Rice OsRGE3 gene and its encoded protein and its application

Abstract

The present invention relates to rice OsRGE3 gene and its encoded protein and application. The present invention constructs a CRISPR / Cas9-OsRGE3 knockout vector, transforms rice by Agrobacterium-mediated method, and obtains OsRGE3 knockout mutant; and it is proved by experiments that the root length of OsRGE3 gene functional loss mutants Cas9-N1 and Cas9-N2 is significantly longer than that of wild type Nipponbare (P<0.01), indicating that reducing the expression of OsRGE3 gene can significantly promote the elongation of young roots in rice germination period, thereby improving the drought resistance of plants. In addition, the growth of rice root length helps plants to enhance nutrient absorption, thereby affecting rice yield and quality. The OsRGE3 gene in the present invention provides a new excellent gene resource for rice molecular breeding, and has good application prospects.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to the rice OsRGE3 gene, its encoded protein and applications. Background Art

[0002] Rice is both an important model plant and one of the crops indispensable for maintaining national food security. As an essential vegetative organ for the growth and development of rice, the root system is the link for rice to exchange substances and communicate information with the soil, and undertakes numerous physiological and biochemical functions, such as fixing the plant, absorbing water and fertilizers, and transporting and storing nutrients, etc., indirectly determining the performance of many agronomic traits such as above-ground yield, quality, and stress resistance (Wu Weiming, Cheng Shihua, 2005; Liang Yongshu et al., 2016; Liang et al., 2011; Liang et al., 2013). In recent years, the country has increased the research on plant root traits. Using modern molecular biology theory and technical systems to screen and identify excellent rice root gene resources is of great significance for optimizing and improving rice root traits and thus increasing rice yield.

[0003] The ubiquitin-proteasome system (UPS) is one of the most important regulatory mechanisms for protein modification in plants. It mediates 80%-85% of protein degradation in eukaryotes and is involved in almost all aspects of plant growth and development. It is one of the most important and precise regulatory mechanisms for efficient and specific protein degradation in plants (Smalle and Vierstra, 2004; Vierstra, 2009; Santner and Estelle, 2010). In the UPS pathway, the ubiquitination process mainly involves three types of ubiquitinating enzymes: ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzyme (E2), and ubiquitin-ligating enzyme (E3). E1 is the first key enzyme in the ubiquitination process and also the starting point of ubiquitination. It is responsible for activating ubiquitin (Ub) molecules and transferring the activated Ub molecules to E2 (Schulman and Harper, 2009); E2 is responsible for transferring Ub molecules to target proteins through E3 (Ye and Rape, 2009); E3 is responsible for recognizing target proteins and determines the specificity of the binding of ubiquitin proteins to substrates. Studies have shown that E3 ubiquitin ligases are involved in the regulation of multiple plant growth and development processes such as photomorphogenesis, hormone signal transduction, abiotic stress, and immune defense. However, compared with the numerous E3 ubiquitin ligase members in Arabidopsis and rice, the functions of the vast majority of E3 ubiquitin ligases, especially the functions of E3 ubiquitin ligases in the regulation of rice root growth and development, have not been revealed and elucidated. Summary of the Invention

[0004] The object of the present invention is to provide the nucleotide sequence of the rice OsRGE3 gene and to clarify the function of this gene in negatively regulating root growth during the germination period of rice.

[0005] The second object of the present invention is to provide the rice OsRGE3 protein.

[0006] The third object of the present invention is to provide the cloning primers for the above OsRGE3 gene.

[0007] The fourth object of the present invention is to provide an expression cassette, recombinant vector, recombinant cell, or recombinant bacterium containing the above OsRGE3 gene.

[0008] The fifth object of the present invention is to provide the application of the above OsRGE3 gene or OsRGE3 protein.

[0009] In order to achieve the above objects, the present invention adopts the following technical solutions:

[0010] The OsRGE3 gene, whose nucleotide sequence is shown in SEQ ID NO:1 or SEQ ID NO:2, or the amino acid sequence of the protein encoded thereby is shown in SEQ ID NO:3.

[0011] The OsRGE3 protein, whose amino acid sequence is shown in SEQ ID NO:2.

[0012] The present invention provides a gene involved in regulating rice root length and its encoded protein. This gene is named OsRGE3 (Root Growth related E3), and the protein encoded by it is named OsRGE3. The full length of the OsRGE3 genomic sequence is 4855bp, the full length of the exon CDS sequence is 2193bp, encoding 730 amino acids. This gene is derived from rice and provides a new genetic resource for regulating root growth during the germination period of rice.

[0013] Primers for cloning the above-mentioned OsRGE3 gene, the nucleotide sequences of the primers are shown in SEQ ID NO:3-4.

[0014] An expression cassette, recombinant vector, recombinant cell or recombinant bacterium containing the above-mentioned OsRGE3 gene.

[0015] When using the OsRGE3 gene provided by the present invention to construct a recombinant expression vector and introduce it into plant cells to obtain transgenic plants related to root elongation during the germination period of rice, any constitutive promoter, enhanced promoter or inducible promoter can be added before the transcription start nucleotide. For the purpose of facilitating the identification and screening of transgenic plants or transgenic plant cells, the vectors used can be processed, such as adding selectable markers (GUS gene, GFP, YFP, luciferase gene, etc.) or antibiotic marker genes with resistance (hygromycin resistance, herbicide Basta resistance genes, etc.). For the safety of the release of transgenic plants, no marker gene may be carried when constructing a plant expression vector, and specific PCR molecular marker screening is carried out at the seedling stage. The plant expression vector containing the OsRGE3 gene of the present invention can be transformed into plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, gene gun method, pollen tube pathway, microinjection, electroporation, Agrobacterium-mediated method, etc. The above-mentioned plants are dicotyledonous plants or monocotyledonous plants, and the monocotyledonous plant is rice.

[0016] The application of the above-mentioned OsRGE3 gene or OsRGE3 protein is any one of the following:

[0017] 1) Application in promoting root growth during the germination period of rice;

[0018] 2) Application in improving the drought tolerance of rice.

[0019] Preferably, by knocking out the OsRGE3 gene or down-regulating the expression level of the OsRGE3 gene or OsRGE3 protein, plants with increased root length at the germination stage are obtained.

