DNA <213> Artificial Sequence <220> <223> barnase gene <400> 3 atggcacagg ttatcaacac gtttgacggg gttgcggatt atcttcagac atatcataag 60 ctacctgata attacattac aaaatcagaa gcacaagccc tcggctgggt ggcatcaaaa 120 gggaaccttg cagacgtcgc tccggggaaa agcatcggcg gagacatctt ctcaaacagg 180 gaaggcaaac tcccgggcaa aagcggacga acatggcgtg aagcggatat taactataca 240 tcaggcttca gaaattcaga ccggattctt tactcaagcg actggctgat ttacaaaaca 300 acggaccatt atcagacctt tacaaaaatc agataa 336 <210> 4 <211> 5530 <212> DNA <213> Artificial Sequence <220> <223> Complete sequence of plasmid U9041-1 <400> 4 ggcatgcaag ctgatttggc tgctgccacc gctgagcaag gccgcttcga gcagacatga 60 taagatacat tgatgagttt ggacaaacca caactagaat gcagtgaaaa aaatgcttta 120 tttgtgaaat ttgtgatgct attgctttat ttgtaaccat tataagctgc aataaacaag 180 ttaacaacaa caattgcatt cattttatgt ttcaggttca gggggagatg tgggaggttt 240 ttttaagcaa gtaaaacctc tacaaatgtg gtaaaatctt aattaagaat tctaatataa 300 cttcgtatag catacattat acgaagttat ggatccactg ttgacaatta atcatcggca 360 tagtatatcg gcatagtata atacgacaag gtgaggaact aaacccagga ggcagatcat 420 gattgaacaa gatggattgc acgcaggttc tccggccgct tgggtggaga ggctattcgg 480 ctatgactgg gcacaacaga caatcggctg ctctgatgcc gccgtgttcc ggctgtcagc 540 gcaggggcgc ccggttcttt ttgtcaagac cgacctgtcc ggtgccctga atgaactgca 600 ggacgaggca gcgcggctat cgtggctggc cacgacgggc gttccttgcg cagctgtgct 660 cgacgttgtc actgaagcgg gaagggactg gctgctattg ggcgaagtgc cggggcagga 720 cgacgttgtc actgaagcgg gaagggactg gctgctattg ggcgaagtgc cggggcagga 720 tctcctgtca tctcaccttg ctcctgccga gaaagtatcc atcatggctg atgcaatgcg 780 tctcctgtca tctcaccttg ctcctgccga gaaagtatcc atcatggctg atgcaatgcg 780 gcggctgcat acgcttgatc cggctacctg cccattcgac caccaagcga aacatcgcat 840 gcggctgcat acgcttgatc cggctacctg cccattcgac caccaagcga aacatcgcat 840 cgagcgagca cgtactcgga tggaagccgg tcttgtcgat caggatgatc tggacgaaga 900 cgagcgagca cgtactcgga tggaagccgg tcttgtcgat caggatgatc tggacgaaga 900 gcatcagggg ctcgcgccag ccgaactgtt cgccaggctc aaggcgcgca tgcccgacgg 960 gcatcagggg ctcgcgccag ccgaactgtt cgccaggctc aaggcgcgca tgcccgacgg 960 cgaggatctc gtcgtgaccc atggcgatgc ctgcttgccg aatatcatgg tggaaaatgg 1020 cgaggatctc gtcgtgaccc atggcgatgc ctgcttgccg aatatcatgg tggaaaatgg 1020 ccgcttttct ggattcatcg actgtggccg gctgggtgtg gcggaccgct atcaggacat 1080 ccgcttttct ggattcatcg actgtggccg gctgggtgtg gcggaccgct atcaggacat 1080 agcgttggct acccgtgata ttgctgaaga gcttggcggc gaatgggctg accgcttcct 1140 agcgttggct acccgtgata ttgctgaaga gcttggcggc gaatgggctg accgcttcct 1140 cgtgctttac ggtatcgccg ctcccgattc gcagcgcatc gccttctatc gccttcttga 1200 cgtgctttac ggtatcgccg ctcccgattc gcagcgcatc gccttctatc gccttcttga 1200 cgagttcttc tgattcgaaa tgaccgacca agcgacgccc aaccggtatc agctcactca 1260 cgagttcttc tgattcgaaa tgaccgacca agcgacgccc aaccggtatc agctcactca 1260 aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca 1320 aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca 1320 aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg 1380 aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg 1380 ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg 1440 acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt 1500 ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt 1560 tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc 1620 tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt 1680 gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt 1740 agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc 1800 tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa 