Combination of CBP / p300 bromodomain inhibitor and EGFR inhibitor for the treatment of EGFR mutant NSCLC

Abstract

In particular, the present invention relates to a combination of a CBP / p300 bromodomain inhibitor and an EGFR inhibitor for use in treating patients suffering from non-small cell lung cancer that exhibits oncogenic alterations in EGFR.

Description

Field of the Invention

[0001] The present invention belongs to the field of non-small cell lung cancer (NSCLC) treatment. Therefore, the present invention relates to a combination of a CBP / p300 bromodomain inhibitor and an EGFR inhibitor for treating patients with NSCLC, wherein the NSCLC exhibits oncogenic alterations in EGFR. Background of the Invention

[0003] Non-small cell lung cancer is the most common malignancy and the leading cause of cancer death in the world, with a 5-year survival rate of no more than 5%.

[0004] Hou et al. recently reported that p300 promotes proliferation, migration and invasion by inducing epithelial-mesenchymal transition in non-small cell lung cancer cells (see Hou et al., BMC Cancer (2018) 18: 641). These results were obtained in NSCLC cell lines in which p300 was downregulated by RNAi. Therefore, the expression of p300 protein was downregulated by a nucleic acid-induced mechanism.

[0005] p300 (also known as EP300 and KAT3B) is a large protein with many different domains that binds different proteins, including many DNA-binding transcription factors. Cyclic AMP response element binding protein (CREB) binding protein CBP (also known as CREBBP and KAT3A) is a protein very related to p300, and the two proteins are often referred to as paralogs given their extensive sequence identity and functional similarities.

[0006] CBP / p300 is a lysine acetyltransferase that has been shown to catalyze the attachment of acetyl groups to the lysine side chains of histones and other proteins. It has been proposed that CBP / p300 activates transcription, wherein the mechanism of action appears to be bridging DNA-binding transcription factors to the RNA polymerase mechanism or by helping to assemble a pre-transcription initiation complex. For this purpose, different CBP / p300 domains are considered to interact with different transcription factor arrays assembled on promoters and enhancers for the transcription of different genes (see Dyson and Wright, JBC Vo.291, no.13, pp.6714-6722, Fig. 2).

[0007] One of the multiple domains of CBP / p300 is the bromodomain. The bromodomain was first identified in Drosophila in 1992 and described about 10 years later as a binding module for acetyl-lysine. In humans, there are many bromodomain-containing proteins that can be divided into eight classes based on sequence and structural similarities. It seems that all bromodomain-containing proteins are involved in the regulation of transcriptional programs. Oncogene rearrangements suggest that targeting bromodomain-containing proteins, especially their bromodomains, may be particularly beneficial in the treatment of cancer.

[0008] To this end, several candidate drugs have been developed and are currently undergoing clinical trials that target the so-called "bromodomain and extra-terminal motif" proteins, commonly referred to as BET proteins, which constitute a group of bromodomain-containing proteins. Examples of BET-protein targeted drugs are INCB054329 (Incyte Corporation), ABBV-075 (AbbVie) and I-BET762 (GlaxoSmithKline). There are also drugs that selectively target the bromodomains of CBP and p300, which are part of another group of bromodomain-containing proteins. Such inhibitors include, for example, CCS1477 (Cell Centric), which is currently undergoing clinical studies for the treatment of metastatic castration-resistant prostate cancer and hematological malignancies, or FT-7051 (Forma Therapeutics Inc.), which is currently undergoing studies for the treatment of metastatic castration-resistant prostate cancer.

[0009] In view of the above findings of Hou et al., it is necessary to further elucidate the role of p300, especially its different domains in NSCLC, in order to provide effective NSCLC treatment.

[0010] Purpose and content of the invention

[0011] The inventors of the present invention surprisingly found that CBP / p300 bromodomain inhibitors, i.e., bromodomain inhibitors that selectively bind to the bromodomain of CBP / p300, provide effective treatment for NSCLC showing oncogenic changes in EGFR if administered in combination with an EGFR inhibitor, whereas CBP / p300 bromodomain inhibitors do not affect cell proliferation of NSCLC cells if administered alone. In other words, the inventors surprisingly found that the combination of CBP / p300 bromodomain inhibitors and EGFR inhibitors is more effective in treating NSCLC showing oncogenic changes in EGFR than the effect of either of the two active substances alone on NSCLC showing oncogenic changes in EGFR. Thus, as described above, CBP / p300 bromodomain inhibitors have no effect when administered alone (wherein "no effect" specifically refers to no objective response as defined by the RECIST 1.1 response criteria for target lesions or non-target lesions in a subject), whereas the effect of EGFR inhibitors when administered alone decreases over time, which may be due to the development of resistance to EGFR inhibitors.

[0012] In a first aspect, the present invention relates to a combination of (i) a CBP / p300 bromodomain inhibitor and (ii) an EGFR inhibitor for use in treating a patient with NSCLC, wherein the NSCLC exhibits oncogenic alterations in EGFR. The first aspect may also be referred to as a combination of (i) a CBP / p300 bromodomain inhibitor and (ii) an EGFR inhibitor for use in treating a patient with NSCLC, wherein the NSCLC is characterized by an EGFR mutation profile given in one or more of the labeled indications of the EGFR inhibitor used in the combination, or wherein the NSCLC is characterized by an EGFR mutation profile targeted by the EGFR inhibitor used in the combination in a clinical trial setting.

[0013] In a preferred embodiment of the first aspect, the oncogenic alteration in EGFR results in overactivation of EGFR. Oncogenic alterations in EGFR may even result in constitutively active EGFR (which means that the enzymatic activity of EGFR, ie, the protein kinase activity, is constitutively active).

[0014] In another preferred embodiment of the first aspect, the oncogenic changes in EGFR are caused by: deletions and / or insertions in exon 18, exon 19 or exon 20 of the EGFR gene; duplication of the kinase domain in the EGFR gene; amplification of the EGFR gene; at least one base mutation in the EGFR gene resulting in an amino acid substitution in EGFR, selected from L858R, G719S, G719A, G719C, V765A, T783A, S768I, S768V, L861Q, E709X, L819Q, A750P and combinations thereof; and any combination of the foregoing. Preferably, the oncogenic changes are caused by: a deletion in exon 19 of the EGFR gene; an insertion in exon 20 of the EGFR gene; at least one base mutation in the EGFR gene that results in an amino acid substitution in EGFR, selected from L858R, G719S, G719A, G719C, V765A, T783A, S768I, S768V, L861Q, E709X, L819Q, A750P, and combinations thereof; and any combination of the foregoing. It may also be preferred that the oncogenic changes are caused by: a deletion in exon 19 of the EGFR gene; at least one base mutation in the EGFR gene that results in an amino acid substitution of L858R in EGFR; and combinations thereof. The deletion and insertion in exon 18 of the EGFR gene are particularly deletions that result in the E709-T710 deletion in EGFR and insertions of D at that position in EGFR. Deletions in exon 19 of the EGFR gene are particularly deletions resulting in E746-A750 or L747-E749 deletions in EGFR. Deletions and insertions in exon 19 of EGFR are particularly deletions resulting in L747-A750 deletions in EGFR and insertion of P at this position in EGFR, or deletions resulting in L747-T751 deletions in EGFR and insertion of S at this position in EGFR. The insertion in exon 20 of the EGFR gene is particularly an insertion that results in an amino acid (meaning any amino acid or X) being inserted into a position between two amino acids in EGFR, the two amino acids being selected from D761-E762, A763-Y764, Y764-V765, A767-S768, S768-V769, V769-D770, D770-N771, N771-P772, P772-H773, H773-V774, V774-C775, V765-M766 and a combination thereof. Most preferably, the oncogenic change is caused by a deletion in exon 19 of the EGFR gene (particularly a deletion that results in a deletion of E746-A750 or L747-E749 in EGFR); at least one base mutation in the EGFR gene that results in an amino acid substitution of L858R or A750P in EGFR and a combination thereof.It is also highly preferred that the oncogenic alteration is caused by a deletion in exon 19 of the EGFR gene or at least one base mutation in the EGFR gene that results in the amino acid substitution L858R in EGFR. When "X" is referred to herein as an amino acid, "X" represents any amino acid (but of course an amino acid that differs from the wild-type amino acid at the corresponding position, if applicable, such as E709X).

[0015] In one embodiment of the first aspect, the non-small cell lung cancer does not show additional resistance changes in EGFR. Therefore, the combination used in the present invention will be used as a first-line treatment, and the EGFR inhibitor in the combination can be any EGFR inhibitor used (or indicated for) treatment of NSCLC showing oncogenic changes in EGFR.

[0016] In another embodiment of the first aspect, non-small cell lung cancer also exhibits resistance changes in EGFR. Resistance changes in EGFR can be caused in particular by at least one base mutation in the EGFR gene, which causes amino acid substitutions selected from T790M, C797X (mainly C797S), L792X, G796X, L718Q, L718V, G724S, D761Y, V834L, T854A and combinations thereof in EGFR. It may be preferred that resistance changes in EGFR are caused by at least one base mutation in the EGFR gene, which causes amino acid substitutions selected from T790M, C797X (mainly C797S), L718Q, L718V, T854A and combinations thereof in EGFR. Most preferably, resistance changes in EGFR are caused by at least one base mutation in the EGFR gene, which causes amino acid substitutions of T790M in EGFR. When "X" is referred to herein as an amino acid, "X" means any amino acid (but of course an amino acid that differs from the wild-type amino acid at the corresponding position, if applicable, eg, C797X).

[0017] When the non-small cell lung cancer also exhibits resistance changes in EGFR, the patient was previously treated with a (first) EGFR inhibitor that was initially effective and then became ineffective due to the development of resistance, particularly due to the development of EGFR resistance changes. It is important to understand that in the combination used in the present invention, the EGFR inhibitor in this case is not the previously administered (first) EGFR inhibitor, but rather a (second or third) EGFR inhibitor that was initially therapeutically effective despite at least one resistance change when administered alone. We call this here the "initial therapeutic effect" because a common observation is that further resistance develops to this (second or third) EGFR inhibitor, rendering this (second or third) EGFR inhibitor ultimately ineffective as well. In this case, the combination used in the present invention will be used as a second-line or third-line treatment. For example, gefitinib may have been previously administered (alone as first-line treatment) to a patient with NSCLC that exhibits oncogenic alterations, gefitinib treatment became ineffective over time (typically after about 10 to about 12 months), and EGFR T790M resistance alterations were found to arise in the tumor during gefitinib treatment (e.g., by biopsy and corresponding testing to detect EGFR mutations). In this case, gefitinib would not be used in the combination of the present invention, but in particular, osimertinib has been shown (and indicated) to be effective in treating EGFR T790M mutation-positive non-small cell lung cancer patients whose disease progressed during or after treatment with an EGFR tyrosine kinase inhibitor (TKI).

[0018] In view of the above, in one embodiment, the present invention relates to a combination of (i) a CBP / p300 bromodomain inhibitor and (ii) an EGFR inhibitor for use in treating a patient suffering from NSCLC, wherein the NSCLC exhibits oncogenic alterations in EGFR, with the proviso that, if the NSCLC additionally exhibits resistance alterations in EGFR due to previous administration of an EGFR inhibitor, the EGFR inhibitor of the combination is not the previously administered EGFR inhibitor, but in particular is an EGFR inhibitor that is therapeutically effective despite the resistance alterations in EGFR (i.e., resistance alterations that render the previously administered EGFR inhibitor therapeutically ineffective). One may also refer to the combination for use according to the first aspect of the invention, provided that, if the non-small cell lung cancer additionally exhibits a resistance alteration in EGFR due to previous administration of an EGFR inhibitor, the EGFR inhibitor of the combination is not the previously administered EGFR inhibitor but is an EGFR inhibitor which, if administered alone (despite the resistance alteration), was therapeutically effective in the first treatment cycle, or provided that, if the non-small cell lung cancer additionally exhibits a resistance alteration in EGFR due to previous administration of an EGFR inhibitor, the EGFR inhibitor of the combination is not the previously administered EGFR inhibitor but is an EGFR inhibitor indicated for the treatment of non-small cell lung cancer additionally exhibiting a resistance alteration in EGFR.

[0019] For example, when considering two specific EGFR inhibitors (i.e., "X" and "the EGFR inhibitor in combination"), the above paragraph is understood to relate, in one embodiment, to a combination of (i) a CBP / p300 bromodomain inhibitor and (ii) an EGFR inhibitor for use in treating a patient with NSCLC, wherein the NSCLC exhibits an oncogenic alteration in EGFR, provided that if the non-small cell lung cancer also exhibits a resistance alteration in EGFR due to prior administration of EGFR inhibitor X, then the EGFR inhibitor in combination is not EGFR inhibitor X. Note that the EGFR inhibitor in combination is still therapeutically effective despite the resistance alteration in EGFR (i.e., a resistance alteration that renders the previously administered EGFR inhibitor X therapeutically ineffective).

[0020] In another embodiment of the first aspect, the CBP / p300 bromodomain inhibitor is a small molecule inhibitor. Thus, in such an embodiment, the CBP / p300 bromodomain inhibitor is not a nucleic acid-based inhibitor, such as shRNA or RNAi directed against CBP and / or p300.

[0021] In another embodiment of the first aspect, the EGFR inhibitor is a small molecule inhibitor or an antibody. Therefore, in such an embodiment, the EGFR inhibitor is not an inhibitor based on nucleic acid, such as shRNA or RNAi for EGFR. In another embodiment of the first aspect, the EGFR inhibitor is a small molecule inhibitor. In another embodiment of the first aspect, the EGFR inhibitor inhibits the tyrosine kinase activity of EGFR.

[0022] The CBP / p300 bromodomain inhibitor may be selected from Compound A, Compound C, Compound 00030, Compound 00071, CCS1477, GNE-781, GNE-049, SGC-CBP30, CPI-637, FT-6876, Compound 462, Compound 424, and Compound 515. These compounds are commercially available or publicly disclosed, as further summarized below, or their synthesis and structure are shown in the examples of the present application. It may be preferred that the CBP / p300 bromodomain inhibitor is selected from Compound A, Compound C, CCS1477, GNE-781, GNE-049, CPI-637, Compound 462, Compound 424, and Compound 515.