[0020] Preferably, the OsRGE3 gene is knocked out by CRISPR-Cas9.

[0021] More preferably, the following steps are further included: extracting genomic DNA of the OsRGE3 gene knockout mutant for PCR amplification, and sequencing and identifying the gene mutation type of the amplification product; wherein, the nucleotide sequences of the primers for the PCR amplification are as shown in SEQ ID NO: 8-9.

[0022] Beneficial effects achieved by the present invention:

[0023] The present invention provides the gene OsRGE3 for regulating rice root growth and the protein encoded thereby, and further provides the application of the gene or protein in promoting root growth at the germination stage of rice, improving the germination rate of rice seeds under drought conditions, and improving the drought tolerance of rice. The present invention constructs a CRISPR / Cas9-OsRGE3 knockout vector, transforms rice by the Agrobacterium-mediated method to obtain an OsRGE3 knockout mutant; and through experiments, it is proved that the root lengths of the OsRGE3 gene function loss mutants Cas9-N1 and Cas9-N2 are significantly longer than those of the wild type Nipponbare (P < 0.01), indicating that reducing the expression of the OsRGE3 gene can significantly promote the elongation of young roots at the germination stage of rice, and further improve the drought tolerance of seeds under drought conditions at the germination stage. In addition, the increase in rice root length helps the plant to enhance nutrient absorption, and thus affects the yield and quality of rice. The OsRGE3 gene in the present invention provides a new excellent gene resource for rice molecular breeding and has good application prospects. Description of the Drawings

[0024] Figure 1 is for the cloning of the OsRGE3 gene;

[0025] Figure 2 is for the prediction of the domain of the protein encoded by OsRGE3;

[0026] Figure 3 is for the sequence analysis of the U-box domain of the protein encoded by OsRGE3;

[0027] Figure 4 is for the sequence alignment analysis of the U-box domain homologous proteins of OsRGE3;

[0028] Figure 5 is for the analysis of the expression pattern of the OsRGE3 gene;

[0029] Figure 6 Schematic diagram of the OsRGE3 gene structure and CRISPR / Cas9 target sequence sites;

[0030] Figure 7 Mutation sites of the Cas9-OsRGE3 knockout mutant in the Nipponbare rice ecological background;

[0031] Figure 8 Phenotype of the root length of the Cas9-OsRGE3 knockout mutant germinated for 3 days in the Nipponbare rice ecological background;

[0032] Figure 9 Statistical analysis of the root length of the Cas9-OsRGE3 knockout mutant germinated for 3 days in the Nipponbare rice ecological background;

[0033] Figure 10 Phenotype analysis of the Cas9-OsRGE3 knockout mutant in the Nipponbare rice ecological background after 2 days of treatment with different concentrations of D-mannitol. Specific implementation mode

[0034] The present invention will be further described below in conjunction with specific implementation modes, but the protection scope of the present invention is not limited thereto; the instruments and equipment involved in the following examples are all conventional instruments and equipment unless otherwise specified; the reagents involved are all commercially available conventional reagents unless otherwise specified; the test methods involved are all conventional methods unless otherwise specified.

[0035] Example 1 Cloning of the OsRGE3 gene

[0036] 1. RNA extraction from wild-type rice Nipponbare

[0037] Take an appropriate amount of leaves from wild-type rice Nipponbare seedlings and place them in a sterile 2 mL RNAase-free centrifuge tube. After quick-freezing in liquid nitrogen, quickly grind them into powder in a tissue grinder. Add 1 mL of TRIzol (Invitrogen), vortex to mix well, and let it stand on ice for 10 - 15 min for lysis; centrifuge at 4°C and 12,000 rpm for 10 min; aspirate the supernatant into a new RNAase-free centrifuge tube, add 200 μL of chloroform, mix well, and let it stand for 3 - 5 min; centrifuge at 4°C and 12,000 rpm for 10 min; gently aspirate 600 μL of the supernatant into a new RNAase-free centrifuge tube (be careful not to aspirate impurities), add an equal volume of pre-cooled isopropanol, mix well, and let it stand at -20°C for 30 min to precipitate RNA; centrifuge at 4°C and 12,000 rpm for 10 min; discard the supernatant, wash twice with 75% ethanol; dry in a laminar flow hood, and after drying, add 50 μL of RNAase-free Water to dissolve the RNA, and measure and record the RNA concentration with a spectrophotometer.

[0038] 2. Reverse transcription of RNA into cDNA

[0039] First, perform gDNA removal. After the reagent melts on ice, vortex to mix well and place it on ice. Add reaction buffer, template RNA, and RNase-free Water to the system in sequence according to the system in Table 1. The system is 10 μL. Mix gently and then centrifuge, and incubate at 42°C for 5 - 10 min.

[0040] Table 1 gDNA removal reaction system

[0041]

[0042] Add 10 μL to the reactant obtained in the previous step Plus 1st Strand cDNA Synthesis SuperMix, mix gently and then centrifuge, incubate at 50°C for 15 - 30 min; then incubate at 75°C for 5 min to terminate the reaction; the reaction product can be directly used for subsequent PCR experiments and stored at -20°C for later use.

[0043] 3. Gene cloning

[0044] Add the reagents required for the PCR reaction, PrimeSTAR Max Premix, primers (OsRGE3-F: ATGGCCACGGCGGGCTCC, OsRGE3-R: ATCTGCATTTGACTGAAGCCAT, the terminator has been removed from the R end), and template DNA, in sequence according to Table 2. The reaction system is 50 μL. Then, perform pre-denaturation, denaturation, annealing, extension, and final extension in sequence according to the PCR amplification reaction program in Table 3 to conduct gene cloning. Electrophorese the obtained PCR products on an agarose gel, cut the gel according to the target band observed by electrophoresis, and perform agarose gel recovery (using an agarose gel recovery kit and operating with reference to the instruction manual). After obtaining the purified target fragment, verify it by sequencing and store it at -20 °C for later use.

[0045] Table 2 PCR reaction system

[0046]

[0047] Table 3 PCR reaction program

[0048]

[0049] 1) Agarose gel electrophoresis

[0050] Weigh 0.3 g of agarose powder into a conical flask, add 30 ml of 1×TAE buffer (the formula of TAE buffer is shown in Table 4), heat and dissolve it until it becomes a clear liquid. When it cools to slightly warm, add nucleic acid dye and mix well, then pour it into the gel bed and let it stand for 20 - 30 min to solidify. Place the prepared agarose gel into the electrophoresis tank, and use a pipette to add the PCR products into the sample wells for electrophoresis.

