Wheat disease resistance related protein TaNLR-4B and coding gene and application thereof

By overexpressing the disease-resistant protein TaNLR-4B in wheat, the environmental threats posed by chemical control and the challenges of breeding disease-resistant varieties have been addressed, achieving efficient and durable resistance to stripe rust in wheat and providing a new method for breeding disease-resistant varieties.

CN119219756BActive Publication Date: 2025-10-24NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411598343.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-11
Publication Date
2025-10-24
Estimated Expiration
2044-11-11

AI Technical Summary

Technical Problem

Existing methods for controlling wheat stripe rust rely on chemical pesticides, posing threats to the environment and food safety. Furthermore, breeding resistant varieties is difficult, and the stripe rust fungus exhibits rapid virulence variation, making disease control challenging.

Method used

By overexpressing the wheat disease resistance-related protein TaNLR-4B using genetic engineering technology, and then using Agrobacterium-mediated genetic transformation, the TaNLR-4B gene was overexpressed in wheat to enhance its resistance to stripe rust.

Benefits of technology

Breaking through reproductive isolation between species in a short period of time, achieving comprehensive, continuous, and broad-spectrum protection of wheat against stripe rust, improving wheat's disease resistance, and providing new methods for breeding disease-resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119219756B_ABST
    Figure CN119219756B_ABST
Patent Text Reader

Abstract

The application discloses a wheat disease resistance related protein TaNLR-4B and a coding gene and application thereof, and belongs to the technical field of genetic engineering. The amino acid sequence of the TaNLR-4B provided by the application is shown as SEQ ID NO:1, the ORF sequence of the TaNLR-4B is shown as SEQ ID NO:2, the gene TaNLR-4B is induced to express in a wheat stripe rust compatible interaction system, is not induced to express in a wheat stripe rust non-compatible interaction system, and plays a positive regulation role in the compatible interaction of the wheat and the stripe rust fungus. The gene TaNLR-4B is cloned in Gui Xie 3, overexpressed in a wheat stripe rust susceptible variety Fielder, TaNLR-4B overexpression plants are obtained, and the enhanced resistance of the TaNLR-4B overexpression plants to the stripe rust fungus CYR34 is verified, thereby providing a new gene resource for wheat stripe rust resistance breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and relates to a wheat disease-resistant protein TaNLR-4B, a coding gene thereof and an application thereof. BACKGROUND

[0002] Disease-resistant proteins are important components of the plant immune system and play a key role in resisting various pathogenic infections. Wheat stripe rust is a fungal disease caused by Puccinia striiformis f. sp. tritici (Pst) and occurs in almost every major wheat-growing region in the world, posing a serious threat to wheat production. Due to the strong genetic variability of Pst, its virulence frequently mutates, leading to frequent outbreaks of wheat stripe rust. Existing disease-resistant varieties often lose their resistance in a short period of time. Therefore, the rational use of disease-resistant genes to create disease-resistant materials is the most economical and effective sustainable development strategy for controlling wheat stripe rust.

[0003] Disease-resistant proteins with coiled-coil domains, nucleotide-binding sites and leucine-rich repeat sequences are important members of the plant disease-resistant gene family. They are named for containing N-terminal coiled-coil domains (CC), nucleotide-binding sites (NBS) and C-terminal leucine-rich repeat sequences (LRR). Disease-resistant proteins can recognize pathogen effector molecules and activate plant defense responses, thereby enhancing plant disease resistance. Studies have shown that disease-resistant proteins with coiled-coil domains, nucleotide-binding sites and leucine-rich repeat sequences can induce immune responses and initiate various defense mechanisms, including hypersensitive response (HR), through direct or indirect interaction with pathogen effectors. This process is usually accompanied by the local occurrence of cell death, thereby limiting the spread of pathogenic bacteria.