1860 agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt 1920 tgcaagcagc agattacgcg cagaaaaaaa ggatttcaag aagatccttt gatcttttct 1980 acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta 2040 tcaaaaagga tcttcaccta gatcctttta tagtccggaa tcgtcacaca aaaaaccaac 2100 acacagatgt aatgaaaata aagatatttt attgcggcca tcgtgatggc tagagtttag 2160 ccctcccaca cataaccaga gggcagcaat tcacgaatcc caactgccgt cggctgtcca 2220 tcactgtcct tcactatggc tttgatccca ggatgcagat cgagaagcac ctgtcggcac 2280 cgtccgcagg ggctcaagat gcccctgttc tcatttccga tcgcgacgat acaagtcagg 2340 ttgccagctg ccgcagcagc agcagtgccc agcaccacga gttctgcaca aggtccccca 2400 gtaaaatgat atacattgac accagtgaag atgcggccgt cgctagagag agctgcgctg 2460 gcgacgctgt agtcttcaga gatggggatg ctgttgattg tagccgttgc tctttcaatg 2520 agggtggatt cttcttgaga caaaggcttg gccatggtgg cgctagtgtc agaagaatcg 2580 agctttttgc aaaagcctag gcctccaaaa aagcctcctc actacttctg gaatagctca 2640 gaggccgagg cggcctcggc ctctgcataa ataaaaaaaa ttagtcagcc atggggcgga 2700 gaatgggcgg aactgggcgg agttaggggc gggatgggcg gagttagggg cgggactatg 2760 gttgctgact aattgagatg catgctttgc atacttctgc ctgctgggga gcctggggac 2820 tttccacacc tggttgctga ctaattgaga tgcatgcttt gcatacttct gcctgctggg 2880 gagcctgggg actttccaca ccctaactga cacacattcc acagctggtt ctttccgcct 2940 cagaaggtac ctaaccaagt tcctctttca gaggttattt caggccatgg tgctgcgcaa 3000 gacgcgttaa ttaagacgtc ggcagtgaaa aaaatgcttt atttgtgaaa tttgtgatgc 3060 tattgcttta tttgtaacca ttataagctg caataaacaa gttaacaaca acaattgcat 3120 tcattttatg tttcaggttc agggggaggt gtgggaggtt ttttaaagca agtaaaacct 3180 ctacaaatgt ggtatggctg attatgatcc gcggccgcaa tacgtcgacg ttatcagctg 3240 acttcgtacg agagcctagg attatggcgc gccactagtt attaatagta atcaattacg 3300 gggtcattag ttcatagccc atatatggag ttccgcgtta cataacttac ggtaaatggc 3360 ccgcctggct gaccgcccaa cgacccccgc ccattgacgt caataatgac gtatgttccc 3420 atagtaacgc caatagggac tttccattga cgtcaatggg tggagtattt acggtaaact 3480 gcccacttgg cagtacatca agtgtatcat atgccaagtc cgccccctat tgacgtcaat 3540 gacggtaaat ggcccgcctg gcattatgcc cagtacatga ccttacggga ctttcctact 3600 tggcagtaca tctacgtatt agtcatcgct attaccatgg tgatgcggtt ttggcagtac 3660 accaatgggc gtggatagcg gtttgactca cggggatttc caagtctcca ccccattgac 3720 gtcaatggga gtttgttttg gcaccaaaat caacgggact ttccaaaatg tcgtaataac 3780 cccgccccgt tgacgcaaat gggcggtagg cgtgtacggt gggaggtcta tataagcaga 3840 gctggtttag tgaaccgtca gatcactaga agctttattg cggtagttta tcacagttaa 3900 attgctaacg cagtcagtgc ttctgacaca acagtctcga acttaagctg cagaagttgg 3960 tcgtgaggca ctgggcaggt aagtatcaag gttacaagac aggtttaagg agaccaatag 4020 aaactgggct tgtcgagaca gagaagactc ttgcgtttct gataggcacc tattggtctt 4080 actgacatcc actttgcctt tctctccaca ggtgtccact cccagttcaa ttacagctct 4140 taaggctaga gtattaatac gactcactat agggctagcg atcgccatgg aataagtaag 4200 gaatccacat ggcacaggtt atcaacacgt ttgacggggt tgcggattat cttcagacat 4260 atcataagct acctgataat tacattacaa aatcagaagc acaagccctc ggctgggtgg 4320 catcaaaagg gaaccttgca gacgtcgctc cggggaaaag catcggcgga gacatcttct 4380 caaacaggga aggcaaactc ccgggcaaaa gcggacgaac atggcgtgaa gcggatatta 4440 actatacatc aggcttcaga aattcagacc ggattcttta ctcaagcgac tggctgattt 4500 acaaaacaac ggaccattat cagaccttta caaaaatcag ataatgttta atgaccccgt 4560 gtcgagctct cgagccaacc actgaggatc tgtactttca gagcgataac gatggatccg 4620 aaatcggtac tggctttcca ttcgaccccc attatgtgga agtcctgggc gagcgcatgc 4680 actacgtcga tgttggtccg cgcgatggca cccctgtgct gttcctgcac ggtaacccga 4740 cctcctccta cgtgtggcgc aacatcatcc cgcatgttgc accgacccat cgctgcattg 4800 