[0051] Table 4 Preparation of 50×TAE (pH 8.5)

[0052]

[0053] The prepared 50×TAE stock solution can be stored at room temperature. When used, dilute it 50 times with distilled water to make it 1×TAE buffer.

[0054] The agarose gel electrophoresis results of the PCR products are as Figure 1 shown. The fragment size is 2193 bp, and lanes 1 and 2 are two replicates.

[0055] 2) Agarose gel recovery

[0056] Cut the target band and place it in a 1.5 mL clean centrifuge tube. Add an equal volume of PN solution and dissolve the gel block by heating at 50 °C. Add 500 μL of equilibration buffer to the adsorption column to equilibrate the column. Then add the dissolved gel solution to the equilibrated adsorption column and let it stand for 5 - 10 min. Centrifuge at 12,000 rpm for 1 min and discard the waste liquid. Add 600 μL of PW to wash the impurities and wash twice. Centrifuge at 12,000 rpm for 2 min to remove all the wash buffer. Air-dry the adsorption column and add 50 μL of ddH 2 O to dissolve the DNA on the adsorption column. Centrifuge at 12,000 rpm for 5 min to collect the purified product.

[0057] The purified target fragment was subjected to sequencing verification. The nucleotide sequence of the OsRGE3 gene is shown in SEQ ID NO:2, and the amino acid sequence of its encoded protein is shown in SEQ ID NO:3.

[0058] Figure 2 For the prediction of the domain of the OsRGE3-encoded protein, OsRGE3 has a Usp domain at the N-terminus, a Pkinase_Tyr domain and a U-box domain at the C-terminus. Figure 3 It is Figure 2 a supplement to the protein sequence of the domain in Figure 4 a homology analysis was performed on other proteins containing the U-box domain in Arabidopsis thaliana and rice.

[0059] Example 2 Analysis of the expression pattern of the OsRGE3 gene

[0060] The expression pattern of the OsRGE3 gene was analyzed by real-time fluorescence quantitative PCR. Specifically, rice tissue samples at different stages were quickly frozen in liquid nitrogen and stored in an ultra-low temperature freezer at -80 °C. The extraction of total RNA from rice and the steps of RNA reverse transcription were referred to Example 1. The obtained cDNA product was diluted 10 times for fluorescence quantitative qRT-PCR. Use Master Mix kit (Promega) to configure the real-time quantitative PCR system [qPCR-F (10 μM), 0.4 μl; qPCR-R (10 μM), 0.4 μl; qPCR Master Mix, 10 μl; cDNA template, 5 μl; RNAase-free Water, 4.2 μl]. Use the CFX96 Real-Time system (Bio-Rad) to perform real-time fluorescence quantitative PCR. The average relative gene expression level was calculated using the 2-ΔΔc(t) method (Livak & Schmittgen, 2001). All reactions were performed with three biological replicates and three technical replicates, and OsActin1 was used as the endogenous reference gene.

[0061] qPCR - OsRGE3 - F: GACTTTGGTAATGTGCCATCC

[0062] qPCR - OsRGE3 - R: GCCTCTGCTTCGTAGGTGAA

[0063] The results are as Figure 5 shown, the OsRGE3 gene is mainly expressed in the main roots during the seedling stage, and is highly expressed in the leaves and roots during the mature stage.

[0064] Example 3 Construction of CRISPR / Cas9 - OsRGE3 Vector

[0065] (1) Primer Design

[0066] According to the CDS sequence of OsRGE3 obtained by sequencing, search for the PAM (i.e., NGG) sequence near its 5' end. The 20 bases in front of NGG plus the corresponding restriction enzyme site are the sequence of primer F, and the reverse complementary sequence plus the corresponding restriction enzyme site is the sequence of primer R. The target site is 20bp in front of NGG ( Figure 6 ). The primer sequences are: Cas9 - F: GGCAGAGAAGGTGTACGTGGCGGT Cas9 - R: AAACACCGCCACGTACACCTTCTC

[0067] (2) Ligation of Intermediate Vector sgRNA

[0068] First, dilute the primers to 100 μM, add them to a 200 μL centrifuge tube in equal proportions, configure a 10 μL system according to the ratio in Table 5, and perform the ligation of the PAM sequence according to the reaction program shown in Table 6. The purpose is to bind the two synthesized strands together. After the reaction, dilute the ligation product 20 times for standby.

[0069] Table 5 PAM Sequence Ligation System

[0070]

[0071] Table 6 PAM Sequence Ligation Program

[0072]

[0073] Secondly, perform the digestion of the sgRNA vector to linearize the vector. Configure it according to the digestion reaction system in Table 7 and digest it in a 37°C water bath for 1 - 2 h.

[0074] Table 7 sgRNA Vector Digestion System

[0075]

[0076] The digested product was subjected to agarose gel electrophoresis and agarose gel recovery to obtain a recovered product, which was ligated with the ligated product diluted in the previous step in the following system, as shown in Table 8.

[0077] Table 8 Ligation system of sgRNA and PAM

[0078]

[0079] After ligation at 25°C for 5 min and then overnight at 4°C, it was transformed into DH5α competent cells (the preparation and transformation process of Escherichia coli DH5α competent cells are as follows). Colony PCR was detected using primers U3-F on the vector and its own R primer (U3-F: AGCACAGGACAGGCGTCTTCT, Cas9-R: AAACACCGCCACGTACACCTTCTC), and the sample was sent for sequencing to determine the correct cloned sgRNA intermediate vector.