[0004] In wheat, disease-resistant proteins with coiled-coil domains, nucleotide-binding sites and leucine-rich repeat sequences have been shown to be closely related to the defense response against Pst. Multiple disease resistance loci in wheat (such as Yr18, Yr36, etc.) have been found to encode this type of disease-resistant protein, which can recognize effector molecules released after Pst invasion, activate downstream signaling pathways, and ultimately initiate disease resistance responses. However, with the variation of Pst, the effectiveness of some disease resistance genes gradually weakens. Therefore, the discovery and study of new protein disease resistance genes is crucial to improving the ability of wheat to resist stripe rust.

[0005] Currently, the control of wheat stripe rust mainly relies on chemical control. However, long-term use of chemical pesticides has caused serious threats to the environment and food safety, which has attracted widespread attention. In contrast, disease-resistant breeding is an economic, effective and environmentally friendly control strategy. However, due to the long screening period of disease-resistant genes, the difficulty of breeding disease-resistant varieties, and the rapid virulence variation of stripe rust, the persistent control of this disease faces great challenges. Therefore, creating broad-spectrum and persistent disease-resistant materials, especially using the disease-resistant mechanism of proteins, is the fundamental approach and key technology for controlling wheat stripe rust. This not only helps to maintain the stability of wheat production, but also provides a strong guarantee for sustainable agricultural development. SUMMARY

[0006] In view of the above prior art, the present application provides a wheat disease-resistant protein TaNLR-4B and an encoding gene and application thereof. Overexpression of the wheat disease-resistant protein gene TaNLR-4B can improve the resistance of wheat to stripe rust, and has important application value in the cultivation of wheat varieties resistant to stripe rust.

[0007] In a first aspect, the present application provides a wheat disease-resistant protein TaNLR-4B, wherein the amino acid sequence of the wheat disease-resistant protein TaNLR-4B is shown as SEQ ID NO: 1.

[0008] Further, the present application screens a coiled coil domain, nucleotide binding site and leucine-rich repeat sequence type disease-resistant protein TaNLR-4B by performing GWAS whole genome association analysis on 500 wheat samples inoculated with stripe rust.

[0009] In a second aspect, the present application provides a wheat disease-resistant protein gene TaNLR-4B, wherein the nucleotide sequence of the wheat disease-resistant protein gene TaNLR-4B is shown as SEQ ID NO: 2.

[0010] In a third aspect, the present application provides an expression vector comprising the wheat disease-resistant protein gene TaNLR-4B.

[0011] Further, the expression vector requires overexpression of the wheat disease-resistant protein gene TaNLR-4B, and the primers for overexpression of the wheat disease-resistant protein gene TaNLR-4B are shown as SEQ ID NO: 3 and SEQ ID NO: 4.

[0012] In a fourth aspect, the present application provides a method for cultivating wheat varieties resistant to stripe rust, wherein the wheat disease-resistant protein gene TaNLR-4B is overexpressed to obtain wheat resistant to stripe rust.

[0013] Further, the application provides a method for cultivating wheat resistant varieties, wherein the expression vector is transformed into wheat by Agrobacterium-mediated genetic transformation, and the wheat variety is wild-type wheat Fielder.

[0014] In a fifth aspect, the application provides the application of the wheat disease resistance related protein gene TaNLR-4B in cultivating wheat resistant to stripe rust.

[0015] Further, overexpression of the wheat disease resistance related protein gene TaNLR-4B improves the resistance of wheat to stripe rust.

[0016] Compared with the prior art, the technical scheme provided by the application has at least the following beneficial effects or advantages:

[0017] (1) Compared with the traditional disease resistance breeding technology, the plant disease resistance genetic engineering technology can break through the reproductive isolation between species and the incompatibility of distant hybridization, realize the directional improvement of target traits in a short time, and provide more comprehensive, continuous and broad-spectrum protection for crops. Through gene function research, the application finds that the disease resistance protein TaNLR-4B plays a positive regulation role in the defense reaction of wheat against stripe rust, that is, overexpression of the TaNLR-4B gene can improve the resistance of wheat to stripe rust.