ctccagacct gatcggtatg ggcaaatccg acaaaccaga cctgggttat ttcttcgacg 4860 accacgtccg cttcatggat gccttcatcg aagccctggg tctggaagag gtcgtcctgg 4920 tcattcacga ctggggctcc gctctgggtt tccactgggc caagcgcaat ccagagcgcg 4980 tcaaaggtat tgcatttatg gagttcatcc gccctatccc gacctgggac gaatggccag 5040 aatttgcccg cgagaccttc caggccttcc gcaccaccga cgtcggccgc aagctgatca 5100 tcgatcagaa cgtttttatc gagggtacgc tgccgatggg tgtcgtccgc ccgctgactg 5160 aagtcgagat ggaccattac cgcgagccgt tcctgaatcc tgttgaccgc gagccactgt 5220 ggcgcttccc aaacgagctg ccaatcgccg gtgagccagc gaacatcgtc gcgctggtcg 5280 aagaatacat ggactggctg caccagtccc ctgtcccgaa gctgctgttc tggggcaccc 5340 caggcgttct gatcccaccg gccgaagccg ctcgcctggc caaaagcctg cctaactgca 5400 aggctgtgga catcggcccg ggtctgaatc tgctgcaaga agacaacccg gacctgatcg 5460 gcagcgagat cgcgcgctgg ctgtctactc tggagatttc cggttaatag aattctagag 5520 tcgacctgca 5530 <210> 5 <211> 4687 <212> DNA <213> Artificial Sequence <220> <223> Complete sequence of plasmid U9041-12 <400> 5 aagacgcgtt aattaagacg tcggcagtga aaaaaatgct ttatttgtga aatttgtgat 60 gctattgctt tatttgtaac cattataagc tgcaataaac aagttaacaa caacaattgc 120 attcatttta tgtttcaggt tcagggggag gtgtgggagg ttttttaaag caagtaaaac 180 ctctacaaat gtggtatggc tgattatgat ccgcggccgc aatacgtcga cgttatcagc 240 tgacttcgta cgagagccta ggattatggc gcgccactag ttattaatag taatcaatta 300 cggggtcatt agttcatagc ccatatatgg agttccgcgt tacataactt acggtaaatg 360 gcccgcctgg ctgaccgccc aacgaccccc gcccattgac gtcaataatg acgtatgttc 420 ccatagtaac gccaataggg actttccatt gacgtcaatg ggtggagtat ttacggtaaa 480 ctgcccactt ggcagtacat caagtgtatc atatgccaag tccgccccct attgacgtca 540 atgacggtaa atggcccgcc tggcattatg cccagtacat gaccttacgg gactttccta 600 cttggcagta catctacgta ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt 660 acaccaatgg gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg 720 acgtcaatgg gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaata 780 accccgcccc gttgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca 840 gagctggttt agtgaaccgt cagatcacta gaagctttat tgcggtagtt tatcacagtt 900 aaattgctaa cgcagtcagt gcttctgaca caacagtctc gaacttaagc tgcagaagtt 960 ggtcgtgagg cactgggcag gtaagtatca aggttacaag acaggtttaa ggagaccaat 1020 agaaactggg cttgtcgaga cagagaagac tcttgcgttt ctgataggca cctattggtc 1080 ttactgacat ccactttgcc tttctctcca caggtgtcca ctcccagttc aattacagct 1140 cttaaggcta gagtattaat acgactcact atagggctag cgctcaccat ggtgaccggc 1200 taccggctgt tcgaggagat tctcgggagc tccggtggtg gcgggagcgg aggtggaggc 1260 tcgagcggtg cgatcgccat ggaataagta aggaatccac atggcacagg ttatcaacac 1320 gtttgacggg gttgcggatt atcttcagac atatcataag ctacctgata attacattac 1380 aaaatcagaa gcacaagccc tcggctgggt ggcatcaaaa gggaaccttg cagacgtcgc 1440 tccggggaaa agcatcggcg gagacatctt ctcaaacagg gaaggcaaac tcccgggcaa 1500 aagcggacga acatggcgtg aagcggatat taactataca tcaggcttca gaaattcaga 1560 ccggattctt tactcaagcg actggctgat ttacaaaaca acggaccatt atcagacctt 1620 tacaaaaatc agataatgtt taaacgaatt cgggctcggt acccggggat cctctagagt 1680 cgacctgcag gcatgcaagc tgatttggct gctgccaccg ctgagcaagg ccgcttcgag 1740 cagacatgat aagatacatt gatgagtttg gacaaaccac aactagaatg cagtgaaaaa 1800 aatgctttat ttgtgaaatt tgtgatgcta ttgctttatt tgtaaccatt ataagctgca 1860 ataaacaagt taacaacaac aattgcattc attttatgtt tcaggttcag ggggagatgt 1920 gggaggtttt tttaagcaag taaaacctct acaaatgtgg taaaatctta attaagaatt 1980 ctaatataac ttcgtatagc atacattata cgaagttatg gatccactgt tgacaattaa 2040 tcatcggcat agtatatcgg catagtataa tacgacaagg tgaggaacta aacccaggag 2100 