[0023] The EGFR inhibitor may be selected from ABBV-321, abivertinib, afatinib, alflutinib, almonertinib, apatinib, AZD3759, brigatinib, D0316, D 0317, D 0318, dacomitinib, DZD9008, erlotinib, FCN-411, gefitinib, icotinib, lapatinib, lazertinib, mobocertinib, nazartinib, neratinib, olafertinib, osimertinib, poziotinib, pyrotinib, rezitinib, zivertinib), TAS6417, vandetanib, varlitinib, XZP-5809, amivantamab, CDP1, cetuximab, GC1118, HLX07, JMT101, M1231, necitumumab, nimotuzumab, matuzumab, panitumumab, SCT200, SI-B001, SYN004, zalutumumab, and combinations thereof. The EGFR inhibitor may also be selected from cetuximab, panitumumab, zalutumumab, nimotuzumab, matuzumab, gefitinib, erlotinib, lapatinib, neratinib, vandetanib, necituzumab, osimertinib, afatinib, dacomitinib, brigatinib, pocitinib, and combinations thereof. In a preferred embodiment, the EGFR inhibitor is selected from avitinib, afatinib, afatinib, ametinib, apatinib, AZD3759, brigatinib, D 0316, D 0317, D 0318, dacomitinib, DZD9008, erlotinib, FCN-411, gefitinib, icotinib, lapatinib, lazertinib, mobotinib, nazartinib, neratinib, orafutinib, osimertinib, pocitinib, pyrotinib, ruzitinib, TAS6417, vandetanib, valitinib, XZP-5809 and combinations thereof. In a more preferred embodiment, the EGFR inhibitor is gefitinib or osimertinib. The most preferred EGFR inhibitor is osimertinib.

[0024] In a preferred embodiment of the first aspect, the combination is administered to the patient during each treatment cycle.

[0025] In another embodiment of the first aspect, in a first treatment cycle, an EGFR inhibitor is administered as the sole active agent, and then in subsequent treatment cycles, a CBP / p300 bromodomain inhibitor is additionally administered, wherein in the first treatment cycle (i.e., before administration of the combination of the present invention), no resistance changes in EGFR have occurred in response to administration of the EGFR inhibitor alone. As described above, the development of resistance changes can be assessed by, for example, biopsy and corresponding testing to detect EGFR mutations. Because the development of drug resistance can be prevented when using the combination used according to the present invention, the combination is preferably administered during each treatment cycle.

[0026] In another embodiment of the first aspect, the CBP / p300 bromodomain inhibitor and the EGFR inhibitor are administered as separate dosage forms or contained in a single dosage form. If the CBP / p300 bromodomain inhibitor and the EGFR inhibitor are administered in separate dosage forms, administration in each treatment cycle may be concomitant or sequential. This includes the option of administering the CBP / p300 bromodomain inhibitor first and then the EGFR inhibitor.

[0027] In another embodiment of the first aspect, the treatment results in an extended duration of the therapeutic effect of the EGFR inhibitor compared to the duration of the therapeutic effect of the EGFR inhibitor when administered as the sole active agent. In another embodiment, the treatment results in an increased therapeutic efficacy of the EGFR inhibitor compared to the therapeutic efficacy of the EGFR inhibitor when administered as the sole active agent. In another embodiment, the treatment results in the prevention of resistance to the EGFR inhibitor.

[0028] In another embodiment of the first aspect, the CBP / p300 bromodomain inhibitor is administered at a daily dose of about 1 mg to about 3000 mg, preferably about 10 mg to about 2000 mg, more preferably about 15 mg to about 1000 mg. Preferably, the CBP / p300 bromodomain inhibitor is administered at a daily dose of about 10 mg, about 15 mg, about 20 mg, about 50 mg, about 100 mg, about 250 mg, about 500 mg, about 1000 mg, about 1500 mg, about 2000 mg, about 2500 mg or about 3000 mg. Administration can be intermittent, i.e. not every day, but on the day of administration, the above-mentioned daily dose can be administered. If CCS1477, compound 462, compound 424 or compound 515 are used as CBP / p300 bromodomain inhibitors, the corresponding compound can be administered at a daily dose of about 10 mg to about 600 mg.

[0029] In another embodiment of the first aspect, if the EGFR inhibitor is administered as the only active agent, the EGFR inhibitor is administered at a daily dose within the typical daily dose range (particularly the daily dose of the EGFR inhibitor mentioned in the label, if any). The typical daily dosage (or indicated daily dosage, if any) depends on the specific EGFR inhibitor to be used. Therefore, gefitinib can be administered, for example, in a combination for the present invention at a daily dose of about 50 to about 300 mg, preferably about 100 mg to about 250 mg, and most preferably about 150 mg to about 250 mg. Osimertinib can be administered, for example, in a combination for the present invention at a daily dose of about 5 to about 1500 mg, preferably about 10 mg to about 100 mg, and most preferably about 50 mg to about 80 mg. Erlotinib can be administered, for example, in a combination for the present invention at a daily dose of about 10 mg to about 300 mg, preferably about 25 mg to about 200 mg, and most preferably about 100 mg to about 150 mg. Afatinib can be administered, for example, in a combination for use in the present invention at a daily dose of about 5 mg to about 100 mg, preferably about 10 mg to about 80 mg, most preferably about 20 mg to about 40 mg. Dacomitinib can be administered, for example, in a combination for use in the present invention at a daily dose of about 5 mg to about 100 mg, preferably about 10 mg to about 80 mg, most preferably about 15 mg to about 50 mg.

[0030] In another embodiment of the first aspect, if the EGFR inhibitor is administered as the sole active agent, the EGFR inhibitor is administered at a daily dose lower than the above-mentioned typical daily dose. In other words, if the EGFR inhibitor is not administered as the sole active agent, but is administered in a combination used according to the present invention, the dosage of the EGFR inhibitor may be lower than the dosage when the EGFR inhibitor is administered as the sole active agent. This means, for example, that for the examples given above, the daily amount will be at the lower end of the given ranges or even below these ranges.

[0031] In another embodiment of the first aspect, the present invention relates to a combination of (i) compound A and (ii) an EGFR inhibitor for treating patients with non-small cell lung cancer (NSCLC), wherein the NSCLC exhibits oncogenic changes in EGFR. In this embodiment, it is preferred that the EGFR inhibitor is osimertinib and the oncogenic changes are caused by: a deletion in exon 19 of the EGFR gene (particularly a deletion resulting in a deletion of E746-A750 or L747-E749 in EGFR); at least one of the EGFR genes results in a base mutation of an amino acid substitution L858R or A750P in EGFR; and a combination thereof. In an embodiment in which the EGFR inhibitor is osimertinib, at least one of the EGFR genes results in a base mutation of an amino acid substitution of T790M in EGFR corresponding to a resistance change in EGFR that may or may not be present.

[0032] In another embodiment of the first aspect, the present invention relates to a combination of (i) Compound A or Compound C and (ii) an EGFR inhibitor for treating a patient with non-small cell lung cancer (NSCLC), wherein the NSCLC exhibits oncogenic changes in EGFR. In this embodiment, it is preferred that the EGFR inhibitor is osimertinib and the oncogenic changes are caused by a deletion in exon 19 of the EGFR gene (particularly a deletion resulting in a deletion of E746-A750 or L747-E749 in EGFR); at least one of the EGFR genes results in a base mutation of the amino acid substitution L858R or A750P in EGFR and a combination thereof. In an embodiment in which the EGFR inhibitor is osimertinib, at least one of the EGFR genes results in a base mutation of the amino acid substitution T790M in EGFR corresponding to a resistance change in EGFR that may or may not be present.

[0033] In another embodiment of the first aspect, the present invention relates to a combination of (i) CCS1477 and (ii) an EGFR inhibitor for treating a patient with non-small cell lung cancer (NSCLC), wherein the NSCLC exhibits oncogenic changes in EGFR. In this embodiment, the EGFR inhibitor is preferably osimertinib and the oncogenic changes are caused by a deletion in exon 19 of the EGFR gene (particularly a deletion resulting in a deletion of E746-A750 or L747-E749 in EGFR); at least one of the EGFR genes results in a base mutation of an amino acid substitution L858R or A750P in EGFR and a combination thereof. In an embodiment where the EGFR inhibitor is osimertinib, at least one of the EGFR genes results in a base mutation of an amino acid substitution of T790M in EGFR corresponding to a resistance change in EGFR that may or may not be present.

[0034] In another embodiment of the first aspect, the present invention relates to a combination of (i) GNE-781 or GNE-049 and (ii) an EGFR inhibitor for treating a patient with non-small cell lung cancer (NSCLC), wherein the NSCLC exhibits oncogenic changes in EGFR. In this embodiment, the EGFR inhibitor is preferably osimertinib and the oncogenic changes are caused by a deletion in exon 19 of the EGFR gene (particularly a deletion resulting in a deletion of E746-A750 or L747-E749 in EGFR); at least one of the EGFR genes results in a base mutation of an amino acid substitution L858R or A750P in EGFR and a combination thereof. In an embodiment where the EGFR inhibitor is osimertinib, at least one of the EGFR genes results in a base mutation of an amino acid substitution of T790M in EGFR corresponding to a resistance change in EGFR that may or may not be present.

[0035] In another embodiment of the first aspect, the present invention relates to a combination of (i) CPI-637 and (ii) an EGFR inhibitor for treating a patient with non-small cell lung cancer (NSCLC), wherein the NSCLC exhibits oncogenic changes in EGFR. In this embodiment, the EGFR inhibitor is preferably osimertinib and the oncogenic changes are caused by a deletion in exon 19 of the EGFR gene (particularly a deletion resulting in a deletion of E746-A750 or L747-E749 in EGFR); at least one of the EGFR genes results in a base mutation of an amino acid substitution L858R or A750P in EGFR and a combination thereof. In an embodiment where the EGFR inhibitor is osimertinib, at least one of the EGFR genes results in an amino acid substitution of T790M in EGFR corresponding to a resistance change in EGFR may or may not be present.

[0036] In another embodiment of the first aspect, the present invention relates to a combination of (i) compound 462 or compound 424 or compound 515 and (ii) an EGFR inhibitor for treating patients with non-small cell lung cancer (NSCLC), wherein the NSCLC exhibits oncogenic changes in EGFR. In this embodiment, the EGFR inhibitor is preferably osimertinib and the oncogenic changes are caused by a deletion in exon 19 of the EGFR gene (particularly a deletion resulting in a deletion of E746-A750 or L747-E749 in EGFR); at least one of the EGFR genes results in a base mutation of an amino acid substitution L858R or A750P in EGFR and a combination thereof. In an embodiment where the EGFR inhibitor is osimertinib, at least one of the EGFR genes results in an amino acid substitution of T790M in EGFR corresponding to a resistance change in EGFR may or may not be present.

[0037] In a second aspect, the invention relates to a method of treating non-small cell lung cancer in a patient in need thereof, the method comprising administering to the patient an effective amount of (i) a CBP / p300 bromodomain inhibitor and an effective amount of (ii) an EGFR inhibitor, wherein the non-small cell lung cancer exhibits oncogenic alterations in EGFR.

[0038] In a third aspect, the invention relates to a method of extending the duration of a therapeutic effect of an EGFR inhibitor in a patient in need thereof, the method comprising administering to the patient an effective amount of (i) a CBP / p300 bromodomain inhibitor and an effective amount of (ii) an EGFR inhibitor, wherein the non-small cell lung cancer exhibits an oncogenic alteration in EGFR. In other words, the duration of the therapeutic effect of the EGFR inhibitor (when administered in combination) is extended compared to the duration of the therapeutic effect of the EGFR inhibitor when administered as the sole active agent in the treatment of NSCLC.

[0039] In a fourth aspect, the present invention relates to a method of increasing the therapeutic efficacy of an EGFR inhibitor in a patient in need thereof, the method comprising administering to the patient an effective amount of (i) a CBP / p300 bromodomain inhibitor and an effective amount of (ii) an EGFR inhibitor, wherein the non-small cell lung cancer exhibits an oncogenic alteration in EGFR. In other words, the therapeutic efficacy of the EGFR inhibitor (when administered in combination) is increased compared to the therapeutic efficacy of the EGFR inhibitor administered as the sole active agent in the treatment of non-small cell lung cancer.

[0040] In a fifth aspect, the present invention relates to a method for blocking proliferation of NSCLC cells, the method comprising administering to the cells an effective amount of (i) a CBP / p300 bromodomain inhibitor and an effective amount of (ii) an EGFR inhibitor, wherein the NSCLC cells exhibit oncogenic changes in EGFR.

[0041] In a sixth aspect, the present invention relates to a method for delaying proliferation of NSCLC cells, the method comprising administering to the cells an effective amount of (i) a CBP / p300 bromodomain inhibitor and an effective amount of (ii) an EGFR inhibitor, wherein the NSCLC cells exhibit oncogenic changes in EGFR.

[0042] The embodiments outlined above for the first aspect are equally applicable to the methods of the second to sixth aspects. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1: In EGFR-mutated non-small cell lung cancer (NSCLC) cells, only CBP / p300 inhibitors that bind to the bromodomain (compound A, CCS1477) or the HAT domain (A485) attenuated EGFR inhibitor-induced gene expression, whereas an inhibitor that prevents CBP from interacting with β-catenin (ICG001) did not attenuate EGFR inhibitor-induced gene expression. Two different EGFR inhibitors were used in cell lines carrying or not carrying the resistance-causing caretaker mutation T790M. Examples of regulated genes shown are ALPP (alkaline phosphatase, placental type; A and C) and HOPX (homeodomain-only protein; B and D). Data are from 2 independent experiments using qPCRs performed in duplicate (mean ± SD).

[0045] Figure 2: Only the enantiomer that binds the bromodomain (BRD) of CBP / p300 (Compound A), but not the enantiomer that does not bind the bromodomain of CBP / p300 (Compound B), enhances EGFR inhibitor-mediated inhibition of NSCLC cell proliferation in a concentration-dependent manner. The cell number of EGFR-mutated HCC827 cells was monitored over time. (A) Cells were treated with DMSO alone (filled circles), 20 nM EGFR inhibitor alone (gefitinib; first-generation EGFR inhibitor, open circles), or in combination with the bromodomain-binding enantiomer of the CBP / p300 BRD inhibitor (Compound A). (B) HCC827 cells were exposed to Compounds A and B in the absence of EGFR inhibitors. In the absence of EGFR inhibitors, Compound A lost its effect on the proliferation of EGFR-mutated NSCLC cells and behaved like Compound B that does not bind the bromodomain of CBP / p300. The graphs presented are from one experiment with three replicates per time point and condition (mean ± SD).