[0018] (2) The application provides a method for cultivating wheat varieties resistant to stripe rust. The method uses genetic engineering technology to overexpress the disease resistance protein TaNLR-4B in wheat plants, and enhances the resistance of wheat to stripe rust. It has been verified that the transgenic wheat obtained by the method shows resistance to the stripe rust physiological race CYR34. The application provides a new technical idea for cultivating wheat varieties resistant to stripe rust from the perspective of molecular biology, and effectively solves the technical problems. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 It is a schematic diagram of the overexpression vector of the gene TaNLR-4B. Wherein, LB is the left border of T-DNA; OsAct1, PvUbi1 and ZmUbi1 are promoters; Bar is a selection marker for plant transgenesis; GUSPlus is a reporter gene for plant gene expression; Acv5 is used for screening or identifying specific cells; TaNLR-4B is the target gene; 35ST, NOST and OCST are terminators; and RB is the right border of T-DNA, which is the integration end point of T-DNA in the plant genome.

[0020] Figure 2 It is the PCR detection result of the transgenic wheat TaNLR-4B-OE positive plant. Wherein, L1, L2 and L3 are transgenic wheat TaNLR-4B-OE; and M is a DNA marker.

[0021] Figure 3 The results of the induced expression profile analysis of the wheat resistance protein gene TaNLR-4B under infection of the stripe rust fungus. MX169 is Mingxian 169, GX3# is Guixie 3; *** is P < 0.001.

[0022] Figure 4 The schematic diagram of the phenotype results of the transgenic wheat TaNLR-4B-OE inoculated with the stripe rust fungus CYR32. TaNLR-4B-OE is the transgenic wheat, CYR32 represents the inoculation of the stripe rust fungus CYR32, WT is the wild type wheat Fielder, L1, L2 and L3 are different strains. DETAILED DESCRIPTION

[0023] In the following, the technical solutions of the present application will be described in conjunction with examples, but the present application is not limited to the following examples. The experimental methods and detection methods described in each example are all conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0024] In order to completely and unambiguously understand the technical solutions of the present application, it needs to be explained that in the present application, the non-italic font "TaNLR-4B" represents the TaNLR-4B protein, and the italic font "TaNLR-4B" represents the TaNLR-4B gene. Of course, those skilled in the art can clearly and completely understand the expression meaning of the related genes and their encoded proteins according to the description of the present application.

[0025] Example 1

[0026] This embodiment provides the isolation and identification of the coiled coil domain, nucleotide binding site and leucine-rich repeat class of disease resistance protein gene TaNLR-4B.

[0027] 500 wheat samples were inoculated with the stripe rust fungus, and then subjected to genome-wide association analysis (GWAS) to mine genetic variations closely related to the wheat resistance to stripe rust trait. After data screening and bioinformatics analysis, the coiled coil domain, nucleotide binding site and leucine-rich repeat class of disease resistance protein gene TaNLR-4B was obtained. The expression level of the gene TaNLR-4B is significantly different between the resistant and susceptible varieties, indicating the core role of the gene in the wheat resistance to stripe rust mechanism. In this embodiment, the gene TaNLR-4B in the wheat variety with strong resistance was cloned, and the obtained TaNLR-4B amino acid sequence is shown as SEQ ID NO: 1, and the nucleotide sequence of the encoding gene TaNLR-4B is shown as SEQ ID NO: 2.

[0028] 1. Wheat samples susceptible to stripe rust fungus and phenotype data collection