[0080] ① Preparation of Escherichia coli DH5α competent cells

[0081] Dip an inoculation needle into the preserved DH5α strain and streak it on an LB plate (without antibiotics) at 37°C for 12 - 16 h; pick a single colony and shake it in 5 mL of LB liquid medium without antibiotics at 37°C with shaking for 12 - 16 h; add 200 mL of LB liquid medium (without antibiotics) at a ratio of 1:50 and culture it at 37°C until the OD value reaches 0.6; place the bacterial solution on ice and let it stand in an ice bath for 10 min, centrifuge at 4,000 rpm for 10 min at 4°C to collect the bacteria in a 50 mL sterile centrifuge tube, and discard the supernatant; add 20 mL of pre-cooled 0.1 mol / L CaCl 2 solution to resuspend the cells; incubate in an ice bath for 30 min, centrifuge at 4,000 rpm for 10 min at 4°C, and discard the supernatant; add 3 - 5 mL of pre-cooled 0.1 mol / L CaCl 2 containing 15% glycerol to resuspend the cells; aliquot 100 μL into 1.5 mL sterile centrifuge tubes, quickly freeze in liquid nitrogen, which is the Escherichia coli DH5α competent cells, and store them in a -80°C refrigerator.

[0082] ② Transformation of Escherichia coli DH5α competent cells

[0083] Take the competent cells and thaw them on ice, add the ligated product, mix gently, and incubate in an ice bath for 30 min; heat shock at 42°C for 90 s, and quickly ice bath for 2 - 3 min; add 500 μL of sterile antibiotic-free LB liquid medium, and incubate at 37°C with shaking at 180 rpm in a shaker for 45 - 60 min to recover the bacteria; according to the experimental requirements, pipette an appropriate amount of the transformed competent cells onto an LB solid plate containing the corresponding antibiotic, and spread the cells evenly with a glass spreader; incubate at 37°C upside down for 12 - 16 h.

[0084] (3) Ligation of the final Cas9-OsRGE3 construct

[0085] Perform LR recombination on the correctly sequenced intermediate vector Entry clone and the Cas9 final destination vector. The recombination system is shown in Table 9, and react at 25 °C for 1 h.

[0086] Table 9 LR recombination system of sgRNA and Cas9 final construct

[0087]

[0088] Add 1 μL of proteinase K and react at 37 °C for 10 min to terminate the reaction. Ligate overnight at 4 °C, transform into DH5α competent cells, detect colony PCR using the primers U3-F on the vector and the self R primer, send the sample for sequencing, and save the plasmid vector with correct sequencing.

[0089] Example 4 OsRGE3 knockout mutants

[0090] 1. Preparation and transformation of Agrobacterium competent cells

[0091] (1) Preparation of Agrobacterium competent cells

[0092] Dip an inoculation needle into the stored EHA105 strain and streak it on an LB solid plate. Incubate at 28 °C for 2 d; pick a newly grown single colony into 5 mL of LB liquid medium and culture it at 28 °C in a shaker at 200 rpm for 12 - 16 h; transfer the shaken Agrobacterium to 50 mL of LB liquid medium and culture it at 28 °C in a shaker at 200 rpm for 3 - 5 h until OD 600 = 0.4 - 0.5. After ice-bathing for 30 min, collect the cells by centrifugation at 5,000 rpm for 10 min at 4 °C using a 50 mL sterile centrifuge tube; discard the supernatant, add 1 mL of 0.1 M CaCl 2 solution containing 15% glycerol to resuspend the cells, and ice-bathe for 30 min; aliquot 100 μL into 1.5 ml sterile centrifuge tubes, quickly freeze in liquid nitrogen, and store at -80 °C to obtain Agrobacterium competent cells.

[0093] (2) Agrobacterium transformation

[0094] Thaw the Agrobacterium competent cells on ice, add 1 μL of the plasmid constructed in Example 3, ice-bathe for 5 min in sequence, quickly freeze in liquid nitrogen for 5 min, water-bathe at 37 °C for 5 min, ice-bathe for 2 min, add 800 μL of LB liquid medium in a laminar flow hood, and culture at 28 °C in a shaker at 200 rpm for 3 - 4 h; centrifuge at 5,000 rpm for 1 min to collect the cells, spread them on an LB solid plate, and culture at 28 °C for 30 - 36 h.

[0095] 2. Rice genetic transformation

[0096] Pick the positive colonies transformed by Agrobacterium, culture them with shaking at 28 °C, and preserve the strains.

[0097] Carry out steps such as co-cultivation, screening, differentiation, rooting, and acclimatization in sequence to obtain transgenic rice seedlings.

[0098] For the T 0 -generation OsRGE3 knockout transgenic plants, take individual plant samples and extract genomic DNA. Using the wild-type rice Nipponbare variety as a control, perform PCR amplification on the OsRGE3 knockout mutant transgenic materials. The amplified fragment is about 498 bp. After gel extraction and recovery of the amplified product, sequence it. The nucleotide sequences of the identification primers are as follows: F: 5’-AGGGAGGCAACAAGAAGAGA-3’, R: 5’-AATTGAGTTGGCCTCGATTG-3’.

[0099] As shown by the sequencing results Figure 7 two types of knockout materials were obtained: The Cas9-N1 line is a homozygous mutant with a single-base T insertion (CTTCTCCGGCGAGAAGGTGTACGTGGCTGGTGGGGGAG), and Cas9-N2 is a homozygous mutant lacking seven bases GGCGGTG (CTTCTCCGGCGAGAAGGTGTACGTGG-------GGAGGAG).

[0100] Example 5 Cultivation of transgenic rice seedlings and analysis of root phenotypes

[0101] 1. Cultivation of rice seedlings

[0102] 1) Germination of rice seeds

[0103] First, disinfect rice seeds with 20% sodium hypochlorite solution [the purchased stock solution is mixed with water at 1:5 (V / V)] for 30 min, and then rinse with sterile water 6 - 8 times until there is no pungent smell; place the disinfected seeds in a petri dish lined with moist filter paper and culture them in the dark at 30 °C for 2 - 3 d, observing and changing the water in the petri dish daily.

[0104] 2) Cultivation of rice seedlings

[0105] Lay the germinated seeds on the gauze floating on the foam board, culture them with clear water for 3 - 4 d, with 1 / 4 full nutrient solution for 2 d, 1 / 3 full nutrient solution for 2 d, 1 / 2 full nutrient solution for 2 d, and then culture them with full nutrient solution. The formula of the hydroponic nutrient solution refers to methods such as the nutrient solution of the International Rice Research Institute.

[0106] Elements required for the nutrient solution:

[0107] ①Macronutrients: nitrogen, phosphorus, potassium, calcium, magnesium.

[0108] ②Micronutrients: silicon, iron, manganese, boron, zinc, copper.

[0109] ③Organic acid: citric acid.