[0046] Figure 3: Only inhibitors that bind to the bromodomain of CBP / p300 (Compound A, CCS1477) can enhance the effect of EGFR inhibitors without affecting cell growth in the absence of EGFR inhibitors. Even in the absence of EGFR inhibitors, CBP / p300 inhibitors that inhibit the histone acetyltransferase (HAT) domain of CBP / p300 inhibitor (A485) affect cell proliferation of EGFR-mutant NSCLC cells. (A), (B), (C), (D), and (E) Cell number of the EGFR-mutant NSCLC cell line HCC827 is plotted as a function of drug treatment (symbols in the graph legends) over time [days] using nuclear fluorescence staining. Figure 3 (A) and (B) and (C) Left: Compound A ( Figure 3A )、CCS1477( Figure 3B )、SGC-CBP30( Figure 3C ) or A485 single agent treatment of cells. In the absence of EGFR inhibitors, the compounds ACCS1477, SGC-CBP30 targeting the bromodomain of CBP / p300 did not affect the cell proliferation of EGFR-mutated NSCLC cells. Figure 3 (A) and (B) and (C) right and Figure 3 (D) and (E): Antiproliferative activity of compound A (A) and CCS1477 (CBP / p300 BRD-I) (B) and SGC-CBP30 (C) and compound 00071 (D) and compound 00030 (E) and A485 (CBP / p300 HAT-I) in the presence of 300nM gefitinib (EGFR inhibitor). Compound A and CCS1477 and SGC-CBP30, as well as Compound 00071 and Compound 00030, which target the bromodomain of CBP / p300, enhanced the effect of EGFR inhibitors in EGFR-mutated NSCLC cells, although these compounds had no antiproliferative effect when used without EGFR inhibitors (left). The plotted curves are from one experiment performed in triplicate (mean ± SD).

[0047] Figure 4: (A) Evaluation of the change in HCC827 cell number over time [h]. In the absence of EGFR inhibitors, compound A does not affect the cell proliferation of EGFR-mutated NSCLC cells, but when combined with EGFR inhibitors, compound A prevents the development of resistance. Treatment: DMSO, 1 μM compound A, 300nM gefitinib, or a combination of 300nM gefitinib and 1 μM compound A, according to the legend. The example figure shows the number of cells (mean ± SD) in 6 wells of DMSO and compound A or 24 wells treated with gefitinib or gefitinib + compound A. (B) The number of cells per well treated with gefitinib or gefitinib + compound A for 0 or 22 days, as shown in the dot plot (from 2 experimental plates in A, 48 wells per condition). ****p<0.0001, Kruksal-Wallis test, with Dunn's multiple comparisons. (C) Waterfall plots of wells treated with 300nM gefitinib or 300nM gefitinib+1μM compound A, from 2 plates (48 wells / each condition), as analyzed in (A), showing the response to treatment after 22 days as the logarithmic fold change of the initial cell number on a specific well. The wells are sorted from the highest to the lowest logarithmic fold change. The hollow columns are wells treated with gefitinib, and the solid columns represent the wells treated with gefitinib+compound A. Although cells did not respond to compound A alone, when EGFR inhibitors were combined with compound A, compound A significantly increased the response to EGFR inhibitors.

[0048] FIG5 : Inhibitors binding to the CBP / p300 bromodomain potentiate the effects of third-generation EGFR inhibitors in EGFR-mutant NSCLC cells carrying the T790M-guardian mutation without affecting cell growth in the absence of EGFR inhibitors. (A) NCI-H1975 cell number changes over time [h] were assessed in the presence of DMSO, 50 nM osimertinib, 2 μM compound A, or a combination of 50 nM osimertinib with 2.0, 0.5, or 0.125 μM compound A. In the absence of third-generation EGFR inhibitors, compound A did not affect cell proliferation of EGFR-mutant NSCLC cells carrying the T790M-guardian mutation, but when combined with EGFR inhibitors, compound A prevented the development of drug resistance. (B) Evaluation of NCI-H1975 cell growth in the presence of DMSO, 50 nM osimertinib, 2 μM CCS1477, or a combination of 50 nM osimertinib and 2.0, 0.5, or 0.125 μM CCS1477. In the absence of third-generation EGFR inhibitors, CCS1477 did not affect cell proliferation of EGFR-mutated NSCLC cells carrying the T790M-guardian mutation, but prevented the development of resistance when used in combination with EGFR inhibitors. (Example graphs show duplicate data and time points for each, and logistic growth curve fits were calculated in GraphPad Prism).

[0049] FIG6 : Inhibitors that bind to the bromodomain of CBP / p300 have no effect in vivo when used without an EGFR inhibitor, but when used in combination with an EGFR inhibitor, they enhance the effect of the EGFR inhibitor, providing better tumor control over time and better response rates to treatment. (A) Mean tumor volume (+SEM) of EGFR-mutated NCI-H1975 xenografts is plotted over time. Four different treatment groups are depicted: vehicle (30% PEG300 / H2O; crossed circles; n=4), 20 mg / kg CCS1477 (open circles; n=4), 2 mg / kg osimertinib (filled circles; n=9), or a combination of 2 mg / kg osimertinib and 20 mg / kg CCS1477 (half-filled circles; n=10). When CCS1477 was used without an EGFR inhibitor, it had no effect on tumor growth. However, when it is combined with EGFR inhibitors, the response to treatment increases, and tumor size is better controlled during treatment. (B) The best average response of all 4 treatment groups is shown in the waterfall diagram (vehicle is gray, 20mg / kg CCS1477 is white, 2mg / kg osimertinib is black, and the combination of 2mg / kg osimertinib and 20mg / kg CCS1477 is square). The dotted line indicates that the initial tumor volume has been reduced by 30%. When the bromodomain binding inhibitor (CCS1477) is co-administered with the EGFR inhibitor (osimertinib), the response rate to treatment increases, although there is no response to the use of the bromodomain binding inhibitor (CCS1477) alone.

[0050] Figure 7 : When determining the crystal structure of the bromodomain of human CREBBP in complex with compound 00004, the initial Fo-Fc difference electron density map of the model (with a contour of 4.0σ) was obtained by refining the initial model before modeling the compound with REFMAC5.

[0051] Figure 8 : The combination of Compound A and the EGFR inhibitor gefitinib mediates long-term inhibition of HCC4006 cell proliferation - details are provided in Example 9.

[0052] Fig. 9 : The combination of Compound A, Compound C and structurally unrelated selective CBP / p300 bromodomain inhibitors (CCS1477, FT-6876 and GNE-781) with the EGFR inhibitor osimertinib mediates inhibition of long-term cell proliferation of HCC827 cells - see Example 10 for details.

[0053] Fig.10: The combination of Compound A, Compound C and structurally unrelated selective CBP / p300 bromodomain inhibitors (CCS1477, FT-6876 and GNE-781) with the EGFR inhibitor osimertinib mediates inhibition of long-term cell proliferation of HCC4006 cells - see Example 11 for details.

[0054] FIG11 : Inhibitors that bind to the bromodomain of CBP / p300 have no effect in vivo when used without an EGFR inhibitor, but when used in combination with an EGFR inhibitor, they potentiate the effect of the EGFR inhibitor, providing better tumor control and better response rates to treatment over time. (A) Mean tumor volume (+SEM) of EGFR-mutated NCI-H1975 xenografts is plotted over time. Four different treatment groups are depicted: vehicle (crossed circles), 90 mg / kg Compound C (open circles), 2 mg / kg osimertinib (filled circles), and 2 mg / kg osimertinib in combination with 90 mg / kg Compound C (half-filled circles). (B) The best mean response of all 4 treatment groups is shown in a waterfall plot (grey for vehicle, white for 90 mg / kg Compound C, black for 2 mg / kg osimertinib, and squares for the combination of 2 mg / kg osimertinib and 90 mg / kg Compound C). The dashed line represents a 30% reduction in initial tumor volume - see Example 12 for details. DETAILED DESCRIPTION OF THE INVENTION

[0056] Before describing the present invention in more detail, the following definitions are introduced.

[0057] 1. Definition

[0058] As used in the specification and claims, the singular forms "a", "an" and "the" include the corresponding plural forms as well, unless the context clearly dictates otherwise.

[0059] In the context of the present invention, the term "about" indicates an interval of accuracy that a person skilled in the art will understand to still ensure the technical effect of the feature in question. The term generally indicates a deviation from the indicated numerical value by ±10%, preferably ±5%.

[0060] It should be understood that the term "comprising" is not restrictive. For the purposes of the present invention, the term "consisting of" is considered to be a preferred embodiment of the term "comprising". If a group is defined below as comprising at least a certain number of embodiments, this also means comprising a group that preferably consists only of these embodiments.

[0061] As used herein, the term "CBP / p300 bromodomain inhibitor" refers to a small molecule that strongly and selectively binds to the bromodomain of CBP and the bromodomain of p300. This term is synonymous with the terms "bromodomain inhibitor that selectively binds to the bromodomain of CBP / p300" and "bromodomain inhibitor that selectively inhibits CBP / p300." "Strong binding" in this regard means that when binding to the bromodomain of CBP and the bromodomain of p300, the Kd is less than about 300nM, preferably less than about 100nM. In this regard, "selective binding" refers to binding to any other bromodomain-containing protein or BROMOscan. TM Compared to the Kd for binding to the bromodomain of CBP, the Kd for binding of the small molecule to the bromodomain of CBP and the bromodomain of p300 is at most about 20 times, preferably at most about 30 times, more preferably at most about 50 times, and most preferably at most about 70 times. Preferably, when BROMOscan is performed as shown in Example 4, TM When compared with other bromodomain-containing proteins or bromodomains shown in the DiscoveRx gene symbol in the table of Example 4 of the present application. For comparison, any bromodomain-containing protein or BROMOscan other than CBP and p300 was compared with other bromodomain-containing proteins or bromodomains shown in the table of Example 4 of the present application. TM The lowest Kd of the bromodomains of BRD4 is compared to the highest Kd of CBP and p300. Thus, if for example the Kd of BRD4 (full length, short iso.) is the lowest of all bromodomain-containing proteins or bromodomains except CBP and p300, and is 7100 nM, this is compared to the Kd of CBP (29 nM) (not compared to the Kd of p300, which is 12 nM and therefore lower than the Kd of CBP). In the table of Example 4 below, the above example was performed for Compound A.

[0062] By strong selective binding as described above, the interaction with the interaction partner in the cell, which usually occurs through the bromodomain of CBP / p300, is inhibited, and the molecule is therefore called an "inhibitor". The term "inhibit interaction" means that preferably no interaction occurs between the bromodomain of CBP / p300 and the interaction partner (at least not to a detectable level). However, when a given interaction between the bromodomain of CBP / p300 and the interaction partner (set to 100%) is greatly reduced, for example, to a level of about 50%, about 40%, about 30%, preferably about 20%, more preferably about 10% or most preferably about 5% or less, this reduced interaction is still included in the term "inhibitory interaction". In terms of the medical use of compounds that inhibit interactions, it may not be necessary to completely inhibit the interaction to achieve a sufficient therapeutic effect. Therefore, it is to be understood that the term "inhibit" as used herein also refers to a reduction in interaction that is sufficient to achieve the desired effect.

[0063] The term "EGFR" as used herein refers to the protein "epidermal growth factor receptor". EGFR is a transmembrane protein that is activated by binding to its specific ligand (including epidermal growth factor). Under the activation of its growth factor ligand, EGFR changes from an inactive monomeric form to an active homodimer. In addition to forming homodimers after ligand binding, EGFR can also pair with another member of the ErbB receptor family, such as ErbB2 / Her2 / neu, to form an activated heterodimer. EGFR dimerization stimulates its inherent intracellular protein tyrosine kinase activity. As a result, several tyrosine residues in the C-terminal domain of EGFR undergo autophosphorylation, which triggers downstream activation and signal transduction of several other proteins associated with the phosphorylated tyrosine (through its own phosphotyrosine binding SH2 domain). These downstream signaling proteins initiate several signal transduction cascades, mainly MAPK, Akt and JNK pathways, leading to DNA synthesis and cell proliferation. Mutations that lead to overactivation of EGFR are associated with a variety of cancers, including lung cancer, and may particularly lead to its continued activation, resulting in uncontrolled cell division.

[0064] The term "EGFR inhibitor" as used herein refers to a molecule that can act on EGFR to inhibit the intracellular downstream signaling that ultimately leads to cell proliferation. In this article, the term "inhibit" means that preferably no downstream signaling occurs. However, when a given downstream signal (set to 100%) is greatly reduced, for example, reduced to about 70%, about 60%, about 50%, about 40%, about 30%, preferably about 20%, more preferably about 10% or most preferably about 5% or lower levels, this reduced downstream signaling is still covered by the term "inhibits intracellular downstream signaling". With regard to the medical use of compounds that inhibit downstream signaling, it may not be necessary to completely inhibit signaling to achieve a sufficient therapeutic effect. Therefore, it is to be understood that the term "inhibit" used in this context also refers to a reduction in downstream signaling, which is sufficient to achieve the desired effect. EGFR inhibitors can bind to and thus block the extracellular ligand binding domain of EGFR. The EGFR inhibitor is usually an antibody, in particular a monoclonal antibody, selected from the group consisting of: ervantumab, CDP1, cetuximab, GC1118, HLX07, JMT101, M1231, nexitozumab, nimotuzumab, matuzumab, panitumumab, SCT200, SI-B001, SYN004, zalutumumab and combinations thereof. The EGFR inhibitor can also bind to the cytoplasmic side of the receptor, thereby inhibiting EGFR tyrosine kinase activity. Such EGFR inhibitors are typically small molecules, particularly small molecules selected from the group consisting of avitinib, afatinib, afatinib, ametinib, apatinib, AZD3759, brigatinib, D 0316, D 0317, D 0318, dacomitinib, DZD9008, erlotinib, FCN-411, gefitinib, icotinib, lapatinib, lazertinib, mobotinib, nazartinib, neratinib, orafutinib, osimertinib, pocitrotinib, pyrotinib, ruzitotinib, TAS6417, vandetanib, valitinib, XZP-5809 and combinations thereof.