[0029] Three lines of wheat mutant materials were selected, and 6-10 full seeds were selected from each line. The wild type Fielder wheat variety was used as a control. The seeds were soaked before planting with 0.2% hydrogen peroxide solution for 18-24 h to promote seed germination. After the seeds were exposed to light, they were transplanted into 10x10 cm plastic flowerpots, with one line of each gene planted in each flowerpot. After recording the numbers, the samples were placed in a culture room with a temperature of 16°C and a light / dark cycle of 16 / 8 for 12-14 days. The seeds were arranged as dispersed and uniform as possible during planting to facilitate subsequent inoculation and identification. When the wheat mutant materials grew to the two-leaf-one-heart stage, the fully expanded two leaves were inoculated with stripe rust CYR31. Before inoculation, the leaves that needed to be inoculated were marked. Fresh stripe rust CYR31 uredospores were poured into an electronic incubation solution and gently mixed to prepare a 4 mg / mL spore suspension. 20-30 μL of the spore suspension was drawn up with a pipette and slowly and evenly spread on the inoculated leaves. After inoculation, a small amount of water was sprayed on the wheat leaves, and the inoculated wheat seedlings were placed in a culture box with a temperature of 14°C and a relative humidity of 100% for light-free humidification. After 24 h, they were removed and transferred to a culture room with a temperature of 16°C and a light / dark cycle of 16 / 8 for further cultivation. A small amount of water was sprayed every day to keep the humidity. After about 14 days of inoculation, the wild type Fielder was fully diseased (the area of the leaf lesion accounted for more than 80% of the total leaf area), and the disease conditions of the other mutant materials were observed. The disease conditions were photographed and recorded for each line, and the reaction types were identified according to the McNeal grading standard.

[0030] 2. Genome DNA extraction and whole genome association analysis of disease-resistant varieties

[0031] The present embodiment uses CTAB method to extract mutant material DNA. After the identification of the inoculated bacteria, the appropriate leaves are placed in 2.0 mL centrifuge tubes, and the labels are marked and quickly placed in liquid nitrogen. The sample is broken by using a broken grinder, 1-2 steel balls are placed in each sample before breaking, the breaking time is 30-60 s, and the sample is immediately placed on ice after breaking; 800 μL of CTAB (containing 0.2% mercapto reducing agent) preheated at 65°C is added to each sample, and then it is placed in a water bath at 65°C after shaking, and the water bath is 1 h. The sample is taken out and placed on ice, and after cooling to room temperature, 800 μL of DNA extraction solution is added and mixed evenly, shaken for 5 min, and then centrifuged at 12000 rpm for 10 min. The supernatant is transferred to a 2.0 mL centrifuge tube, chloroform is added (supernatant: chloroform = 1:1, v / v), mixed evenly, and then centrifuged at 12000 rpm for 10 min. The supernatant is transferred to a 1.5 mL centrifuge tube, and pre-cooled isopropanol and sodium acetate (supernatant: isopropanol: sodium acetate = 10:10:1, v / v) are added and mixed evenly. Store in a -20°C ultra-low temperature refrigerator overnight. Centrifuge at 12000 rpm for 10 min, discard the supernatant, add 500 μL of 75% ethanol, and suspend the DNA precipitate. Centrifuge at 12000 rpm for 5 min, discard the supernatant, add 500 μL of anhydrous ethanol, and suspend the DNA precipitate. Centrifuge at 12000 rpm for 5 min, discard the supernatant, and stand at room temperature for 10-30 min (to allow the anhydrous ethanol to evaporate completely). Add 100 μL of preheated sterile ddH2O to the DNA precipitate, and dissolve the DNA precipitate completely. Take 1-5 μL of the DNA sample, add Loading buffer in proportion, mix well, and perform agarose nucleic acid electrophoresis detection (1% agarose gel, 160 V, 20 min) to detect whether the extracted DNA sample has tailing and degradation. Take 1 μL of the DNA sample, and use a Nanodrop 2000 spectrophotometer to detect the concentration and quality of the DNA. If the measured OD 260nm / 280nm value is between 1.8 and 2.0, and the OD 260nm / 230nm value is greater than 2.0, the DNA sample has good purity. The DNA sample with good concentration and quality is stored in a -20°C ultra-low temperature refrigerator.

[0032] Genome-wide association analysis (GWAS)

[0033] First, the materials with obvious phenotypes are collected statistically. DNA is extracted from each sample and genotyped, and whole genome sequence data is obtained through whole genome sequencing technology, including SNPs, InDels, CNVs, and other variations. GWAS analysis involves a large amount of data, so strict quality control is needed to ensure the accuracy of the results. Low-quality samples are removed, samples with too small sample size, inaccurate phenotype data, and significant errors are removed, statistical methods are used to remove outliers, check if the sample has inconsistent phenotype or genotype data, remove suspected duplicates or errors, remove SNPs with high missing rates (such as more than 5% missing data), as this may lead to false positive results, remove SNPs with very low allele frequency (for example, less than 5% frequency), as these SNPs usually do not perform well in samples and may not have sufficient statistical power, check if each SNP meets the Hardy-Weinberg equilibrium (HWE) in the population, SNPs deviating from equilibrium may be data errors or markers that do not conform to the population genetic structure. Check the sample population structure to avoid genotype differences between populations affecting the results.