[0110] Preparation of stock solutions of each nutrient element:

[0111] The micronutrients Mn, Mo, B, Zn, Cu and citric acid (monohydrate) need to be dissolved separately and then mixed with 100 ml of concentrated H 2 SO 4 and made up to 2 L with distilled water. Weigh the drugs containing manganese, boron, zinc, copper and citric acid according to a certain proportion, dissolve them separately and then mix them, then mix with concentrated sulfuric acid and make up the volume with distilled water. Note that when adding concentrated sulfuric acid, the concentrated sulfuric acid needs to be added to the mixed solution and stirred while adding to prevent danger caused by excessive temperature due to heat release when concentrated sulfuric acid is mixed with water. For the preparation of Fe, dissolve 3.722 g of EDTA-Na 2 and 2.7802 g of FeSO 4 .7H 2 O. Heat the EDTA-Na 2 solution on an electric furnace to 70 °C and dissolve it, then slowly add the FeSO 4 .7H 2 O solution. The solution turns brownish-yellow and is placed in an oven at 70 °C for 2 h. The preparation of the stock solutions of each element is shown in Table 10 below.

[0112] Table 10 Preparation of stock solutions

[0113]

[0114] 3) Preparation of nutrient solution

[0115] The preparation of the nutrient solution is as shown in Table 11 below.

[0116] Table 11 Taking the preparation of 4 L of nutrient solution as an example

[0117]

[0118] 2. Statistical analysis of rice root phenotypes

[0119] To determine the effect of the loss of function of the OsRGE3 gene on the root length during rice germination, the wild-type rice variety Nipponbare was used as a control to analyze the root length growth of the OsRGE3 gene function loss mutants Cas9-N1 and Cas9-N2 during seed germination. The wild-type rice and the Cas9-OsRGE3 mutant materials were normally cultured in the same environment. The root phenotypes were observed daily, and root traits such as root length were statistically analyzed, and then biological statistical analysis was carried out.

[0120] The results are as Figures 8 - 9 shown. After 3 days of germination, the root lengths of the OsRGE3 gene function loss mutants Cas9-N1 and Cas9-N2 were significantly longer than that of the wild-type Nipponbare (P < 0.01), about 40%-45% longer, indicating that reducing the expression of the OsRGE3 gene can significantly promote the elongation of young roots during rice germination.

[0121] Example 6 Mannitol simulation drought treatment test after germination

[0122] D-mannitol with concentrations of 0.1 M and 0.3 M was prepared to treat the OsRGE3 gene function loss mutants Cas9-N1 and Cas9-N2 with consistent germination and the wild-type Nipponbare. The phenotypes were observed and photographed after 2 days of treatment.