[0065] As used herein, the term "wherein non-small cell lung cancer exhibits oncogenic changes in EGFR" refers to a non-small cell lung cancer tumor having a mutant form of EGFR, wherein this mutant form of EGFR is associated with the development of non-small cell lung cancer. In other words, the mutant form of EGFR can be considered to be associated with the development of non-small cell lung cancer or lead to the development of non-small cell lung cancer, optionally with the presence of other factors. Due to changes in the EGFR gene, the mutant form of EGFR is present in non-small cell lung cancer tumors, wherein this change is particularly a deletion in the EGFR gene, an insertion in the EGFR gene, a deletion and insertion in the EGFR gene, a duplication in the EGFR gene, an amplification of the EGFR gene and / or at least one base mutation in the EGFR gene that leads to an amino acid substitution in the EGFR. The corresponding specific changes are as described above. Combinations of such changes in the EGFR gene are often found. "Carcinogenic changes in EGFR" are not "resistance changes in EGFR" as defined below.

[0066] As used herein, the term "resistance alteration in EGFR" means that after treatment with an EGFR inhibitor, a NSCLC tumor has acquired further alterations in EGFR (in addition to the oncogenic alterations), wherein this further alteration in EGFR renders the NSCLC resistant to treatment with the EGFR inhibitor (i.e., the EGFR inhibitor used for treatment and to which the NSCLC was initially sensitive). Resistance is mediated by alterations in the EGFR gene, in particular, at least one base mutation in the EGFR gene that results in an amino acid substitution in EGFR. Thus, in contrast to the "oncogenic alteration in EGFR" defined above, the "resistance alteration" is not considered to be associated with or causal for the initial development of non-small cell lung cancer. Rather, it provides a further growth advantage to NSCLC, i.e., it confers resistance to treatment with a previously administered specific EGFR inhibitor (and the inhibitor was effective in treating NSCLC until the tumor's response to the treatment developed into a resistance alteration). A prominent "resistance alteration in EGFR" is the amino acid substitution T790M in EGFR, which is also known as a caretaker mutation. "Resistance alterations in EGFR" are not "oncogenic alterations in EGFR" as defined above. However, both types of alterations can certainly be present in EGFR in non-small cell lung cancer tumors and are frequently detected in patients, and corresponding cell lines exist as model systems (see e.g. cell line NCI-H1975).

[0067] As used herein, the term "hyperactivation" of EGFR means that EGFR is more active, particularly more active in downstream activation and signal transduction, compared to the wild-type state, thereby leading to cancer cell growth.

[0068] The term "small molecule" as used herein refers to a small organic compound with a low molecular weight. The small molecule in the context of the present invention preferably has a molecular weight less than 5000 daltons, more preferably less than 4000 daltons, more preferably less than 3000 daltons, more preferably less than 2000 daltons or even more preferably less than 1000 daltons. In a particularly preferred embodiment, the small molecule in the context of the present invention has a molecular weight less than 800 daltons. In another preferred embodiment, the molecular weight of the small molecule in the context of the present invention is 50 to 3000 daltons, preferably 100 to 2000 daltons, more preferably 100 to 1500 daltons, even more preferably 100 to 1000 daltons.

[0069] The term "treatment" as used herein refers to clinical intervention in order to cure or ameliorate a disease, prevent recurrence of a disease, alleviate symptoms of a disease, reduce any direct or indirect pathological consequences of a disease, achieve a stable (i.e., non-worsening) state of a disease, prevent metastasis, reduce the rate of disease progression, and / or prolong survival compared to expected survival if not receiving treatment.

[0070] As used herein, the term "treatment cycle" refers to a period of time during which drug administration occurs following an initial assessment of a patient's condition, wherein the patient's condition is typically reassessed prior to initiating another treatment cycle.

[0071] The details of the CBP / p300 bromodomain inhibitors mentioned herein are as follows: the structures of compound A, compound C, compound 00030 and compound 00071 are shown in the examples section of the present application. In addition, the synthetic routes of these compounds are shown in the examples section of the present application. CCS1477 is commercially available, for example, at Aobious, and its CAS number is 2222941-37-7. GNE-781 can be purchased at, for example, MCE (MedChemExpress), and its CAS number is 1936422-33-1. GNE-049 can be purchased at companies such as MCE (MedChemExpress), and its CAS number is 1936421-41-8. SGC-CBP30 can be purchased at companies such as MCE (MedChemExpress), and its CAS number is 1613695-14-9. CPI-637 is available from companies such as MCE (MedChemExpress) with a CAS number of 1884712-47-3. FT-6876 is available from companies such as MCE (MedChemExpress) with a CAS number of 2304416-91-7 (FT-6876 is also known as "CBP / p300-IN-8"). The structures of compounds 462, 424, and 515 are described below, where these structures and synthetic routes are given in WO 2020 / 006483 (see in particular compound 424 on pages 33 and 34, compound 462 on pages 42 and 43, and compound 515 on pages 47 and 48):

[0072]

[0073] 2. The inventor’s surprising discovery

[0074] The present inventors have identified novel compounds that bind strongly to the bromodomain of CBP / p300 and have shown that binding to the bromodomain of CBP / p300 is also selective, as it is known that many proteins contain bromodomains.

[0075] CBP / p300 has been identified as the central node of the eukaryotic transcriptional regulatory network, and interacts with more than 400 transcription factors and other regulatory proteins. CBP / p300 regulates crosstalk and interference between many cell signaling pathways, and is targeted by tumor viruses to hijack cell regulatory mechanisms (see Dyson and Wright, supra, page 6714, right column). CBP / p300 is a large protein comprising several domains, which can be derived from Fig. 1 of Dyson and Wright, see above. These domains are NRID, TAZ1, TAZ2, KIX, CRD1, BRD, CH2 (including PHD domain and RING finger domain), HAT, ZZ and NCBD domains. It is obvious from the size of these proteins and their different domains that their cellular functions are very diverse, for example, because CBP / p300 can perform multiple interactions, they can interact with many different interaction partners. The enzymatic activity of CBP / p300 as histone acetyltransferase is located in the HAT domain. As mentioned above, the function of this enzyme mainly involves transcriptional activation. CBP / p300 is also susceptible to post-translational modification, particularly phosphorylation. Their own enzymatic activity and protein are subject to post-translational modification, which brings another level of complexity to the various functions and effects of CBP / p300. Goodman and Smolk, Genes & Development 2000, 14: 1553-1577 summarize well in the introduction that these functions and effects can even be antagonized, wherein it is pointed out that a major contradiction in the function of CBP / p300 is that these proteins seem to be able to promote diametrically opposed cellular processes, and whether CBP / p300 promotes apoptosis or cell proliferation seems to be highly dependent on the environment. For the impact of disease, especially cancer, this means that the environment of specific diseases and specific cancer types will determine how CBP / p300 participates, if they participate.

[0076] In view of the above, it is not surprising that it is not possible to assign a single function to CBP / p300 in cellular processes, which could be affected by, for example, a general "CBP / p300 inhibitor". On the contrary, due to the great level of complexity, dissecting the various functions of CBP / p300 seems to be possible only when studying specific domains of CBP / p300, i.e. by analyzing the effects achieved when, for example, the enzymatic activity of CBP / p300 in its HAT domain is inhibited or when specific interactions with interacting partners are made impossible by blocking (or "inhibiting") certain domains. Moreover, as mentioned above, this has to be seen in the respective context, such as a specific disease or cancer type.

[0077] Therefore, the inventors continue to study their effects in specific environments, where their inhibitors make it impossible to interact with interaction partners through the bromodomains of CBP / p300. At present, it is known that the bromodomains of CBP / p300 recognize acetyl-lysine residues in histone tails and transcription factor IDRs (intrinsic disordered regions), including those of p53 and CREB (see Dyson and Wright, supra, page 6717, right column). In view of the recent publications of Hou et al. (Hou et al., supra), the inventors set out to study the effects of their inhibitors in non-small cell lung cancer (NSCLC) cells. In this publication, it is concluded that p300, as a key tumor promoter, promotes cell proliferation, migration and invasion in non-small cell lung cancer cells. However, when the inhibitor is applied alone, the inventors fail to see the effect of the proliferation of the tested NSCLC cell lines. Therefore, in contrast to other cancer types such as prostate cancer, where CBP / p300 bromodomain inhibitors were unable to exert an effect on the proliferation of NSCLC cells, it remains to be seen whether inhibitors targeting different domains of CBP / p300 will show the effects observed when the intact p300 protein is knocked down by RNAi in NSCLC cells.

[0078] The inventors continued to test CBP / p300 bromodomain inhibitors and surprisingly found that their CBP / p300 bromodomain inhibitors prolonged the effect of EGFR inhibitors in NSCLC cells showing oncogenic changes in EGFR compared to administration of EGFR inhibitors alone. In other words, despite failing to exert an effect alone on the proliferation of NSCLC showing oncogenic changes in EGFR, the inventors' CBP / p300 bromodomain inhibitors showed an effect together with EGFR inhibitors. In other words, over time, the combination of the inventors' CBP / p300 bromodomain inhibitors and EGFR inhibitors resulted in significant proliferation inhibition of the tested EGFR mutant NSCLC cells over time.

[0079] In their experiments, the inventors used NSCLC cell lines deleted in exon 19 of the EGFR gene as oncogenic changes (HCC827 with a deletion in exon 19 resulted in a deletion of E746 to A750 in EGFR, and HCC4006 with a deletion in exon 19 resulted in a deletion of L747 to E749 in EGFR), but there were no resistance changes in EGFR. Therefore, these cell lines can be regarded as a model system for first-line treatment of patients with non-small cell lung cancer whose tumors have "EGFR exon 19 deletion". Gefitinib and osimertinib were used in combination with CBP / p300 bromodomain inhibitors as EGFR inhibitors, respectively (see the following examples). The inventors also used NSCLC cell lines with EGFR that exhibited oncogenic changes L858R and resistance changes T790M (NCI-H1975). It is well known that EGFR T790M can produce resistance to gefitinib treatment, resulting in ineffective gefitinib treatment. Therefore, this cell line can be considered as a model system for second-line treatment of patients with non-small cell lung cancer whose tumors have become resistant to initial EGFR inhibitor treatment. In this cell line, the inventors used only osimertinib and CBP / p300 bromodomain inhibitors (because osimertinib still showed efficacy despite the resistance change T790M in EGFR, which would cause gefitinib to be ineffective). Given the T790M mutation, the combination trial of gefitinib and CBP / p300 bromodomain inhibitors is meaningless.

[0080] The significant proliferation inhibition of the combination observed in long-term incubation in all tested cell lines is particularly noteworthy because - due to the development of resistance - when EGFR inhibitors are used alone, the proliferation inhibition will not remain complete over time. As shown in the data of the experimental part below, this is not only the case when gefitinib is used alone, but also when osimertinib is used alone. Therefore, although osimertinib was initially able to overcome the resistance provided by the mutation EGFR T790M and was therefore initially effective (in contrast to gefitinib, non-small cell lung cancer is already resistant to gefitinib), its resistance to osimertinib also develops over time, eventually causing osimertinib to become ineffective. Considering the results of their CBP / p300 inhibitors, the inventors continued to study whether the observed effects can be equally extended to CBP / p300 inhibitors. To this end, other CBP / p300 bromodomain inhibitors, namely CCS1477, SGC-CBP30, FT-6876 and GNE-781, were tested. It is noteworthy that the structures of the different groups of CBP / p300 inhibitors tested by the inventors are not related, so their common features are only relevant to the effect achieved by these inhibitors, namely, selective inhibition of CBP / p300 bromodomains. The structures of all tested CBP / p300 inhibitors are as follows:

[0081]

[0082]

[0083] It should also be mentioned that the tested EGFR inhibitors gefitinib and osimertinib are very different in structure and action (gefitinib is a "non-covalent inhibitor" and osimertinib is a "covalent inhibitor"), but have a common function of inhibiting EGFR kinase activity. In addition, they are very different in development, namely, the first generation of drugs for the treatment of NSCLC (i.e., gefitinib) and the third generation of drugs for the treatment of NSCLC (i.e., osimertinib).

[0084] In addition, the inventors not only tested a single NSCLC cell line, but also used three different NSCLC cell lines (HCC827, HCC4006 and NCI-H1975). This is particularly important because in vitro experiments performed with a single cell line for a given disease may provide unreliable results, and obtaining the same results in at least two different cell lines for a given disease is a stronger indicator that the obtained results are reliable. In addition, it seems preferable to use NSCLC cell lines that were initially completely inhibited from growing by EGFR inhibitors in this analysis so that the effects of CBP / p300 bromodomain inhibitors can be more reliably analyzed, especially after a few days of treatment. Of course, the results based on xenograft models and consistent with the initial findings when using NSCLC cell lines even better confirm the overall conclusions that can be drawn from the experiments. The inventors also obtained such xenograft data, as shown in the Examples section below.

[0085] 3. Pharmaceutical compositions of the compounds of the present invention

[0086] "CBP / p300 bromodomain inhibitors" and "EGFR inhibitors" are "pharmaceutically active agents" for the uses claimed herein. As mentioned above, they may be present in separate dosage forms or contained in a single dosage form.

[0087] As used herein, "pharmaceutically active agent" refers to a compound that is effective in modulating a response in a patient (i.e., in the body of a human or animal). As used herein, the term "pharmaceutically acceptable excipient" refers to an excipient that is typically included in a pharmaceutical composition, as known to the skilled person. Such excipients are listed below. In view of the definition of "pharmaceutically active agent" given above, a pharmaceutically acceptable excipient can be defined as being inactive.

[0088] If a commercially available EGFR inhibitor is used in combination with a CBP / p300 bromodomain inhibitor, it is preferably administered in separate dosage forms, and the EGFR inhibitor is administered in an approved dosage form and route of administration. The CBP / p300 bromodomain inhibitor can be administered in the dosage form described below, or in a dosage form currently undergoing clinical trials.

[0089] The dosage form used according to the present invention can be formulated for oral, buccal, nasal, rectal, topical, transdermal or parenteral application. Oral application is preferred. Parenteral application is also preferred, including intravenous, intramuscular or subcutaneous administration. The dosage form of the present invention can also be referred to as a preparation or pharmaceutical composition.

[0090] Typically, the pharmaceutical composition according to the present invention may include various pharmaceutically acceptable excipients, which are selected according to the function to be achieved by the composition. "Pharmaceutically acceptable excipients" in the sense of the present invention may be any substance used to prepare a pharmaceutical dosage form, including coating materials, film-forming materials, fillers, disintegrants, materials that change release, carrier materials, diluents, adhesives and other adjuvants. Typical pharmaceutically acceptable excipients include substances such as sucrose, mannitol, sorbitol, starch and starch derivatives, lactose and lubricants such as magnesium stearate, disintegrants and buffers.