[0034] The PCA (Principal Component Analysis) method is used to detect the population structure in the samples. PCA can identify different populations or subpopulations that may exist in the samples by calculating principal components to represent different population structures. The PCA results can be added as covariates to subsequent regression analysis. The mixed linear model (MLM) corrects the population structure and family effects. MLM can consider the genetic relationship and environmental effects between populations, thereby improving the accuracy of GWAS analysis. The GEMMA software tool is used to perform linear regression analysis, chi-square test, and mixed linear model (MLM) to correlate 500 genotype data and phenotype data, and identify genetic variations related to the trait. The statistical software GEMMA is used to perform genome-wide association analysis, and the correlation strength between each SNP and the phenotype is calculated, represented by p-value. Multiple comparison correction is performed to avoid false positives, and the false discovery rate (FDR) is controlled to find SNPs significantly associated with the phenotype. According to the genomic location of the SNP, relevant candidate genes are screened. Gene Ontology (GO) analysis is used to explore the functions of these candidate genes and their roles in biological processes.

[0035] Example 2

[0036] This example provides a method for preparing transgenic wheat TaNLR-4B-OE.

[0037] The transgenic background material used in this example is wild-type wheat Fielder, which overexpresses the gene TaNLR-4B and uses Agrobacterium-mediated genetic transformation to create TaNLR-4B gene editing plants. The method for preparing TaNLR-4B gene editing plants is as follows:

[0038] (1) Construction of overexpression vector

[0039] The primers for overexpressing gene TaNLR-4B are designed as shown in SEQ ID NO: 3 and SEQ ID NO: 4:

[0040] TaNLR-4B-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGATT ACAAGGATGACGACGATATGGCTGAAGCTTCCCGGCGAG (SEQ ID NO: 3);

[0041] TaNLR-4B-R: GGGGACCACTTTGTACAAGAAAGCTGGGTCTTATCGGCC TTCTGGATGTG (SEQ ID NO: 4).

[0042] The full-length sequence of the amplified gene is obtained by using the TaNLR-4B overexpression vector construction primer, and the amplified fragment is constructed into the expression vector pANIC6E by homologous recombination Gateway reaction to obtain the TaNLR-4B-pANIC6E overexpression vector.

[0043] As Figure 1As shown, the beginning of the overexpression vector is the left border (LB) of the T-DNA, which is the starting point of the T-DNA transfer from the plasmid to the plant genome in the process of Agrobacterium-mediated plant transformation, marking the beginning of the T-DNA sequence, and is a key signal for the integration of the vector into the plant genome. The overexpression vector contains the rice promoter Actin 1 (OsActl) to drive the efficient expression of the selection marker gene Bar in plants. The selection marker gene Bar encodes a phosphotransferase, making the plant resistant to glyphosate and allowing for the rapid identification of cells that have successfully taken up the target gene. After the gene Bar, the 35S terminator of the cauliflower mosaic virus (35ST) is used to terminate the transcription of the gene Bar and add a poly-A tail to stabilize the structure of the mRNA and improve the expression efficiency of the gene. The overexpression vector also contains the common bean ubiquitin 1 promoter (PvUbi 1) to drive the gene GUSPlus. The gene GUSPlus encodes β-glucuronidase, which is detected by a color reaction to observe the expression pattern and location of the gene. The Nopaline synthase terminator (NOST) of Agrobacterium terminates the transcription of the gene GUSPlus. The maize ubiquitin 1 promoter (ZmUbi 1) drives the target gene TaNLR-4B, and the Acv5 element is used to screen the target gene. The Octopine synthase gene terminator (OCST) of Agrobacterium terminates the transcription of the gene TaNLR-4B. The end of the overexpression vector is the right border (RB) of the T-DNA.