gcagatcatg attgaacaag atggattgca cgcaggttct ccggccgctt gggtggagag 2160 gctattcggc tatgactggg cacaacagac aatcggctgc tctgatgccg ccgtgttccg 2220 gctgtcagcg caggggcgcc cggttctttt tgtcaagacc gacctgtccg gtgccctgaa 2280 tgaactgcag gacgaggcag cgcggctatc gtggctggcc acgacgggcg ttccttgcgc 2340 agctgtgctc gacgttgtca ctgaagcggg aagggactgg ctgctattgg gcgaagtgcc 2400 ggggcaggat ctcctgtcat ctcaccttgc tcctgccgag aaagtatcca tcatggctga 2460 tgcaatgcgg cggctgcata cgcttgatcc ggctacctgc ccattcgacc accaagcgaa 2520 acatcgcatc gagcgagcac gtactcggat ggaagccggt cttgtcgatc aggatgatct 2580 ggacgaagag catcaggggc tcgcgccagc cgaactgttc gccaggctca aggcgcgcat 2640 gcccgacggc gaggatctcg tcgtgaccca tggcgatgcc tgcttgccga atatcatggt 2700 ggaaaatggc cgcttttctg gattcatcga ctgtggccgg ctgggtgtgg cggaccgcta 2760 tcaggacata gcgttggcta cccgtgatat tgctgaagag cttggcggcg aatgggctga 2820 ccgcttcctc gtgctttacg gtatcgccgc tcccgattcg cagcgcatcg ccttctatcg 2880 ccttcttgac gagttcttct gattcgaaat gaccgaccaa gcgacgccca accggtatca 2940 gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac 3000 atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt 3060 ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg 3120 cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc 3180 tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc 3240 gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc 3300 aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac 3360 tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt 3420 aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct 3480 aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc 3540 ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt 3600 ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatttcaaga agatcctttg 3660 atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc 3720 atgagattat caaaaaggat cttcacctag atccttttat agtccggaat cgtcacacaa 3780 aaaaccaaca cacagatgta atgaaaataa agatatttta ttgcggccat cgtgatggct 3840 agagtttagc cctcccacac ataaccagag ggcagcaatt cacgaatccc aactgccgtc 3900 ggctgtccat cactgtcctt cactatggct ttgatcccag gatgcagatc gagaagcacc 3960 tgtcggcacc gtccgcaggg gctcaagatg cccctgttct catttccgat cgcgacgata 4020 caagtcaggt tgccagctgc cgcagcagca gcagtgccca gcaccacgag ttctgcacaa 4080 ggtcccccag taaaatgata tacattgaca ccagtgaaga tgcggccgtc gctagagaga 4140 gctgcgctgg cgacgctgta gtcttcagag atggggatgc tgttgattgt agccgttgct 4200 ctttcaatga gggtggattc ttcttgagac aaaggcttgg ccatggtggc gctagtgtca 4260 gaagaatcga gctttttgca aaagcctagg cctccaaaaa agcctcctca ctacttctgg 4320 aatagctcag aggccgaggc ggcctcggcc tctgcataaa taaaaaaaat tagtcagcca 4380 tggggcggag aatgggcgga actgggcgga gttaggggcg ggatgggcgg agttaggggc 4440 gggactatgg ttgctgacta attgagatgc atgctttgca tacttctgcc tgctggggag 4500 cctggggact ttccacacct ggttgctgac taattgagat gcatgctttg catacttctg 4560 cctgctgggg agcctgggga ctttccacac cctaactgac acacattcca cagctggttc 4620 tttccgcctc agaaggtacc taaccaagtt cctctttcag aggttatttc aggccatggt 4680 gctgcgc 4687 <210> 6 <211> 2961 <212> DNA <213> Artificial Sequence <220> <223> pUC57-barnase plasmid full sequence <400> 6 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240 attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300 tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360 tttcccagtc acgacgttgt aaaacgacgg ccagagaatt cgagctcggt acctcgcgaa 420 tacatctaga tatcgcgatc gccatggaat aagtaaggaa tccacatggc acaggttatc 480 aacacgtttg acggggttgc ggattatctt cagacatatc ataagctacc tgataattac 540 attacaaaat cagaagcaca