[0091] The term "carrier" refers to a pharmaceutically acceptable organic or inorganic carrier substance to which the active ingredient is combined to facilitate application. Suitable pharmaceutically acceptable carriers include, for example, water, saline solutions, alcohols, oils, preferably vegetable oils, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, surfactants, spice oils, fatty acid monoglycerides and diglycerides, petroethral fatty acid esters, hydroxymethylcellulose, polyvinylpyrrolidone, etc. The pharmaceutical composition can be sterilized and, if necessary, mixed with adjuvants such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorants, flavorings and / or aromatic substances, etc., which do not react harmfully with the active compound.

[0092] If the present invention contemplates liquid dosage forms, these dosage forms may include pharmaceutically acceptable emulsions, solutions, suspensions and syrups containing inert diluents commonly used in the art such as water. These dosage forms may contain, for example, microcrystalline cellulose for filling, alginic acid or sodium alginate as a suspending agent, methylcellulose as a viscosity increasing agent and sweeteners / flavoring agents.

[0093] For parenteral use, particularly suitable carriers include solutions, preferably oily or aqueous solutions, and suspensions, emulsions or implants. Pharmaceutical preparations for parenteral administration are particularly preferred and include aqueous solutions in water-soluble forms. In addition, suspensions can be made into suitable oily injection suspensions. Suitable lipophilic solvents or carriers include fatty oils such as sesame oil, or synthetic fatty acid esters such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol or dextran.

[0094] Particularly preferred dosage forms are injection preparations of the pharmaceutical composition of the present invention. Therefore, sterile injectable aqueous or oily suspensions can be prepared, for example, using suitable dispersants, wetting agents and / or suspending agents according to known techniques. Sterile injection preparations can also be sterile injection solutions or suspensions in nontoxic parenteral acceptable diluents or solvents. Acceptable carriers and solvents that can be used are water and isotonic sodium chloride solutions. Sterile oils are also commonly used as solvents or suspension media.

[0095] Suppositories for rectal administration of the pharmaceutical compositions of this invention can be prepared, for example, by mixing the compound with suitable non-irritating excipients such as cocoa butter, synthetic triglycerides and polyethylene glycols which are solid at room temperature but liquid at the rectal temperature so that they melt in the rectum and release the active agent from the suppository.

[0096] For administration by inhalation, pharmaceutical compositions comprising the compounds of the invention may be conveniently delivered in the form of an aerosol spray from a pressurized pack or nebulizer using a suitable propellant, (e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas). In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin, for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

[0097] Oral dosage forms can be liquid or solid, including, for example, tablets, lozenges, pills, capsules, powders, effervescent preparations, dragees and granules. Orally used pharmaceutical preparations can be obtained as solid excipients, optionally grinding the resulting mixture, and processing the granular mixture after adding suitable adjuvants (if necessary) to obtain tablets or dragee cores. Suitable excipients are especially fillers, such as sugars, including lactose, sucrose, mannitol or sorbitol; cellulose preparations, such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidone (PVP). If necessary, disintegrants such as cross-linked polyvinylpyrrolidone, agar or alginic acid or its salt, such as sodium alginate, can be added. Oral dosage forms can be formulated to ensure the immediate release of the active agent or the sustained release of the active agent.

[0098] 4. Further Disclosure and Implementation Plans

[0099] Clinical antitumor effects of receptor tyrosine kinase (RTK) inhibitors and other kinase inhibitors are not durable. Resistance to these inhibitors often develops. More specifically, clinical antitumor effects of EGFR inhibitors (EGFRi) are not durable. Depending on the therapeutic agent and the clinical setting, resistance to EGFR inhibitors typically develops within 9 to 19 months. Therefore, there is a need to develop a cancer treatment paradigm that can prevent cancer patients from developing resistance. Historically, most approaches to address resistance have focused on the genetic drivers of recurrent tumors. To overcome established resistance, new mutant proteins that drive tumor regrowth are targeted by therapy alone or in combination with the primary cancer drug. One mechanism of resistance to EGFRi therapy is the development of a caretaker mutation in the EGFR protein—a mutation that renders EGFRi ineffective. The most common of these caretaker mutations is the T790M mutation. Mutation-specific inhibitors such as osimertinib are used to overcome established resistance to first-generation EGFR inhibitors, which do not inhibit mutant EGFR T790M. Another mechanism of resistance to EGFRi therapy is bypass signaling, which is activated by other receptor tyrosine kinases, such as by amplification, overexpression, or activation of MET, ErbB2, HGF, ErbB3, IGF1R, AXL, NTRK1, BRAF, FGFR3, or FGFR1. Therapeutic interventions that inhibit bypass signaling have been tested in the clinic with mixed results.

[0100] Previous publications such as patent application WO2018022637 describe the use of CBP / p300 inhibitors as novel cancer therapies, particularly for treating cancers containing p300 mutations. WO2011085039 describes methods for treating cancer comprising inhibiting the activity of CBP / p300 histone acetyltransferase (HAT), and the use of CBP / p300 HAT inhibitors for treating subjects with cancer, particularly in combination with DNA damaging chemotherapeutic anticancer agents.

[0101] There is a need for new effective methods and compositions to prevent the development of cancer drug resistance. This is particularly addressed by the embodiments of this Section 4.

[0102] Embodiment 1: A CBP / p300 bromodomain inhibitor for use in a method of treating cancer in an animal, the method comprising administering to an animal in need thereof a CBP / p300 bromodomain inhibitor and a receptor tyrosine kinase inhibitor selected from the group consisting of an EGFR, ALK, MET, HER2, ROS1, RET, NTRK1 and AXL inhibitor, or a KRas (Kirsten Rat Sarcoma) or BRAF (proto-oncogene B-Raf and v-Raf murine sarcoma viral oncogene homolog B) inhibitor, wherein the cancer comprises alterations in the corresponding receptor tyrosine kinase or KRas or BRAF, and wherein the CBP / p300 bromodomain inhibitor alone does not slow the progression of the cancer.

[0103] Embodiment 2: A CBP / p300 bromodomain inhibitor in a method for extending the duration of response of an animal to a receptor tyrosine kinase inhibitor or a KRas or BRAF inhibitor cancer therapy, comprising administering a CBP / p300 bromodomain inhibitor or a pharmaceutically acceptable salt thereof to an animal having cancer, wherein the duration of response to the cancer treatment is extended when the CBP / p300 bromodomain inhibitor or a pharmaceutically acceptable salt thereof is administered as compared to the duration of response to the cancer treatment when the CBP / p300 bromodomain inhibitor or a pharmaceutically acceptable salt thereof is not administered, and wherein the receptor tyrosine kinase inhibitor is selected from EGFR, ALK, MET, HER2, ROS1, RET, NTRK1 and AXL inhibitors.

[0104] Embodiment 3: A composition for treating cancer, comprising a synergistic combination of a CBP / p300 bromodomain inhibitor or a pharmaceutically acceptable salt thereof and a receptor tyrosine kinase inhibitor selected from the group consisting of inhibitors of EGFR, ALK, MET, HER2, ROS1, RET, NTRK1 and AXL, or KRas or BRAF inhibitors, wherein the cancer comprises alterations in the corresponding receptor tyrosine kinases or KRas or BRAF, and wherein the CBP / p300 bromodomain inhibitor alone does not slow the progression of the cancer.

[0105] Embodiment 4: A method of inhibiting the growth of cancer cells, comprising administering a CBP / p300 bromodomain inhibitor and a receptor tyrosine kinase inhibitor selected from the group consisting of an EGFR, ALK, MET, HER2, ROS1, RET, NTRK1 and AXL inhibitor, or a KRas or BRAF inhibitor, and wherein the cancer cells contain alterations in the corresponding receptor tyrosine kinase or KRas or BRAF, and wherein the CBP / p300 bromodomain inhibitor alone does not inhibit the growth of the cancer cells.

[0106] Embodiment 5: The CBP / p300 bromodomain inhibitor or composition for use or method as described in any of the preceding embodiments, wherein the alteration of the receptor tyrosine kinase or KRas or BRAF is an oncogenic alteration.

[0107] Embodiment 6: A CBP / p300 bromodomain inhibitor or composition for use or method according to any preceding embodiment, wherein the receptor tyrosine kinase inhibitor is an EGFR inhibitor.

[0108] Embodiment 7: The CBP / p300 bromodomain inhibitor or composition for use or method according to Embodiment 6, wherein the alteration of the receptor tyrosine kinase is a mutation in EGFR.

[0109] Embodiment 8: A CBP / p300 bromodomain inhibitor or composition for use or method according to any of the preceding embodiments, wherein the composition or combination of the CBP / p300 bromodomain inhibitor or a pharmaceutically acceptable salt thereof and a receptor tyrosine kinase inhibitor or a KRas or BRAF inhibitor has a synergistic effect in treating cancer compared to the CBP / p300 inhibitor alone or the receptor tyrosine kinase or KRas or BRAF inhibitor alone.

[0110] Embodiment 9: A CBP / p300 bromodomain inhibitor or composition for use or method according to any preceding embodiment, wherein the composition or combination of the CBP / p300 bromodomain inhibitor or a pharmaceutically acceptable salt thereof and a receptor tyrosine kinase inhibitor or a Kras or BRAF inhibitor delays or reduces the risk of cancer resistance to the receptor tyrosine kinase inhibitor or a KRas or BRAF inhibitor.

[0111] Embodiment 10: A CBP / p300 bromodomain inhibitor or composition for use or method according to any preceding embodiment, wherein the CBP / p300 bromodomain inhibitor is administered in an amount effective to prevent cancer cells from developing resistance to a receptor tyrosine kinase inhibitor or a KRas or BRAF inhibitor.

[0112] Embodiment 11: A CBP / p300 bromodomain inhibitor or composition for use or method according to any of the preceding embodiments, wherein the EGFR inhibitor is selected from the group consisting of: cetuximab, panitumumab, zalutumumab, nimotuzumab, matuzumab, gefitinib, erlotinib, dacomitinib, lapatinib, neratinib, vandetanib, nacitozumab, osimertinib, afatinib, AP26113, EGFR inhibitor (CAS No. 879127-07-8), EGFR / ErbB2 / ErbB-4 inhibitor (CAS No. 881001-19-0), EGFR / ErbB-2 inhibitor (CAS No. 17924861-4), EGFR inhibitor II (BIBX 1382, CAS No. 196612-93-8), EGFR inhibitor III (CAS No.733009-42-2), EGFR / ErbB-2 / ErbB-4 inhibitor II (CAS No.944341-54-2) or PKCβII / EGFR inhibitor (CAS No.145915-60-2).

[0113] Embodiment 12: A CBP / p300 bromodomain inhibitor or composition for use or method according to any preceding embodiment, wherein the CBP / p300 inhibitor is a compound of formula (I)

[0114]

[0115] in

[0116] R 1 is selected from halogen and -(optionally substituted hydrocarbyl containing 1 to 20 carbon atoms and optionally 1 to 15 heteroatoms selected from O, N and S);

[0117] R 21is selected from hydrogen, -(optionally substituted C 1-6 alkyl), which may contain 1 to 3 oxygen atoms between the carbon atoms, and -(optionally substituted C 3-6 Cycloalkyl);

[0118] R 3 is selected from -(optionally substituted heterocyclyl), -(optionally substituted carbocyclyl), -(optionally substituted C 1-6 alkylene)-(optionally substituted heterocyclyl) and -(optionally substituted C 1-6 alkylene)-(optionally substituted carbocyclyl);

[0119] X 1 , X 2 and X 3 Each independently selected from N, CH and CR x , where X 1 , X 2 and X 3 At least one of them is N;

[0120] R 31 Selected from –H, –C 1-6 -alkyl and -(C substituted with one or more F 1-6 -alkyl); wherein R 3 and any R 31 may be optionally connected; and

[0121] E is absent or selected from –CH2–, –CHR x –, –CR x 2–, –NH–, –NR x –, –O–, –L 1 –L 2 – and –L 2 –L 1 –, where L 1 Selected from –CH2–, –CHR x –, –CR x 2–, –NH–, –NR x – and –O– and L 2 Selected from –CH2–, –CHR x – and –CR x 2–;

[0122] R 6x For –halogen, –OH, =O, C 1-6 Alkyl, C 1-6 Haloalkyl, C substituted with one or more OH 1-6 Alkyl, optionally with one or more R xb A substituted monocyclic aromatic group, optionally substituted with one or more R xbsubstituted monocyclic heteroaryl, optionally substituted with one or more R xb Substituted monocyclic cycloalkyl, optionally substituted by one or more R xb Substituted monocyclic heterocycloalkyl, optionally substituted by one or more R xb Substituted monocyclic cycloalkenyl, optionally substituted with one or more R xb Substituted monocyclic heterocycloalkenyl, wherein R xb independently selected from -halogen, -OH, =O, C 1-4 Alkyl, C 1-2 Haloalkyl, C substituted with one or two OH 1-2 alkyl;

[0123] Ring A can be further replaced by one or more R x Group substitution, where any two R x The group may be optionally attached to and / or any R on ring A x The group may optionally be combined with R 21 and / or wherein ring A may be further connected by a group R x Replace with R 6x Together they form a bicyclic moiety with the following partial structure:

[0124]

[0125] wherein Ring B is -(optionally substituted heterocycle) or -(optionally substituted carbocycle);

[0126] R x are each independently selected from -halogen, -OH, -O-(optionally substituted C 1-6 alkyl), -NH-(optionally substituted C 1-6 alkyl), -N(optionally substituted C 1-6 alkyl)2, =O, -(optionally substituted C 1-6 alkyl), -(optionally substituted carbocyclyl), -(optionally substituted heterocyclyl), -(optionally substituted C 1-6 alkylene)-(optionally substituted carbocyclyl), -(optionally substituted C 1-6 alkylene)-(optionally substituted heterocyclic), -O-(optionally substituted C 1-6 alkylene)-(optionally substituted carbocyclyl) and -O-(optionally substituted C 1-6 alkylene)-(optionally substituted heterocyclyl), and

[0127] wherein the optionally substituted hydrocarbon group, the optionally substituted C 3-6 cycloalkyl, optionally substituted heterocyclyl, optionally substituted heterocycle, optionally substituted carbocyclyl, optionally substituted carbocycle and optionally substituted C 1-6The optional substituents of the alkylene group are independently selected from -(C optionally substituted with one or more halogens); 1-6 alkyl), -halogen, -CN, -NO2, oxo, -C(O)R*, -COOR*, -C(O)NR*R*, -NR*R*, -N(R*)-C(O)R*, -N(R*)-C(O)-OR*, -N(R*)-C(O)-NR*R*, -N(R*)-S(O)2R*, -OR*, -OC(O)R*, -OC(O)-NR*R*, -SR*, -S(O)R*, -S(O)2R*, -S(O)2-NR*R*, -N(R*)-S(O)2-NR*R*, optionally substituted by halogen or C 1-6 alkyl-substituted heterocyclic group, and optionally substituted by halogen or C 1-6 wherein each R* is independently selected from H, C optionally substituted by halogen 1-6 Alkyl, optionally substituted with halogen or C 1-6 alkyl-substituted heterocyclic group, and optionally substituted by halogen or C 1-6 an alkyl-substituted carbocyclyl; wherein any two R* attached to the same nitrogen atom may be optionally attached, and

[0128] wherein the optionally substituted C 1-6 Alkyl and optionally substituted C 1-6 The optional substituents of the alkylene are independently selected from -halogen, -CN, -NO2, oxo, -C(O)R**, -COOR**, -C(O)NR**R**, -NR**R**, -N(R**)-C(O)R**, -N(R**)-C(O)-OR**, -N(R**)-C(O)-NR**R**, -N(R**)-S(O)2R**, -OR**, -OC(O)R**, -OC(O)-NR**R**, -SR**, -S(O)R**, -S(O)2R**, -S(O)2-NR**R**, and -N(R**)-S(O)2-NR**R**, wherein R** is independently selected from H, C(O) optionally substituted with halogen, or 1-6 Alkyl, optionally substituted with halogen or C 1-6 alkyl-substituted heterocyclic group, and optionally substituted by halogen or C 1-6 Alkyl substituted carbocyclyl; wherein any two R** attached to the same nitrogen atom may be optionally linked.