[0123] The results are as Figure 10 shown. Under the treatment of 0 M D-mannitol, the root length of the Cas9-OsRGE3 knockout material was longer than that of the wild-type Nipponbare after 2 days; under the treatment of 0.1 M D-mannitol, the root length of the Cas9-OsRGE3 knockout material was also longer than that of the wild-type Nipponbare after 2 days, but the overall length was shorter compared with that under 0 M D-mannitol treatment; under the treatment of 0.3 M D-mannitol, the root length of the Cas9-OsRGE3 knockout material was also longer than that of the wild-type Nipponbare after 2 days, and the overall length was significantly shorter compared with that under 0 M D-mannitol treatment. The above results indicate that the Cas9 material shows a more drought-resistant phenotype under the condition of D-mannitol simulation drought treatment. <110> Henan Agricultural University <120> Rice OsRGE3 Gene, Its Encoded Protein and Application <160> 9 <170> PatentIn version 3.5 <210> 1 <211> 4855 <212> DNA <213> Rice (Oryza sativa L.) <221> OsRGE3 gene <400> 1 atggccacgg cgggctcccc ctctccgtac cccggtgatt cgccggagcc gtccttctcc 60 ggcgagaagg tgtacgtggc ggtgggggag gagtccagca ggggcacgct gctgtgggcg 120 ctgcacaagt tcccccaagg caccgccttc gtgctgctcc atgtctactc ccctcccaac 180 ttcctcccca tccgtacgca tccctcttcc tcctacctac actagtacta gagtctagat 240 tgatgatccg atctaccacg attgtattgg cacagatcgt ctagtttctt tgtccagttc 300 cctcaatgac tccaaattta caaccttttt ccccacacac taaatcattt ctctctcttt 360 ttttaatgca ccattttacc ccctacgttt ttacaatcga ggccaactca attcattcag 420 attgagtttg gcttccattt tgtttacatc tctggcttcc tcttagagtt ttcagtccat 480 gtatgtgtat ggctgcaaat gcttatgcaa cctccatcca ttgtcgtgtg cagtcggagc 540 caagattccc gccggccagc tgcgagagca ggagctgatt gcacacaaga agatgaacct 600 gcaaagaatc agtgacaact tggatcaata ccaactcata tgcgcgcagc agaaggtctg 660 cctgtttccc actttattga actaaaattc agttgtattc acatgtaaag gccaacacgg 720 atgtatcaat tcattggttt tgtttgttgc aaaatgtcat ccgtaatctc gattgatact 780 tcactgtgct attcatctct aggtacaagc tgagaaattg gtggttgaat cagatgatgt 840 tgcatacgga ttggtggacg tcatctctga gcataatgtt tccatgcttg taatgggggc 900 cgcagatgat aagcactata caaagtacgc atgtgccaaa gcttggaata cttttatgca 960 tttttatccg tagtagtagt aactatgatg aaacactgtg atcacagtgg atgctagtaa 1020 ggaaccatgc ttgggagaag tgttggtttt tgtctactta gctaaataaa ttcttcaaga 1080 taattaaatg ttaacactaa ttgcttgcac cttggttttc tgggaagcaa acttagtgtt 1140 tgtactgctt cagtacgttc taaaatctaa atagtaatct ttgccctatt aattctctaa 1200 aacctaactc cttgtttcaa gagttcagga aaatgaaggt tctgaaatcc aggaaagcac 1260 gagttgtaga acagcatgca gatcatttct gcaaaatatg gttcatttgc aaaggcacac 1320 tggtatactg taggtatggt tgtaagctga tcatacactt cactttgttc ctacattacg 1380 gactttccag cctgcatcca tttgcattta ctatgttctc ttcctttgta ttctctacac 1440 taggaaggct gctccctttg gccatgatgt gatgcaggac tgtaggcaaa gtgctacttc 1500 tgcacaatgt tcagtggaga gatcgagtag cttgtcagag atttggtgtg tttcaaacac 1560 atggctacac aaactaaacc tcgaaccaca tatcgagaca actagttcag acagatactc 1620 tgataaggaa aaggtaagca caattacgtc gatgttggat ctgattaaga tcactaattg 1680 atctgtccac attgcatcct cacttgaaat ggatccatga tggagcattt gcttgataca 1740 tacataagtt agaggatcat tacatggtat gccattttgt ctaatagctc accagtttgt 1800 acttttgatc atcttatcta gttttccttt gaattttggg agctctctaa tatcttaatg 1860 gcagtgctct cacaaatttt gatgcatgaa taagctaccc aatcttatgc aggaagatac 1920 taaagagcgt ggtgagtctg acaatgagct ccagcatata cccatgcagt tagagagagt 1980 aagacaagaa gcttatgagg agaaatgtag gcgtgagaaa gcagagcagg agttatttga 2040 ggctctccag aaagtaagaa tagattaatt atatttatct ctcatataat gtgtgctata 2100 cttaatggtt attctaatga taatatggct gcatgccaat gagagcagag aaattcttcg 2160 tactgtccat gtaaaaaact ttcatgattg ttatactcta tatcgtggag tataaatctg 2220 gaaatgatgt tttggataag tgatacctac agatttaaac aaaatccttg gtctcacatt 2280 taatatcacc aacaggtgca ggtatcagag aatttgtact ttggagaact gaagcaaaag 2340 aatgaaatag aggtaaaatt ggcaacaaca atggaggaag ttgacaggct tgcaagaaca 2400 gctgatgaac ttgctgcaaa atttcaagag caatgtgaga agatattggt cctagagaag 2460 cgaagcgccc attctgaccg tattatcaag gatcttatgt tgcagcgtga caaagcagta 2520 agagaggcag aagcaatacg tgtaaaaaat ggagagtcta ctgcaattgc ggatagaaca 2580 attcccatta cagagctatc gatatcagag attaaggagg caaccagcaa ctttgatcac 2640 tcatcgaagg ttggggaaag tgtttatgga agtgtatata agggacttct tcggcaaaca 2700 aatgtggctg taaagaagtt gaatcctgaa agcacagagt cactgtcaca gttcagtcat 2760 gaggtaaaag tttttgttct agttatatac ttaccttcta taaacttgat tgacattttg 2820 ttggtccaaa taaactgttg tatttcagac agttaagttg ttcttgctga taatttacag 2880 gtggaaatcc ttagcagggt gcgacatccg aatcttgtaa ctcttatagg ggcatgcaag 2940 gatgcccgag ctcttgtcta tgaatacatg cccaatggaa gcttagatga ccgcttggct 3000 tgcaaggaca attcaaagcc tcttagttgg cagttgcgta cccgcatcgc ttccaatatt 3060 tgttctgcac tgatttttct ccattccaat aaaccccaca gcattgttca cagtgacttg 3120 aaagcatcta acattcttct tgatggaaat aatgtggcta agcttagtgg ttttggtgtg 3180 tgccgaatgt taactgatga attcaaggcc acaaccactc tataccgcca tacccaccca 3240 aaaggaactt ttgtgtacat tgatcctgaa tacgctattt ctggtgatct