agccctcggc tgggtggcat caaaagggaa ccttgcagac 600 gtcgctccgg ggaaaagcat cggcggagac atcttctcaa acagggaagg caaactcccg 660 ggcaaaagcg gacgaacatg gcgtgaagcg gatattaact atacatcagg cttcagaaat 720 tcagaccgga ttctttactc aagcgactgg ctgatttaca aaacaacgga ccattatcag 780 acctttacaa aaatcagata atgtttaaac gatatcggat cccgggcccg tcgactgcag 840 aggcctgcat gcaagcttgg tgtaatcatg gtcatagctg tttcctgtgt gaaattgtta 900 tccgctcaca attccacaca acatacgagc cggaagcata aagtgtaaag cctggggtgc 960 ctaatgagtg agctaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg 1020 aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg 1080 tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg 1140 gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa 1200 cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc 1260 gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc 1320 aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag 1380 ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct 1440 cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta 1500 ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc 1560 cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc 1620 agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt 1680 gaagtggtgg cctaactacg gctacactag aagaacagta tttggtatct gcgctctgct 1740 gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc 1800 tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca 1860 agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta 1920 agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa 1980 atgaagtttt aaatcaagcc caatctgaat aatgttacaa ccaattaacc aattctgatt 2040 agaaaaactc atcgagcatc aaatgaaact gcaatttatt catatcagga ttatcaatac 2100 catatttttg aaaaagccgt ttctgtaatg aaggagaaaa ctcaccgagg cagttccata 2160 ggatggcaag atcctggtat cggtctgcga ttccgactcg tccaacatca atacaaccta 2220 ttaatttccc ctcgtcaaaa ataaggttat caagtgagaa atcaccatga gtgacgactg 2280 aatccggtga gaatggcaaa agtttatgca tttctttcca gacttgttca acaggccagc 2340 cattacgctc gtcatcaaaa tcactcgcat caaccaaacc gttattcatt cgtgattgcg 2400 cctgagcgag acgaaatacg cgatcgctgt taaaaggaca attacaaaca ggaatcgaat 2460 gcaaccggcg caggaacact gccagcgcat caacaatatt ttcacctgaa tcaggatatt 2520 cttctaatac ctggaatgct gtttttccgg ggatcgcagt ggtgagtaac catgcatcat 2580 caggagtacg gataaaatgc ttgatggtcg gaagaggcat aaattccgtc agccagttta 2640 gtctgaccat ctcatctgta acatcattgg caacgctacc tttgccatgt ttcagaaaca 2700 actctggcgc atcgggcttc ccatacaagc gatagattgt cgcacctgat tgcccgacat 2760 tatcgcgagc ccatttatac ccatataaat cagcatccat gttggaattt aatcgcggcc 2820 tcgacgtttc ccgttgaata tggctcataa caccccttgt attactgttt atgtaagcag 2880 acagttttat tgttcatgat gatatatttt tatcttgtgc aatgtaacat cagagatttt 2940 gagacacggg ccagagctgc a 2961 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gRNA-1 <400> 7 gccggaaagc gaggcttatc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gRNA-2 <400> 8 gccggataag cctcgctttc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gRNA-3 <400> 9 tttccgctaa gattgcatgc 20 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer Cas9-F <400> 10 actagccagc atccgtttac ga 22 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer Cas9-R <400> 11 tgcgcaaagt attgtccatg cc 22 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer F1 <400> 12 attctcggca aaatgcatca ggacg 25 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer R1 <400> 13 ttatgaagtc tgaaaagtga ggaaa 25 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer R2 <400> 14 tcttcatcaa ctacctccta t 21