[0044] (2) Obtaining of transgenic wheat

[0045] Using the Agrobacterium-mediated genetic transformation method, the overexpression vector TaNLR-4B-pANIC6E was introduced into wheat embryonic cells, and transgenic wheat TaNLR-4B-OE was obtained by culture.

[0046] Take 100 μL of Agrobacterium competent EHA105, place it in ice until it completely melts; add the overexpression vector TaNLR-4B-pANIC6E to the Agrobacterium competent cells, gently shake to mix them thoroughly; preheat the water bath to 37°C, and then perform the transformation according to the following operations: low-temperature standing in an ice box for 5 min; standing in liquid nitrogen for 5 min; 37°C water bath for 5 min; low-temperature standing in an ice box for 5 min; add 800 μL of antibiotic-free LB liquid medium, mix gently and evenly, then shake at 28°C, 160 rpm for 2-3 h; 5000 rpm, 5 min, collect the bacteria; discard the supernatant in a super-clean bench, reserve about 100 μL of supernatant, move it to a plate containing Kan (50 mg / L) and Rif (25 mg / L), evenly spread, and then stand for 2-3 min to dry the bacteria; seal the plate with sealing film, invert it in a 28°C incubator, and cultivate in the dark for 2-3 days. The transgenic overexpression plants are obtained through the Agrobacterium-mediated genetic transformation system.

[0047] (3) PCR verification

[0048] This example performs PCR verification on L1, L2 and L3 of the transgenic wheat TaNLR-4B-OE T1 generation. The transgenic positive plants are detected by Blp-F / R primers, and the PCR products are detected by 1% agarose gel electrophoresis. The Blp-F / R primers are as follows:

[0049] Blp-F: GCAAGACCCTTCCTCTATATAAGG;

[0050] Blp-R: TCAGATCTCGGTGACGGGCAGGACC.

[0051] The DNA extracted from the transgenic wheat TaNLR-4B-OE is positively detected. According to the reaction system shown in Table 1, the reaction sample and reagents are sequentially added to the PCR tube:

[0052] Table 1 PCR verification reaction system

[0053]

[0054] The above sample and reagents are sequentially added to the PCR tube, and then mixed by instantaneous centrifugation. The PCR reaction program is set as shown in Table 2:

[0055] Table 2 PCR verification reaction program

[0056] Procedure Pre-denaturation Denaturation Annealing Extension Final extension Preservation Temperature 95℃ 95℃ 58℃ 72℃ 72℃ 16℃ Time 5 min 30s 30s 30s 10 min forever

[0057] Wherein, the denaturation-annealing-extension cycle is 35 times. After the reaction is completed, 5-10 μL of the PCR product is taken for agarose nucleic acid electrophoresis detection (1% agarose gel, 160 V, 20 min), and the gel running condition is observed by a gel imaging instrument.

[0058] Figure 2 PCR verification results of the transgenic wheat TaNLR-4B-OE. Figure 3 The electrophoresis verification results of the overexpression strain are shown in Table 2, wherein L1, L2 and L3 all amplify a 750 bp fragment, indicating that the transgenic wheat with the TaNLR-4B gene is successfully obtained.

[0059] Example 3

[0060] This example provides the induction expression of the disease-resistant protein gene TaNLR-4B by Puccinia striiformis.

[0061] When the transgenic wheat with the TaNLR-4B gene prepared in Example 2 grows to the two-leaf-one-heart stage, Puccinia striiformis CYR32 is inoculated on the fully expanded two leaves. Before inoculation, the leaves to be inoculated are marked. Fresh Puccinia striiformis CYR32 uredospores are poured into an electronic incubation solution and gently mixed to prepare a 4 mg / mL spore suspension. 20-30 μL of the spore suspension is taken by a pipette and slowly and evenly spread on the inoculated leaves. After inoculation, a small amount of water is sprayed on the wheat leaves, and the inoculated wheat seedlings are placed in a culture box with a temperature of 14°C and a relative humidity of 100% for light-free and moisture retention. After 24 h, the seedlings are taken out and transferred to a culture room with a temperature of 16°C and a light-dark cycle of 16 / 8 for further cultivation. During the cultivation, a small amount of water can be sprayed every day to keep the moisture. At different time points (6 h, 12 h, 24 h, 36 h and 48 h after inoculation), the inoculated leaf samples and the control samples (wheat leaves without Puccinia striiformis inoculation) are collected for subsequent RNA extraction.