gacaccccta 3300 tctgatgtat attcttttgg tatcatactc ctgcgactct tgactggaag atcaggattt 3360 ggtcttttga aagatgtgca acgggcagta gcaaagggtt gcttgcaagc aatattggat 3420 tcatcagctg gagactggcc tcttatgcat gctgagcagt tgtctcgggt aggcctaaga 3480 tgctgtgaaa tcagaagaaa aaaccgtcct gacctgcaaa cagaggtttg gacagtactt 3540 gaaccaatgt tgaggtctgc ttcctctatg ctatgttcat tatcatttaa atcagtatct 3600 gaagactttg gtaatgtgcc atcctacttc atctgtccaa tacaacaggt tagtcatata 3660 tactttactt agtgattatt actccccctt ctctcaaaag tatttcctca ccatgatttc 3720 cttcagactc tcatgtttgg taattggtcc gtctatgtaa tgatatccat ttctattttt 3780 tttaatatac tagtctctaa aggataacta gatgaaatat tttttgtata caataagaga 3840 aatcaaaggg tgacatttga ttggatttaa attcctcttg cgcttctgct tccatttatg 3900 attcctgatg ttatttgatt aactccaaat tactcctgag cttctgtttc catttagtat 3960 gattcttagt aattttagag aaagtcagtc aattgtttgc ctggacagca gttgagatat 4020 cagttctgca aacatctctg tgaacttcaa gttatgggag ctctcagttc ttgttactaa 4080 tgaaatgacc attgtaaact actgtttgta tgtgtgtttc tcaaccctga tgcaatgaca 4140 caccaaattt tttgtgtgtt acctaaggaa agataatcag ttttcttctc ccttggttca 4200 cctgtgcatt ttatgcattg caggatgtca tgagggaccc tttaattgct gcagatggtt 4260 tcacctacga agcagaggct ataagagagt ggtttgatag tggtcactat acatcaccca 4320 tgacaaacct cgatctacca caccgtgatc ttttgccgaa ccatgccctc cgttctgcaa 4380 ttcaagaatg gcttcagtca aatgcagatt aatatgtttg gattctcatc atggaaagta 4440 acaatgaaaa ttatgtcata tatcttctga agatacatct cagaccaggg ttaataagca 4500 gaaaccacag gaaaccaaac gtcttgtgtc tttttttgtt ctgaaggaat gactaattaa 4560 aggtatacac acggttgttc ttttcttttc ttttttttag caaaacctgt atgtaaaaaa 4620 tataataaat tcggagctat ctctgctcca tcagtagcat ggtagacatt gtacaggtag 4680 tcacttgtca ctttgtcagt gtagtagaga gttgtgatat ctgagcaata gccaaaaaaa 4740 tgctcagcta gagtgtatgg aagtggaaat acatgtatga atagaactat cagatcagaa 4800 tttcaccatt tataatgtta tcatgcttac gtgttgtaac cattctgatt atata 4855 <210> 2 <211> 2193 <212> DNA <213> Rice (Oryza sativa L.) <221> OsRGE3 gene <400> 2 atggccacgg cgggctcccc ctctccgtac cccggtgatt cgccggagcc gtccttctcc 60 ggcgagaagg tgtacgtggc ggtgggggag gagtccagca ggggcacgct gctgtgggcg 120 ctgcacaagt tcccccaagg caccgccttc gtgctgctcc atgtctactc ccctcccaac 180 ttcctcccca tcctcggagc caagattccc gccggccagc tgcgagagca ggagctgatt 240 gcacacaaga agatgaacct gcaaagaatc agtgacaact tggatcaata ccaactcata 300 tgcgcgcagc agaaggtaca agctgagaaa ttggtggttg aatcagatga tgttgcatac 360 ggattggtgg acgtcatctc tgagcataat gtttccatgc ttgtaatggg ggccgcagat 420 gataagcact atacaaagaa ggctgctccc tttggccatg atgtgatgca ggactgtagg 480 caaagtgcta cttctgcaca atgttcagtg gagagatcga gtagcttgtc agagatttgg 540 tgtgtttcaa acacatggct acacaaacta aacctcgaac cacatatcga gacaactagt 600 tcagacagat actctgataa ggaaaaggaa gatactaaag agcgtggtga gtctgacaat 660 gagctccagc atatacccat gcagttagag agagtaagac aagaagctta tgaggagaaa 720 tgtaggcgtg agaaagcaga gcaggagtta tttgaggctc tccagaaagt gcaggtatca 780 gagaatttgt actttggaga actgaagcaa aagaatgaaa tagaggtaaa attggcaaca 840 acaatggagg aagttgacag gcttgcaaga acagctgatg aacttgctgc aaaatttcaa 900 gagcaatgtg agaagatatt ggtcctagag aagcgaagcg cccattctga ccgtattatc 960 aaggatctta tgttgcagcg tgacaaagca gtaagagagg cagaagcaat acgtgtaaaa 1020 aatggagagt ctactgcaat tgcggataga acaattccca ttacagagct atcgatatca 1080 gagattaagg aggcaaccag caactttgat cactcatcga aggttgggga aagtgtttat 1140 ggaagtgtat ataagggact tcttcggcaa acaaatgtgg ctgtaaagaa gttgaatcct 1200 gaaagcacag agtcactgtc acagttcagt catgaggtgg aaatccttag cagggtgcga 1260 catccgaatc ttgtaactct tataggggca tgcaaggatg cccgagctct tgtctatgaa 1320 tacatgccca atggaagctt agatgaccgc ttggcttgca aggacaattc aaagcctctt 1380 agttggcagt tgcgtacccg catcgcttcc aatatttgtt ctgcactgat ttttctccat 1440 tccaataaac cccacagcat tgttcacagt gacttgaaag catctaacat tcttcttgat 1500 ggaaataatg tggctaagct tagtggtttt ggtgtgtgcc gaatgttaac tgatgaattc 1560 aaggccacaa ccactctata ccgccatacc cacccaaaag gaacttttgt gtacattgat 1620 cctgaatacg ctatttctgg tgatctgaca cccctatctg atgtatattc ttttggtatc 1680 atactcctgc gactcttgac tggaagatca ggatttggtc ttttgaaaga tgtgcaacgg 1740 gcagtagcaa agggttgctt gcaagcaata ttggattcat cagctggaga ctggcctctt 1800 atgcatgctg agcagttgtc tcgggtaggc ctaagatgct gtgaaatcag aagaaaaaac 1860 cgtcctgacc tgcaaacaga ggtttggaca gtacttgaac caatgttgag gtctgcttcc 1920 tctatgctat gttcattatc atttaaatca gtatctgaag actttggtaa tgtgccatcc 1980 tacttcatct gtccaataca acaggatgtc atgagggacc ctttaattgc tgcagatggt 2040 ttcacctacg aagcagaggc tataagagag tggtttgata gtggtcacta tacatcaccc 2100 atgacaaacc tcgatctacc acaccgtgat cttttgccga accatgccct ccgttctgca 2160 attcaagaat ggcttcagtc aaatgcagat taa 2193 <210> 3 <211> 730 <212> PRT <213> Rice (Oryza sativa L.) <221> OsRGE3 protein <400> 3 Met Ala Thr Ala Gly Ser Pro Ser Pro Tyr Pro Gly Asp Ser Pro Glu 1 5 10 15 Pro Ser Phe Ser Gly Glu Lys Val Tyr Val Ala Val Gly Glu Glu Ser 20 25 30 Ser Arg Gly Thr Leu Leu Trp Ala Leu His Lys Phe Pro Gln Gly Thr 35 40 45 Ala Phe Val Leu Leu His Val Tyr Ser Pro Pro Asn Phe Leu Pro Ile 50 55 60 Leu Gly Ala Lys Ile Pro Ala Gly Gln Leu Arg Glu Gln Glu