[0129] Embodiment 13: A CBP / p300 bromodomain inhibitor or composition for use or method according to any preceding embodiment, wherein the CBP / p300 inhibitor is an aryl imidazolyl isoxazole of formula (A):

[0130] in

[0131] R° and R are the same or different and are each H or C1-C6 alkyl, which is unsubstituted or substituted by OH, -OC(O)R' or OR', wherein R' is unsubstituted C1-C6 alkyl;

[0132] W is N or CH;

[0133] R 1 is an unsubstituted or substituted group selected from C-attached 4 to 6 membered heterocyclic group; C3-C6 cycloalkyl; unsubstituted or substituted C6-C 10 Aryl, 5-12 membered N-containing heteroaryl, C3-C6 cycloalkyl, OH, -OC(O)R' or OR' substituted C1-C6 alkyl, wherein R' is as defined above; and a spirocyclic group of the formula:

[0134]

[0135] Y is -CH2-, -CH2CH2- or -CH2CH2CH2-;

[0136] n is 0 or 1;

[0137] R 2 Is selected from C6-C 10 aryl, 5 to 12 membered N-containing heteroaryl, C3-C6 cycloalkyl and C5-C6 cycloalkenyl groups, wherein the groups are unsubstituted or substituted, and wherein C6-C 10 The aryl group is optionally fused to a 5- or 6-membered heterocyclic ring;

[0138] or a pharmaceutically acceptable salt thereof, and wherein the aryl imidazolyl isoxazole preferably has the formula (Aa*):

[0139] (Aa*; CCS1477[CAS 2222941-37-7]).

[0140] Embodiment 14: A CBP / p300 bromodomain inhibitor or composition for use or method according to any preceding embodiment, wherein the CBP / p300 inhibitor is a compound of formula (Ba)

[0141] in

[0142] R 1 is -O(C1-C3 alkyl);

[0143] R 6 is optionally independently replaced by one or more R B Substituted phenyl, wherein R B Selected from –OC 1-6Alkyl, -OC 3-6 Cycloalkyl, -O-aryl or -O-heteroaryl, wherein each alkyl, cycloalkyl, aryl or heteroaryl is optionally substituted independently with one or more halogens;

[0144] or wherein the CBP / p300 inhibitor is a compound of formula (Bc)

[0145] in

[0146] R 1 For-OR 5 ;

[0147] R 5 For –C 1-6 Alkyl, -C 3-8 cycloalkyl, heterocyclyl, aryl or heteroaryl;

[0148] R 6 -OH, halogen, oxo, -NO2, -CN, -NH2, -C 1-6 Alkyl, -C 3-8 Cycloalkyl, -C 4-8 Cycloalkenyl, heterocyclyl, aryl, spirocycloalkyl, spiroheterocyclyl, heteroaryl, -OC 3-6 Cycloalkyl, -Oaryl, -Oheteroaryl, -(CH2)n-OR 8 、-C(O)R 8 '、-C(O)OR 8 or -C(O)NR 8 R 9 、-NHC 1-6 Alkyl, -N(C 1-6 Alkyl)2, -S(O)2NH(C 1-6 alkyl), -S(O)2N(C 1-6 Alkyl)2, -S(O)2C 1-6 Alkyl, -N(C 1-6 Alkyl)SO2C 1-6 Alkyl, -S(O)(C 1-6 alkyl), -S(O)N(C 1-6 Alkyl)2 or -N(C 1-6 Alkyl)S(O)(C 1-6 alkyl), wherein each alkyl, cycloalkyl, cycloalkenyl, heterocyclyl, spirocycloalkyl, spiroheterocyclyl, heteroaryl or aryl is optionally substituted by one or more R 10 replace;

[0149] R 7 Each occurrence is independently -H, halogen, -OH, -CN, -OC 1-6 Alkyl, -NH2, -NH(C 1-6Alkyl), -N(C 1-6 Alkyl)2, -S(O)2H(C 1-6 alkyl), -S(O)2N(C 1-6 Alkyl)2, -S(O)2(C 1-6 Alkyl, -S(O)2OH, -C(O)C 1-6 Alkyl, -C(O)NH2, -C(O)NH(C 1-6 alkyl), -C(O)N(C 1-6 Alkyl)2, -C(O)OH, -C(O)OC 1-6 Alkyl, -N(C 1-6 Alkyl)SO2C 1-6 Alkyl, -S(O)(C 1-6 alkyl), -S(O)N(C 1-6 alkyl)2, -S(O)2NH2, -N(C 1-6 Alkyl)S(O)(C 1-6 Alkyl) or tetrazole;

[0150] R 10 Each occurrence is independently -C 1-6 Alkyl, -C 2-6 Alkenyl, -C 2-6 Alkynyl, -C 3-8 Cycloalkyl, -C 4-8 Cycloalkenyl, heterocyclyl, heteroaryl, aryl, -OH, halogen, oxo, -NO2, -CN, -NH2, -OC 1-6 Alkyl, -OC 3-6 Cycloalkyl, -Oaryl, -Oheteroaryl, -NHC 1-6 Alkyl, -N(C 1-6 Alkyl)2, -S(O)2NH(C 1-6 alkyl), -S(O)2N(C 1-6 Alkyl)2, -S(O)2C 1-6 Alkyl, -C(O)C 1-6 Alkyl, -C(O)NH2, -C(O)NH(-C 1-6 Alkyl), -NHC(O)C 1-6 Alkyl-C(O)N(C 1-6 Alkyl)2, -C(O)OC 1-6 Alkyl, -N(C 1-6 Alkyl)SO2-C 1-6 Alkyl, -S(O)(C 1-6 alkyl), -S(O)N(C 1-6 Alkyl)2 or -N(C 1-6 Alkyl)S(O)(C 1-6alkyl), wherein each alkyl, alkenyl, alkynyl, cycloalkylcycloalkenyl, heterocyclyl, heteroaryl or aryl is optionally substituted by one or more -R 12 replace;

[0151] R 12 is independently at each occurrence a halogen;

[0152] m is an integer from 0 to 5;

[0153] r is an integer from 0 to 5.

[0154] Embodiment 15: A CBP / p300 bromodomain inhibitor or composition for use or method according to any preceding embodiment, wherein the slow progression of cancer is measured using RECIST 1.1 response criteria for target lesions or non-target lesions in the animal.

[0155] Embodiment 16: The CBP / p300 bromodomain inhibitor or composition for the use or method according to any preceding embodiment, wherein the cancer is non-small cell lung cancer (NSCLC).

[0156] Embodiment 17: A CBP / p300 bromodomain inhibitor or composition for use or method according to any preceding embodiment, wherein the CBP / p300 bromodomain inhibitor is a compound of formula (I) according to embodiment 12, the receptor tyrosine kinase inhibitor is an EGFR inhibitor, the receptor tyrosine kinase is EGFR, the cancer is NSCLC, more preferably, the NSCLC comprises an EGFR T790M mutation, more preferably, wherein the receptor tyrosine kinase inhibitor is osimertinib.

[0157] Embodiment 18: A CBP / p300 bromodomain inhibitor or composition for use or method according to any preceding embodiment, wherein the CBP / p300 bromodomain inhibitor is a compound of formula (A) of Embodiment 13, preferably CCS1477 (CAS 2222941-37-7), the receptor tyrosine kinase inhibitor is an EGFR inhibitor, the receptor tyrosine kinase is EGFR, the cancer is NSCLC, more preferably NSCLC comprises an EGFR T790M mutation, and more preferably wherein the receptor tyrosine kinase inhibitor is osimertinib.

[0158] With regard to the above-mentioned Embodiment 13, it is noted that compounds of formula (A) have been described in WO2016170324, WO2018073586 and WO2019202332, all of which applications and their disclosures are fully incorporated herein by reference, particularly with respect to the synthesis of compounds of formula (A).

[0159] In another embodiment, a method of treating cancer in an animal is provided, comprising administering to an animal in need thereof a CBP / p300 bromodomain inhibitor and a receptor tyrosine kinase inhibitor selected from EGFR, ALK, MET, HER2, ROS1, RET, NTRK1 and AXL inhibitors, or KRas or BRAF inhibitors, wherein the cancer comprises alterations in the corresponding receptor tyrosine kinases or KRas or BRAF, and wherein the CBP / p300 bromodomain inhibitor alone does not slow the progression of the cancer.

[0160] In another embodiment, a method of treating cancer with a composition comprising a synergistic combination of a CBP / p300 bromodomain inhibitor or a pharmaceutically acceptable salt thereof and a receptor tyrosine kinase inhibitor, or a Kras or BRAF inhibitor selected from an EGFR, ALK, MET, HER2, ROS1, RET, NTRK1, and AXL inhibitor, or a Kras or BRAF inhibitor, wherein the cancer comprises an alteration of the corresponding receptor tyrosine kinase, or Kras or BRAF, and wherein the CBP / p300 bromodomain inhibitor alone does not slow the progression of the cancer.

[0161] In another embodiment, a method for extending the duration of response to a receptor tyrosine kinase inhibitor or a Kras or BRAF inhibitor cancer therapy in an animal is provided, comprising administering a CBP / p300 bromodomain inhibitor or a pharmaceutically acceptable salt thereof to an animal having cancer, wherein the duration of response to the cancer therapy is extended when the CBP / p300 inhibitor or a pharmaceutically acceptable salt thereof is administered as compared to the duration of response to the cancer therapy in the absence of administration of the CBP / p300 inhibitor or a pharmaceutically acceptable salt thereof, and wherein the receptor tyrosine kinase inhibitor is selected from EGFR, ALK, MET, HER2, ROS1, RET, NTRK1 and AXL or is a KRas or BRAF inhibitor.

[0162] In another embodiment, a method of inhibiting the growth of cancer cells is provided, the method comprising administering to the cancer cells a CBP / p300 bromodomain inhibitor and a receptor tyrosine kinase inhibitor selected from EGFR, ALK, MET, HER2, ROS1, RET, NTRK1 and AXL inhibitors or KRas or BRAF inhibitors, wherein the cancer cells comprise alterations of the corresponding receptor tyrosine kinases or KRas or BRAF, and wherein the CBP / p300 bromodomain inhibitor alone does not inhibit the growth of the cancer cells, and wherein the CBP / p300 bromodomain inhibitor is administered in an effective amount to prevent the cancer cells from developing resistance to the kinase inhibitor.

[0163] In another embodiment, a method of inducing cell death in cancer cells is provided, comprising administering to the cancer cells a CBP / p300 bromodomain inhibitor and a receptor tyrosine kinase inhibitor selected from EGFR, ALK, MET, HER2, ROS1, RET, NTRK1 and AXL inhibitors, or a Kras or BRAF inhibitor, wherein the cancer cells comprise alterations in the corresponding receptor tyrosine kinases, or KRas or BRAF, and wherein the CBP / p300 bromodomain inhibitor alone does not induce cell death in the cancer cells.

[0164] In one embodiment, the alteration of receptor tyrosine kinases can be an oncogenic alteration, wherein in this embodiment of Section 4, the term "oncogenic alteration" can refer to a genetic alteration of a cellular proto-oncogene. The result of these genetic changes / alterations can be to confer a growth advantage on the cell. In one embodiment, the genetic mechanisms of mutation, gene amplification, gene fusion and / or chromosomal rearrangement can activate oncogenes in human tumors.

[0165] In another embodiment, the oncogenic change is an EGFR gene mutation selected from the following: EGFR-exon 19 deletion, EGFR-L858R, EGFR-T790M, EGFR-T854A, EGFR-D761Y, EGFR-L747S, EGFR-G796S / R, EGFR-L792F / H, EGFR-L718Q, EGFR-exon 20 insertion, EGFR-G719X (wherein X is any other amino acid), EGFR-L861X, EGFR-S768I or EGFR amplification. In a preferred embodiment, the change is EGFR-T790M. In another embodiment, the cancer is NSCLC, and the change is a mutation comprising EGFR exon 19 deletion, L858R or T790M.

[0166] In another embodiment, the oncogenic alteration is a RET gene mutation or rearrangement selected from the group consisting of KIF5B-RET, CCDC6-RET, NCOA4-RET, TRIM33-RET, RET-V804L, RET-L730, RET-E732, RET-V738, RET-G810A, RET-Y806, RET-A807, or RET-S904F.

[0167] In another embodiment, the oncogenic alteration is a HER2 gene mutation selected from HER2 exon 20 insertion or mutation and HER2-C805S, HER2 T798M, HER2 L869R, HER2 G309E, HER2 S310F, or HER2 amplification.