[0062] The samples are quickly cut from the infected wheat leaves and immediately frozen in liquid nitrogen or stored in a -80°C refrigerator. Commercial RNA extraction kits are used to extract total RNA according to the instructions. The RNA concentration is measured using a NanoDrop instrument, and the integrity of the RNA is confirmed by agarose gel electrophoresis.

[0063] The extracted RNA is transcribed into cDNA using a reverse transcription kit. Real-time PCR is used for quality control of the cDNA, and the reference gene TaEF1-α is selected for verification. Specific primers for the disease-resistant protein gene TaNLR-4B are designed. The primers for the reference gene TaEF1-α are designed. The specific primers for the gene TaNLR-4B and the TaEF primers are as follows:

[0064] TaEF-F: TGGTGTCATCAAGCCTGGTATGGT;

[0065] TaEF-R: ACTCATGGTGCATCTCAACGGACT.

[0066] TaNLR-4B-qRT-F: TGCAAGAGGCCGGCGAGAGA;

[0067] TaNLR-4B-qRT-R: GAATGACAGTGAGTCTGAAC.

[0068] Prepare the qRT-PCR reaction system, add appropriate amount of cDNA template, primers, SYBR Green fluorescent dye and other necessary reagents. According to the characteristics of the primers, set the appropriate annealing temperature and cycle conditions. Real-time PCR detects the relative expression of disease resistance protein gene TaNLR-4B, and uses the internal reference gene for standardization. Use the Delta Delta Ct method to calculate the relative expression, and draw the expression change curve. Analyze the expression difference of disease resistance protein gene TaNLR-4B in different time points.

[0069] This example analyzes the induced expression profile of gene TaNLR-4B at different stages of wheat and stripe rust in compatible and incompatible systems. Figure 3 The results of the induced expression analysis of gene TaNLR-4B. qRT-PCR detects the induced expression of gene TaNLR-4B at different time points (6h, 12h, 24h, 36h, 48h) of wheat variety Guixiezhang 3 (GX3#) inoculated with stripe rust CYR34 (compatible) and Mingxian 169 (MX169) inoculated with stripe rust CYR34 (incompatible). The results show that the expression of gene TaNLR-4B is the highest at 24h after infection of stripe rust in the compatible system, indicating that gene TaNLR-4B responds to the interaction between wheat and stripe rust.

[0070] Example 4

[0071] This example provides the analysis of stripe rust resistance of transgenic wheat TaNLR-4B-OE.

[0072] The resistance of TaNLR-4B gene edited plants to stripe rust was identified by McNeal phenotype evaluation and qRT-PCR method.

[0073] Genomic DNA was extracted from transgenic wheat TaNLR-4B-OE material, and primers were designed for PCR amplification, which were used to amplify cDNA of TaNLR-4B gene. The PCR products were analyzed by agarose gel electrophoresis. After positive identification, the positive material was analyzed for genome editing to determine the editing condition.

[0074] The amplification primers of the target gene TaNLR-4B are as follows:

[0075] TaNLR-4B-cDNA-F: ATGGCTGAAGCTTCCCGGCGAG;

[0076] TaNLR-4B-cDNA-R: TTATCGGCCTTCTGGATGTG.