Claims

1. An engineered bacterium, characterized in that, The chromosomal genome of the engineered bacterium contains the barstar gene, and the engineered bacterium can be used to clone the barnase gene. The barstar gene has the nucleotide sequence shown in SEQ ID NO:

1.

2. The engineered bacterium according to claim 1, wherein The chromosomal genome of the engineered bacterium includes an expression element containing the barstar gene.

3. The engineered bacterium according to claim 2, wherein the expression element containing the barstar gene includes a promoter and a terminator.

4. The engineered bacterium according to claim 3, wherein the promoter is selected from one or more of the EM7, recA, trp, araBAD, TEF1, GAL1, GAL10, lac, psbA, T7 or tacP promoters; and the terminator sequence is selected from one or more of the MrrnB T1, T7Te, rrnBT1, rrnBT2, rrnB1 or rrnB2 terminators.

5. The engineered bacterium according to claim 3, wherein the expression element containing the barstar gene has the nucleotide sequence shown in SEQ ID NO:

2.

6. The engineered bacterium according to any one of claims 1-5, characterized in that, The engineered bacterium is selected from Escherichia coli, Bacillus subtilis or yeast.

7. The engineered bacterium according to claim 6, wherein, The Escherichia coli is selected from TOP10F, JM108, DH5a, stbl3, JM109, DH10b, EPI300 or EPI400.

8. The engineered bacterium according to any one of claims 1-5, wherein the barstar gene is cloned downstream of the lacZ, recA, araD, dam, galE, galU, malA, ompT, tonA, rha or CyaA gene in the chromosomal DNA of the Escherichia coli engineered bacterium.

9. The engineered bacterium according to claim 8, wherein, The barstar gene is cloned downstream of the CyaA gene in the chromosomal DNA of the Escherichia coli engineered bacterium.

10. A method for preparing the engineering bacterium according to any one of claims 1-9, characterized in that, The barstar gene is cloned into the chromosomal genome of the engineered bacterium by gene editing technology, and the gene editing technology is selected from CRISPR-Cas9 technology, zinc finger nuclease technology or transcription activator-like effector nuclease technology.