[0168] In another embodiment, the oncogenic alteration is a ROS1 gene fusion or rearrangement selected from the group consisting of: CD74-ROS1, GOPC-ROS1, EZR-ROS1, CEP85L-ROS1, SLC34A2-ROS1, SDC4-ROS1, FIG-ROS1, TPM3-ROS1, LRIG3-ROS1, KDELR2-ROS1, CCDC6-ROS1, TMEM106B-ROS1, TPD52L1-ROS1, CLTC-ROS1, and LIMA1-ROS1, or a mutation comprising ROS1 G2032R, D2033N, S1986Y / F, L2026M, and / or L1951R.

[0169] In another embodiment, the oncogenic alteration is MET gene amplification, MET gene mutation such as MET Y1230C, D1227N, D1228V, Y1248H and MET exon 14 skipping, or a gene fusion or rearrangement selected from TPR-MET, CLIP2-MET, TFG-MET fusion, KIF5B-MET fusion.

[0170] In another embodiment, the oncogenic alteration is a KRas gene mutation selected from G12C, G12V, G12D, G13D, Q61H or L or R, K117N.

[0171] In another embodiment, the oncogenic alteration is an ALK gene mutation or gene fusion or rearrangement selected from the group consisting of EML4-ALK, TFG-ALK, KIF5B-ALK, KLC1-ALK, STRN-ALK in NSCLC, EML4-ALK, C2orf44-ALK, EML4-ALK, TPM-ALK, VCL-ALK, TPM3-ALK, EML4-ALK or VCL-ALK.

[0172] In another embodiment, the oncogenic alteration is a BRAF gene mutation selected from V600E or V600K.

[0173] In another embodiment, the oncogenic alteration is an NTKR gene fusion or rearrangement selected from the group consisting of: TPM3-NTRK1, ETV6-NTRK3, TPM3-NTRK1, TPR-NTRK1, TFG-NTRK1, PPL-NTRK1, ETV6-NTRK3, TPR-NTRK1, MPRIP-NTRK1, CD74-NTRK1, SQSTM1-NTRK1, TRIM24-NTRK2, LMNA-NTRK, ETV6-NTRK3, BCAN-NTRK1, ETV6-NTRK3, AML, GIST , NFASC-NTRK1, BCAN-NTRK1, AGBL4-NTRK2, VCL-NTRK2, ETV6-NTRK3, BTBD1-NTRK3, RFWD2-NTRK1, RABGAP1L-NTRK1, TP53-NTRK1, AFAP1-NTRK2, NACC2-NTRK2, OKI-NTRK2, PAN3-NTRK2, or an NTKR1 gene mutation selected from F589L, G595R, G667C / S, A608D, or an NTRK3 gene mutation selected from G623R, G696A.

[0174] In another embodiment, the receptor tyrosine kinase inhibitor is an EGFR inhibitor. In another embodiment, the EGFR inhibitor is selected from cetuximab, panitumumab, zalutumumab, nimotuzumab, matuzumab, gefitinib, erlotinib, lapatinib, neratinib, vandetanib, nacitozumab, osimertinib, afatinib, dacomitinib, AP26113, pocitinib, EGFR inhibitor (CAS No. 879127-07-8), EGFR / ErbB2 / ErbB-4 inhibitor (CAS No. 881001-19-0), EGFR / ErbB-2 inhibitor (CAS No. 17924861-4), EGFR inhibitor II (BIBX1382, CAS No. 196612-93-8), EGFR inhibitor III (CAS No. 733009-42-2), EGFR / ErbB-2 / ErbB-4 inhibitor II ... No.944341-54-2) or PKCβII / EGFR inhibitor (CAS No.145915-60-2).

[0175] In another embodiment, the alteration of the receptor tyrosine kinase is a mutation in the EGFR gene.

[0176] In another embodiment, the receptor tyrosine kinase inhibitor is a RET inhibitor. In another embodiment, the RET inhibitor is selected from cabozantinib, vandetanib, lenvatinib, alectinib, apatinib, ponatinib, LOXO-292, BLU-667, or RXDX-105.

[0177] In another embodiment, the receptor tyrosine kinase inhibitor is a HER2 inhibitor. In another embodiment, the HER2 inhibitor is selected from trastuzumab, hyaluronidase / trastuzumab fam-trastumzumab deruxtecan, ado-trastuzumab emtansine, lapatinib, neratinib, pertuzumab, tucatinib, pocitinib, or dacomitinib.

[0178] In another embodiment, the receptor tyrosine kinase inhibitor is a ROS1 inhibitor. In another embodiment, the ROS1 inhibitor is selected from crizotinib, ceritinib, brigatinib, lorlatinib, entrectinib (Etrectinib), cabozantinib, DS-6051b, TPX-0005.

[0179] In another embodiment, the receptor tyrosine kinase inhibitor is a MET inhibitor. In another embodiment, the MET inhibitor is selected from: crizotinib, cabozantinib, MGCD265, AMG208, altiratinib, golvatinib, glesantinib, foretinib, avumatinib, tivatinib, savotinib, AMG337, capmatinib and tepotinib, OMO-1 [JNJ38877618] or the anti-MET antibodies onartuzumab and emibetuzumab [LY2875358] or the anti-HGF antibodies ficlatuzumab [AV-299] and rilotumumab [AMG102].

[0180] In another embodiment, the inhibitor is a KRas inhibitor. In another embodiment, the KRas inhibitor is selected from AMG510, MRTX849, JNJ-74699157 / ARS-3248, BI1701963, BAY-293 or a "RAS(ON)" inhibitor.

[0181] In another embodiment, the receptor tyrosine kinase inhibitor is an ALK inhibitor. In another embodiment, the ALK inhibitor is selected from crizotinib, ceritinib, alectinib, lorlatinib or brigatinib.

[0182] In another embodiment, the inhibitor is a BRAF inhibitor. In another embodiment, the BRAF inhibitor is selected from vemurafenib, dabrafenib, encorafenib or any non-specific RAF inhibitor.

[0183] In another embodiment, the receptor tyrosine kinase inhibitor is an NTRK inhibitor. In another embodiment, the NTRK inhibitor is selected from entrectinib, larotrectinib (LOXO-101), LOCO-195, DS-6051b, cabozantinib, merestinib, TSR-011, PLX7486, MGCD516, crizotinib, regorafenib, dovitinib, lestaurtinib, BMS-7 54807, danusertib, ENMD-2076, midostaurin, PHA-848125AC, BMS-777607, altriratinib, AZD7451, MK5108, PF-03814735, SNS-314, foreitinib, nintedanib, ponatinib, ONO-5390556, or TPX-0005.

[0184] In another embodiment, the composition or combination of a CBP / p300 bromodomain inhibitor or a pharmaceutically acceptable salt thereof and a receptor tyrosine kinase inhibitor or KRas or BRAF inhibitor has a synergistic effect in treating cancer compared to a CBP / p300 inhibitor alone or a receptor tyrosine kinase or KRas or BRAF inhibitor alone. In the embodiments of Section 4, the term "synergistic" refers to an interaction between two or more drugs that results in a total effect of the drugs that is greater than the sum of the individual effects of each drug. In a preferred embodiment, the synergistic effect is an increase in the response rate of an animal to a combination of a CBP / p300 bromodomain inhibitor and a receptor tyrosine kinase inhibitor or KRas or BRAF inhibitor. In another embodiment, the increase in response rate is measured as an increase in efficacy in the treatment of cancer.

[0185] In another embodiment, the anticancer effect provided by the composition or combination of a CBP / p300 bromodomain inhibitor, or a pharmaceutically acceptable salt thereof, and a receptor tyrosine kinase or KRas or BRAF inhibitor is greater than the anticancer effect provided by monotherapy with the same dose of the CBP / p300 inhibitor or receptor tyrosine kinase inhibitor or Kras or BRAF inhibitor. As used in the context of the embodiments of Section 4, the term "anticancer" refers to the treatment of a malignant or cancerous disease. In another embodiment, the invention provides a composition for use or method, wherein the anticancer effect provided by the composition or combination of a CBP / p300 bromodomain inhibitor, or a pharmaceutically acceptable salt thereof, and a receptor tyrosine kinase inhibitor or Kras or BRAF inhibitor is at least 2-fold, at least 3-fold, at least 5-fold, or at least 10-fold greater than that of the individual monotherapy.

[0186] In another embodiment, a composition or combination of a CBP / p300 bromodomain inhibitor or a pharmaceutically acceptable salt thereof and a receptor tyrosine kinase inhibitor or a Kras or BRAF inhibitor delays or reduces the risk of cancer developing resistance to a receptor tyrosine kinase inhibitor or a Kras or BRAF inhibitor. As used in the context of the embodiments of Section 4, the term "cancer resistance" refers to a reduction in the efficacy of a drug; more specifically, the term may refer to cancer cells developing resistance. In another embodiment, the cancer does not develop resistance to a receptor tyrosine kinase inhibitor or a Kras or BRAF inhibitor for at least 3 months, 6 months, 9 months, 12 months, 24 months, 48 ​​months, or 60 months. In another embodiment, the CBP / p300 bromodomain inhibitor is administered in an effective amount to prevent cancer cells from developing resistance to a receptor tyrosine kinase inhibitor or a KRas or BRAF inhibitor.

[0187] In another embodiment, the CBP / p300 bromodomain inhibitor inhibits the bromodomain of CBP and / or p300. p300 (also known as histone acetyltransferase p300, E1A binding protein p300, E1A-associated protein p300) and CBP (also known as CREB binding protein or CREBBP) are two transcriptional coactivators with very similar structures.

[0188] As used in the context of the embodiments of Section 4, the term "CBP / p300 bromodomain inhibitor" may be considered to refer to a compound that binds to a CBP bromodomain and / or a p300 bromodomain and inhibits and / or reduces the biological activity or function of CBP and / or p300. In some embodiments, a CBP / p300 bromodomain inhibitor may bind to CBP and / or p300 primarily (e.g., solely) through contact and / or interaction with a CBP bromodomain and / or a p300 bromodomain. In some embodiments, a CBP / p300 bromodomain inhibitor may bind to CBP and / or p300 through contact and / or interaction with a CBP bromodomain and / or a p300 bromodomain and additional CBP and / or p300 residues and / or domains. In some embodiments, a CBP / p300 bromodomain inhibitor may substantially or completely inhibit the biological activity of CBP and / or p300. In some embodiments, the biological activity can be binding of the bromodomains of CBP and / or p300 to chromatin (e.g., a histone associated with DNA) and / or another acetylated protein. In certain embodiments in the context of the embodiments of Section 4, the inhibitor can have an IC of less than about 50 μM, less than about 1 μM, less than about 500 nM, less than about 100 nM, less than about 10 nM, or less than about 1 nM. 50 or binding constant. In some embodiments, a CBP / p300 bromodomain inhibitor may bind to and inhibit a CBP bromodomain. In some embodiments, a CBP / p300 bromodomain inhibitor may bind to and inhibit a p300 bromodomain. In some embodiments, a CBP / p300 bromodomain inhibitor may not inhibit the histone acetyltransferase activity of CBP / p300.

[0189] In one embodiment, the CBP / p300 bromodomain inhibitor is a compound of formula (I). In one embodiment, the CBP / p300 bromodomain inhibitor is a compound of formula (A), preferably CCS1477 (CAS 2222941-37-7). In another embodiment, the CBP / p300 bromodomain inhibitor is FT-7051. In another embodiment, the compound of formula (I), the compound of formula (A), preferably CCS1477 or FT-7051 is a daily dose of the drug, and its concentration is selected from a list including 10 mg, 15 mg, 25 mg, 50 mg, 100 mg, 150 mg or 200 mg. In another embodiment, CCS1477 is administered 2, 3, 4, 5, 6 or 7 days per week. In another embodiment, CCS1477 is administered twice a day. In another embodiment, administration to cancer cells includes contacting cancer cells with a CBP / p300 inhibitor and a receptor tyrosine kinase inhibitor or a KRas or BRAF inhibitor.

[0190] In another embodiment, dosage depends on multiple factors, including patient's age, body weight and condition and route of administration. Daily dosage can vary in a wide range, and will be adjusted according to the individual needs of each particular case. However, typically, when the compound is administered alone to an adult, the dosage adopted by each route of administration can be in the range of 0.0001 to 50 mg / kg, most commonly in the range of 0.001 to 10 mg / kg body weight, such as 0.01 to 1 mg / kg. This dosage can be, for example, administered 1 to 5 times a day. For intravenous injection, a suitable daily dosage can be 0.0001 to 1 mg / kg body weight, preferably 0.0001 to 0.1 mg / kg body weight. The daily dosage can be administered in a single dose or according to a divided dose regimen.

[0191] In another embodiment, the progression of cancer or the duration of response to cancer treatment can be measured using RECIST 1.1 response criteria for target lesions or non-target lesions in a subject / animal.

[0192] In another embodiment, the term "does not slow the progression of cancer" may be defined in the embodiments of Section 4 as a subject that does not achieve any RECIST 1.1 clinical response. In another embodiment, the term "does not slow the progression of cancer" may be defined in the embodiments of Section 4 as a subject / animal that does not achieve a partial RECIST 1.1 clinical response. In another embodiment, the term "does not slow the progression of cancer" is measured as no objective response rate and / or no increase in progression-free survival according to RECIST 1.1. In another embodiment, the term "does not slow the progression of cancer" is measured as a decrease of less than 30% in the sum of the longest diameters of target lesions, with the baseline sum of the longest diameters of target lesions as a reference.