Leu Ile 65 70 75 80 Ala His Lys Lys Met Asn Leu Gln Arg Ile Ser Asp Asn Leu Asp Gln 85 90 95 Tyr Gln Leu Ile Cys Ala Gln Gln Lys Val Gln Ala Glu Lys Leu Val 100 105 110 Val Glu Ser Asp Asp Val Ala Tyr Gly Leu Val Asp Val Ile Ser Glu 115 120 125 His Asn Val Ser Met Leu Val Met Gly Ala Ala Asp Asp Lys His Tyr 130 135 140 Thr Lys Lys Ala Ala Pro Phe Gly His Asp Val Met Gln Asp Cys Arg 145 150 155 160 Gln Ser Ala Thr Ser Ala Gln Cys Ser Val Glu Arg Ser Ser Ser Leu 165 170 175 Ser Glu Ile Trp Cys Val Ser Asn Thr Trp Leu His Lys Leu Asn Leu 180 185 190 Glu Pro His Ile Glu Thr Thr Ser Ser Asp Arg Tyr Ser Asp Lys Glu 195 200 205 Lys Glu Asp Thr Lys Glu Arg Gly Glu Ser Asp Asn Glu Leu Gln His 210 215 220 Ile Pro Met Gln Leu Glu Arg Val Arg Gln Glu Ala Tyr Glu Glu Lys 225 230 235 240 Cys Arg Arg Glu Lys Ala Glu Gln Glu Leu Phe Glu Ala Leu Gln Lys 245 250 255 Val Gln Val Ser Glu Asn Leu Tyr Phe Gly Glu Leu Lys Gln Lys Asn 260 265 270 Glu Ile Glu Val Lys Leu Ala Thr Thr Met Glu Glu Val Asp Arg Leu 275 280 285 Ala Arg Thr Ala Asp Glu Leu Ala Ala Lys Phe Gln Glu Gln Cys Glu 290 295 300 Lys Ile Leu Val Leu Glu Lys Arg Ser Ala His Ser Asp Arg Ile Ile 305 310 315 320 Lys Asp Leu Met Leu Gln Arg Asp Lys Ala Val Arg Glu Ala Glu Ala 325 330 335 Ile Arg Val Lys Asn Gly Glu Ser Thr Ala Ile Ala Asp Arg Thr Ile 340 345 350 Pro Ile Thr Glu Leu Ser Ile Ser Glu Ile Lys Glu Ala Thr Ser Asn 355 360 365 Phe Asp His Ser Ser Lys Val Gly Glu Ser Val Tyr Gly Ser Val Tyr 370 375 380 Lys Gly Leu Leu Arg Gln Thr Asn Val Ala Val Lys Lys Leu Asn Pro 385 390 395 400 Glu Ser Thr Glu Ser Leu Ser Gln Phe Ser His Glu Val Glu Ile Leu 405 410 415 Ser Arg Val Arg His Pro Asn Leu Val Thr Leu Ile Gly Ala Cys Lys 420 425 430 Asp Ala Arg Ala Leu Val Tyr Glu Tyr Met Pro Asn Gly Ser Leu Asp 435 440 445 Asp Arg Leu Ala Cys Lys Asp Asn Ser Lys Pro Leu Ser Trp Gln Leu 450 455 460 Arg Thr Arg Ile Ala Ser Asn Ile Cys Ser Ala Leu Ile Phe Leu His 465 470 475 480 Ser Asn Lys Pro His Ser Ile Val His Ser Asp Leu Lys Ala Ser Asn 485 490 495 Ile Leu Leu Asp Gly Asn Asn Val Ala Lys Leu Ser Gly Phe Gly Val 500 505 510 Cys Arg Met Leu Thr Asp Glu Phe Lys Ala Thr Thr Thr Leu Tyr Arg 515 520 525 His Thr His Pro Lys Gly Thr Phe Val Tyr Ile Asp Pro Glu Tyr Ala 530 535 540 Ile Ser Gly Asp Leu Thr Pro Leu Ser Asp Val Tyr Ser Phe Gly Ile 545 550 555 560 Ile Leu Leu Arg Leu Leu Thr Gly Arg Ser Gly Phe Gly Leu Leu Lys 565 570 575 Asp Val Gln Arg Ala Val Ala Lys Gly Cys Leu Gln Ala Ile Leu Asp 580 585 590 Ser Ser Ala Gly Asp Trp Pro Leu Met His Ala Glu Gln Leu Ser Arg 595 600 605 Val Gly Leu Arg Cys Cys Glu Ile Arg Arg Lys Asn Arg Pro Asp Leu 610 615 620 Gln Thr Glu Val Trp Thr Val Leu Glu Pro Met Leu Arg Ser Ala Ser 625 630 635 640 Ser Met Leu Cys Ser Leu Ser Phe Lys Ser Val Ser Glu Asp Phe Gly 645 650 655 Asn Val Pro Ser Tyr Phe Ile Cys Pro Ile Gln Gln Asp Val Met Arg 660 665 670 Asp Pro Leu Ile Ala Ala Asp Gly Phe Thr Tyr Glu Ala Glu Ala Ile 675 680 685 Arg Glu Trp Phe Asp Ser Gly His Tyr Thr Ser Pro Met Thr Asn Leu 690 695 700 Asp Leu Pro His Arg Asp Leu Leu Pro Asn His Ala Leu Arg Ser Ala 705 710 715 720 Ile Gln Glu Trp Leu Gln Ser Asn Ala Asp 725 730 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <221> OsRGE3-F <400> 3 atggccacgg cgggctcc 18 <210> 4 <211> 22 <212> DNA <213> Artificial sequence <221> OsRGE3-R <400> 4 atctgcattt gactgaagcc at 22 <210> 5 <211> 24 <212> DNA <213> Artificial sequence <221> Cas9-F <400> 5 ggcagagaag gtgtacgtgg cggt 24 <210> 6 <211> 24 <212> DNA <213> Artificial sequence <221> Cas9-R <400> 6 aaacaccgcc acgtacacct tctc 24 <210> 7 <211> 21 <212> DNA <213> Artificial sequence <221> U3-F <400> 7 agcacaggac aggcgtcttc t 21 <210> 8 <211> 20 <212> DNA <213> Artificial sequence <221> Identification primer F <400> 8 agggaggcaa caagaagaga 20 <210> 9 <211> 20 <212> DNA <213> Artificial sequence <221> Identification primer R <400> 9 aattgagttg gcctcgattg 20

Claims

1. OsRGE3 The application of the gene or OsRGE3 protein is any of the following: 1) Application in promoting root growth during rice germination period; 2) Application in improving drought tolerance of rice; OsRGE3 The nucleotide sequence of the gene is shown in SEQ ID NO: 1 or SEQ ID NO: 2; the amino acid sequence of the OsRGE3 protein is shown in SEQ ID NO: 3; OsRGE3 Gene knockout or downregulation OsRGE3 By regulating the expression level of the gene or the OsRGE3 protein, plants with increased root length during the germination period or plants with improved drought tolerance of rice are obtained.

2. The use according to claim 1, characterized in that: Through CRISPR-Cas9 OsRGE3 Gene knockout.

3. The use according to claim 2, characterized in that: The following steps are also included: extract OsRGE3 The genomic DNA of the gene knockout mutant is amplified by PCR, and the amplified product is sequenced to identify the type of gene mutation; wherein the nucleotide sequence of the primers for PCR amplification is shown in SEQ ID NO: 8-9.

Images