11. According to the method described in claim 10, wherein, The gene editing technology is CRISPR-Cas9 technology, and includes the following steps: (1) Synthesize the left and right homologous arm sequences and the expression element sequence containing the barstar gene, and insert the synthesized sequences into the pTarget plasmid containing the gRNA sequence. Among them, the left and right homologous arm sequences are each a sequence on the left and right sides of the barstar gene cloned to the gene target sequence of the engineered bacterium. (2) The plasmid obtained in step (1) and the pCas9 plasmid are co-transfected into the engineered bacterium cells and cultured and incubated. (3) The engineered bacterium cultured in step (2) is screened by resistance to obtain a strain in which the barstar gene is integrated into the chromosomal genome.

12. The method according to claim 10, wherein, The engineered bacterium is Escherichia coli, and the Escherichia coli is selected from TOP10F, JM108, DH5a, stbl3, JM109, DH10b, EPI300 or EPI400.

13. The method according to claim 11, wherein, The engineered bacterium is Escherichia coli, and the Escherichia coli is selected from TOP10F, JM108, DH5a, stbl3, JM109, DH10b, EPI300 or EPI400.

14. According to the method described in claim 12, the gene target sequence to which the barstar gene is cloned into the Escherichia coli engineered bacterium is selected from the downstream sequences of the lacZ, recA, araD, dam, galE, galU, malA, ompT, tonA, rha or CyaA genes.

15. According to the method described in claim 13, the gene target sequence to which the barstar gene is cloned into the Escherichia coli engineered bacterium is selected from the downstream sequences of the lacZ, recA, araD, dam, galE, galU, malA, ompT, tonA, rha or CyaA genes.

16. According to the method described in claim 14, the gene target sequence to which the barstar gene is cloned into the Escherichia coli engineered bacterium gene is the downstream sequence of the CyaA gene.

17. According to the method described in claim 15, the gene target sequence to which the barstar gene is cloned into the Escherichia coli engineered bacterium gene is the downstream sequence of the CyaA gene.

18. According to the method described in claim 11 or 15, the gRNA in step (1) is designed according to the gene locus where the barstar gene is cloned into the engineered bacterium.

19. According to the method described in claim 11 or 15, the pTarget plasmid containing the gRNA sequence in step (1) is obtained by mutating and amplifying using the empty vector pTarget plasmid as a template.

20. According to the method described in claim 11 or 15, the left and right homologous arm sequences in step (1) are obtained by amplifying the 50 - 500 bp sequences on both sides of the target sequence of the engineered bacterium.

21. According to the method described in claim 11 or 15, the plasmid obtained in step (1) and the pCas9 plasmid in step (2) each contain at least one resistance gene.

22. According to the method described in claim 21, the resistance genes of the plasmid containing the gRNA and the pCas9 plasmid in step (2) are respectively selected from the spectinomycin resistance gene, kanamycin resistance gene, chloramphenicol resistance gene or ampicillin resistance gene.

23. According to the method described in claim 11 or 15, the resistance screening in step (3) refers to screening out the strains in which the barstar gene is integrated into the chromosomal genome of the engineered bacterium through a double - resistance medium.

24. A method for cloning the barnase gene, characterized in that, The method includes transforming the plasmid containing the barnase gene into the engineered bacterium described in any one of claims 1 - 9 or the engineered bacterium prepared by using the method described in any one of claims 10 - 23 and culturing and amplifying.

25. According to the method described in claim 24, it further includes screening out the engineered bacterium transformed with the barnase gene through a double - resistance medium.

26. The method according to claim 24 or 25, characterized in that, It also includes plasmid extraction from the amplified and cultured engineered bacterium.

27. According to the method described in claim 26, it further includes sequence verification of the extracted plasmid.

28. The method according to claim 24 or 25, characterized in that, The plasmid containing the barnase gene is selected from the prokaryotic expression vectors pET, pGEX series, yeast vectors pRS, pESC series, plant vectors pCAMBIA series, eukaryotic expression vectors pcDNA3.1 series, pUC57, U9041-1 or U9041-12.