[0077] Gene expression analysis (qRT-PCR), total RNA was extracted from the gene edited plants. Ensure to select healthy wheat tissues (such as leaves), extract RNA using RNA extraction kit, and transcribe the extracted RNA into cDNA using reverse transcription kit for subsequent PCR analysis. Select the target gene TaNLR-4B and the internal reference gene for quantitative PCR, and use TaNLR-4B specific primers for qRT-PCR. By Delta Delta Ct method, compare the expression level of TaNLR-4B in transgenic plants and control plants. After confirming the expression of TaNLR-4B gene in gene edited plants in Example 3, the transgenic wheat TaNLR-4B-OE was subjected to Puccinia striiformis CYR32 resistance detection, and whether the edited gene improved the resistance of the plant to Puccinia striiformis was observed.

[0078] Select 6-10 full seeds of each strain of TaNLR-4B-OE material, and number them; meanwhile, use wild type Fielder wheat variety as control; seed soaking is performed before planting, soak in 0.2% hydrogen peroxide solution for 18-24 h to promote seed germination; after seed germination, transplant to 10*10 cm plastic flowerpots, plant one strain of one gene in each flowerpot, record the number, and place in a culture room with temperature of 16°C and light / dark cycle of 16 / 8 for 12-14 days. Try to place the seeds dispersed and uniformly during planting, so as to facilitate subsequent inoculation identification; when the wheat mutant material grows to two-leaf-one-heart stage, inoculate stripe rust CYR32 on fully expanded two leaves. Label the leaves to be inoculated before inoculation, pour fresh stripe rust CYR32 uredospores into electronic incubation liquid, mix gently, and prepare 4 mg / mL spore suspension. Use a pipette gun to take 20-30 μL spore suspension, and slowly and uniformly spread on the inoculated leaves; after inoculation, spray a small amount of water on the wheat leaves, and place the inoculated wheat seedlings in a culture room with temperature of 14°C and relative humidity of 100% for light-avoiding and moisture-keeping. Take out after 24 h, and transfer to a culture room with temperature of 16°C and light / dark cycle of 16 / 8 for continuous cultivation; spray a small amount of water every day during cultivation to keep moist; after about 14 days of inoculation, observe the disease incidence of the inoculated leaves of the wild type Fielder, take pictures of the disease incidence of each strain, and identify the reaction type according to the selected grading standard.

[0079] The phenotype results of transgenic wheat L1, L2 and L3 after inoculation with stripe rust virus race CYR32 for 14 d are shown in Table 1. Figure 4 As shown in Table 1, the wild type Fielder wheat plant produces a large number of spores on the leaf surface, while the transgenic wheat L1, L2 and L3 produces less spores on the leaf surface, indicating that the transgenic wheat L1, L2 and L3 has resistance to stripe rust virus race CYR32. The above results show that the resistance of TaNLR-4B-OE overexpression plant to stripe rust is enhanced.

[0080] The above-described embodiments are part of the embodiments of the present application, rather than all the embodiments. The detailed description of the embodiments of the present application is not intended to limit the scope of the claimed application, but merely represents selected embodiments of the application. All other embodiments obtained by persons of ordinary skill in the art based on the relevant deductions and substitutions made under the concept of the present application, without making creative efforts, fall within the scope of protection of the present application.

Claims

1. A method of breeding a wheat variety resistant to stripe rust, comprising, Overexpression of wheat disease-related protein genes TaNLR-4B ; The nucleotide sequence of the wheat disease resistance-related protein gene TaNLR-4B is shown as SEQ ID NO: 2; The amino acid sequence of the wheat disease resistance related protein TaNLR-4B is shown as SEQ ID NO:

1.

2. The method of claim 1, wherein, Transforming expression vector over-expressing wheat disease-related protein gene TaNLR-4B into wheat to obtain wheat resistant to stripe rust.

3. The method of claim 2, wherein, The transformation method is Agrobacterium-mediated genetic transformation method.

4. The method of claim 2, wherein, The variety of the wheat is wild type wheat Fielder.

5. A wheat disease resistance-related protein gene TaNLR-4B Use in breeding of wheat resistant to stripe rust, characterized in that, overexpressing said wheat disease resistance-related protein gene TaNLR-4B to increase the resistance of wheat to stripe rust; The nucleotide sequence of the wheat disease resistance-related protein gene TaNLR-4B is shown as SEQ ID NO: 2.