[0193] In certain embodiments, the cancer is selected from the group consisting of acoustic neuroma, acute leukemia, acute lymphocytic leukemia, acute myeloid leukemia, acute T-cell leukemia, basal cell carcinoma, bile duct cancer, bladder cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, chondrosarcoma, chordoma, choriocarcinoma, chronic leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myeloid leukemia, colon cancer, colorectal cancer, craniopharyngioma, cystadenocarcinoma, diffuse Large B-cell lymphoma, proliferative disorders, embryonal carcinoma, endometrial cancer, endothelial sarcoma, ependymoma, epithelial cancer, erythroleukemia, esophageal cancer, estrogen receptor-positive breast cancer, essential thrombocythemia, Ewing's sarcoma, fibrosarcoma, follicular lymphoma, germ cell testicular cancer, glioma, glioblastoma, gliosarcoma, heavy chain disease, head and neck cancer, hemangioblastoma, liver cancer, hepatocellular carcinoma, hormone-insensitive prostate cancer, smooth muscle Sarcoma, leukemia, liposarcoma, lung cancer, lymphangioendothelial sarcoma, lymphangiosarcoma, lymphoblastic leukemia, lymphoma, lymphoid malignancies of T-cell or B-cell origin, medullary carcinoma, medulloblastoma, melanoma, meningioma, mesothelioma, multiple myeloma, myeloid leukemia, myeloma, myxosarcoma, neuroblastoma, NUT midline carcinoma (NMC), non-small cell lung cancer (NSCLC), oligodendroglioma, oral cancer, bone and flesh In some embodiments, the cancer is a melanoma, NSCLC, renal cancer, ovarian cancer, pancreatic cancer, papillary adenocarcinoma, papillary carcinoma, pinealoma, polycythemia vera, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, sarcoma, sebaceous gland carcinoma, seminoma, skin cancer, small cell lung cancer, solid tumors (carcinomas and sarcomas), small cell lung cancer, gastric cancer, squamous cell carcinoma, synovioma, sweat gland carcinoma, thyroid cancer, Waldenstrom's macroglobulinemia, testicular tumor, uterine cancer and Wilms' tumor. In certain embodiments, the cancer is melanoma, NSCLC, renal cancer, ovarian cancer, colon cancer, pancreatic cancer, hepatocellular carcinoma or breast cancer. In certain embodiments of any method, the cancer is lung cancer, breast cancer, pancreatic cancer, colorectal cancer and / or melanoma. In certain embodiments, the cancer is lung cancer. In certain embodiments, the lung cancer is non-small cell lung cancer NSCLC. In certain embodiments, the cancer is breast cancer. In certain embodiments, the cancer is melanoma. In certain embodiments, the cancer is colorectal cancer.

[0194] In another embodiment, the CBP / p300 bromodomain inhibitor and the receptor tyrosine kinase inhibitor or KRas or BRAF inhibitor are administered to the animal simultaneously as a single composition. In another embodiment, the CBP / p300 bromodomain inhibitor and the receptor tyrosine kinase inhibitor or KRas or BRAF inhibitor are administered to the animal separately. In another embodiment, the CBP / p300 bromodomain inhibitor and the receptor tyrosine kinase inhibitor or KRas or BRAF inhibitor are administered to the animal simultaneously. In another embodiment, the CBP / p300 bromodomain inhibitor is administered to the animal prior to administration of the receptor tyrosine kinase inhibitor or KRas or BRAF inhibitor. In another embodiment, the animal is a human.

[0195] In one embodiment, the term "effective amount" of a pharmaceutical agent (e.g., a pharmaceutical preparation) may refer to an effective amount that achieves the desired therapeutic or preventive effect within the necessary dosage and time period. In some embodiments, an effective amount refers to an amount of a CBP / p300 bromodomain inhibitor and a receptor tyrosine kinase inhibitor or a KRas or BRAF inhibitor that (i) treats a specific disease, condition, or disorder, (ii) attenuates, improves, or eliminates one or more symptoms of a specific disease, condition, or disorder, or (iii) prevents or delays the onset of one or more symptoms of a specific disease, condition, or disorder described herein. In some embodiments, an effective amount of a CBP / p300 bromodomain inhibitor and a receptor tyrosine kinase inhibitor or a KRas or BRAF inhibitor can reduce the number of cancer cells; may reduce tumor size; may inhibit (i.e., slow down and preferably stop) the infiltration of cancer cells into peripheral organs; may inhibit (i.e., slow down and preferably stop) tumor metastasis; may inhibit tumor growth to a certain extent; and / or may alleviate one or more cancer-related symptoms to a certain extent. For cancer treatment, efficacy can be measured, for example, by assessing time to disease progression (TTP) and / or determining a response rate (RR). In some embodiments, an effective amount is an amount of a CBP / p300 bromodomain inhibitor and a receptor tyrosine kinase inhibitor or a KRas or BRAF inhibitor entity described herein sufficient to significantly reduce the activity or number of drug-resistant or drug-resistant persisting cancer cells.

[0196] In one embodiment, the compounds of the invention may be administered to a human or animal patient in combination with radiation therapy or another chemotherapeutic agent for the treatment of cancer. In another embodiment, a combination therapy may be provided in which a CBP / p300 inhibitor or RTK inhibitor or KRas or BRAF inhibitor is administered simultaneously or sequentially with radiation therapy; or is administered simultaneously and sequentially with another chemotherapeutic agent or multiple chemotherapeutic agents or as a combined preparation for the treatment of cancer. The or each other chemotherapeutic agent is typically an agent conventionally used for the type of cancer being treated. In one embodiment, the type of chemotherapeutic agent used in combination may be, for example, an androgen receptor antagonist for the treatment of prostate cancer, such as enzalutamide, and an inhibitor of CYP17A1 (17a-hydroxylase / C 17,20 lyase), such as abiraterone. In other embodiments, other chemotherapeutic agents in the combination therapy may include docetaxel. In one embodiment, the term "combination" in Section 4 may refer to simultaneous, separate or sequential administration. When administered sequentially or separately, delayed administration of the second component should not result in loss of the beneficial effects of the combination.

[0197] In another embodiment, the response to the CBP / p300 bromodomain inhibitor and the receptor tyrosine kinase inhibitor or KRas or BRAF inhibitor is a sustained response. In one embodiment, a "sustained response" can refer to a sustained effect on reducing tumor growth after treatment is stopped. For example, the tumor size can remain the same or smaller than the size at the beginning of the dosing period.

[0198] In another embodiment, the term "treatment" (and variants such as "treatment" or "treatment") may refer to a clinical intervention that attempts to alter the natural course of the individual or cell being treated, and may be performed for prevention or during clinical pathology. The desired effect of treatment may include preventing the occurrence or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, stabilizing (i.e., not worsening) the disease state, preventing metastasis, reducing the rate of disease progression, improving or alleviating the disease state, prolonging survival or improving prognosis compared to the expected survival when not receiving treatment. In certain embodiments, CBP / p300 bromodomain inhibitors and receptor tyrosine kinases or KRas or BRAF inhibitors can be used to delay the development of a disease or disorder or slow the progression of a disease or disorder. In one embodiment, those individuals in need of treatment may include those individuals who already have the disorder or disorder and those individuals who are prone to the disorder or disorder (e.g., through genetic mutations or abnormal expression of genes or proteins) or those individuals in which the disorder or disorder will be prevented.

[0199] In one embodiment, the term "delay" can refer to delaying, hindering, slowing down, delaying, stabilizing and / or postponing the development of a disease (such as cancer) or drug resistance of a disease. Such delays can vary in length, depending on the history of the disease and / or the individual being treated. It will be apparent to those skilled in the art that sufficient or significant delays can actually include prevention, as the individual will not develop the disease. For example, advanced cancer, such as the development of metastasis, can be delayed.

[0200] 5. Examples

[0201] The following examples are merely illustrative and will further describe the present invention. These examples should not be construed as limiting the present invention thereto.

[0202] The preparation of Compound 00003 (Compound B), 00004 (Compound A), 00030, 00071 and Compound C are described below. Where deemed helpful, synthetic routes to intermediate compounds and / or compounds close to the above compounds are given.

[0203] General experimental methods

[0204] LCMS method:

[0205] Method A: Instrument: Agilent 1260Bin. Pump: G1312B, degasser; Autosampler, ColCom, DAD: Agilent G1315D, 220-320nm, MSD: Agilent LC / MSD G6130B ESI, pos / neg 100-800, ELSDAlltech 3300 gas flow 1.5mL / min, gas temperature: 40°C; Column: Waters XSelect TM C18, 30x2.1 mm, 3.5 μ, temperature: 35 °C, flow rate: 1 mL / min, gradient: t0 = 5% A, t 1.6min =98%A,t 3min =98% A, post-run time (Posttime): 1.3 min, eluent A: 0.1% formic acid in acetonitrile, eluent B: 0.1% formic acid in water).

[0206] Method B: Instrument: Agilent 1260Bin. Pump: G1312B, degasser; Autosampler, ColCom, DAD: Agilent G1315D, 220-320nm, MSD: Agilent LC / MSD G6130B ESI, pos / neg 100-800, ELSDAlltech 3300 gas flow 1.5mL / min, gas temperature: 40°C; Column: Waters XSelectTM C18, 50x2.1mm, 3.5μ, temperature: 35℃, flow rate: 0.8mL / min, gradient: t0=5%A, t 3.5min =98%A,t 6min =98% A, post-run time: 2 min; eluent A: 0.1% formic acid in acetonitrile, eluent B: 0.1% formic acid in water).

[0207] Method C: Instrument: Agilent 1260Bin. Pump: G1312B, degasser; Autosampler, ColCom, DAD: Agilent G1315C, 220-320nm, MSD: Agilent LC / MSD G6130B ESI, pos / neg 100-800; Column: Waters XSelect TM CSH C18, 30x2.1mm, 3.5μ, temperature: 25℃, flow rate: 1mL / min, gradient: t0=5%A, t 1.6min =98%A,t 3min =98% A, post-run time: 1.3 min, eluent A: 95% acetonitrile + 5% 10 mM ammonium bicarbonate in acetonitrile aqueous solution, eluent B: 10 mM ammonium bicarbonate aqueous solution (pH = 9.5).

[0208] Method D: Instrument: Agilent 1260Bin. Pump: G1312B, degasser; Autosampler, ColCom, DAD: Agilent G1315C, 220-320nm, MSD: Agilent LC / MSD G6130B ESI, pos / neg 100-800; Column: Waters XSelect TM CSH C18, 50x2.1mm, 3.5μ, temperature: 25℃, flow rate: 0.8mL / min, gradient: t0=5%A, t 3.5min =98%A,t 6min =98% A, post-run time: 2 min, eluent A: 95% acetonitrile + 5% 10 mM ammonium bicarbonate in acetonitrile aqueous solution, eluent B: 10 mM ammonium bicarbonate aqueous solution (pH = 9.5).

[0209] UPLC Method:

[0210] Method A: Instrument: Agilent Infinity II; Bin. Pump: G7120A, multi-sampler, VTC, DAD: Agilent G7117B, 220-320 nm, PDA: 210-320 nm, MSD: Agilent G6135B ESI, pos / neg 100-1000, ELSD G7102A: Evap 40°C, Neb 50°C, gasflow 1.6 mL / min, column: Waters XSelect CSHC18, 50x2.1 mm, 2.5 μm temperature: 25°C, flow rate: 0.6 mL / min, gradient: t0 = 5% B, t 2min =98%B,t 2.7min =98% B, post-running time: 0.3 min, eluent A: 10 mM ammonium bicarbonate aqueous solution (pH = 9.5), eluent B: acetonitrile.

[0211] Method B: Instrument: Agilent Infinity II; Bin. Pump: G7120A, Multisampler, VTC, DAD: Agilent G7117B, 220-320 nm, PDA: 210-320 nm, MSD: Agilent G6135B ESI, pos / neg 100-1000, ELSD G7102A: Evap 40°C, Neb 40°C, gas flow: 1.6 mL / min, column: Waters XSelect TM CSHC18, 50x2.1mm, 2.5μmTemperature: 40℃, Flow rate: 0.6mL / min, Gradient: t0=5%B, t 2min =98%B,t 2.7min =98% B, post-run time: 0.3 min, eluent A: 0.1% formic acid in water, eluent B: 0.1% formic acid in acetonitrile.

[0212] GCMS Method:

[0213] Method A: Equipment: GC: Agilent 6890N G1530N and MS: MSD 5973G2577A, EI-positive, measurement temperature: 280°C, mass range: 50-550; column: RXi-5MS 20m, ID 180μm, df 0.18μm; average flow rate: 50cm / s; injection volume: 1μl; injector temperature: 250°C; split ratio: 100 / 1; carrier gas: He; initial temperature: 100°C; start time: 1.5min; solvent delay: 1.0min; rate: 75°C / min; final temperature: 250°C; holding time: 4.3min.

[0214] Method B: Equipment: GC: Agilent 6890N G1530N, FID: measurement temperature: 300°C and MS: MSD5973G2577A, EI-positive, measurement temperature: 280°C mass range: 50-550; column: Restek RXi-5MS 20m, ID 180μm, df 0.18μm; average flow rate: 50cm / s; injection volume: 1μl; injector temperature: 250°C; split ratio: 20 / 1; carrier gas: He; initial temperature: 60°C; start time: 1.5min; solvent delay: 1.3min; rate: 50°C / min; final temperature: 250°C; holding time: 3.5min.

[0215] Method C: Equipment: GC: Agilent 6890N G1530N, FID: measurement temperature: 300℃ and MS: MSD5973G2577A, EI-positive, measurement temperature: 280℃ mass range: 50-550; column: Restek RXi-5MS 20m, ID 180μm, df 0.18μm; average flow rate: 50cm / s; injection volume: 1μl; injector temperature: 250℃; split ratio: 20 / 1; carrier gas: He; initial temperature: 100℃; start time: 1.5min; solvent delay: 1.3min; rate: 75℃ / min; final temperature: 250℃; holding time: 4.5min.

[0216] Chiral LC:

[0217] Method A: (Instrument: Agilent 1260 Quart. Pump: G1311C, Autosampler, ColCom, DAD: Agilent G4212B, 220-320 nm, Column: OD-H 250x4.6mm, temperature: 25°C, flow rate: 1mL / min, no gradient: 90 / 10, time: 30min, eluent A: heptane, eluent B: ethanol).

[0218] Preparative reversed phase chromatography:

[0219] Method A: Device Type: Reveleris TM prep MPLC; column: Phenomenex LUNA C18 (150x25mm, 10μ); flow rate: 40mL / min; column temperature: room temperature; eluent A: 0.1% (v / v) formic acid in water, eluent B: 0.1% (v / v) formic acid in acetonitrile; gradient: t=0min 5% B, t=1min 5% B, t=2min 30% B, t=17min 70% B, t=18min 100% B, t=23min 100% B; detection type UV: 220 / 254nm. The appropriate fractions were combined and lyophilized.

[0220] Method B: Device Type: Reveleris TM prep MPLC; column: Waters XSelect TM CSH C18 (145x25mm, 10μ); flow rate: 40mL / min; column temperature: room temperature; eluent A: 10mM ammonium bicarbonate in water (pH=9.0); eluent B: 99% acetonitrile + 1% 10mM ammonium bicarbonate in water; gradient: t=0min 5% B, t=1min 5% B, t=2min 30% B, t=17min 70% B, t=18min 100% B, t=23min 100% B; detection type UV: 220 / 254nm. The appropriate fractions were combined and lyophilized.

[0221] Chiral (preparative) SFC

[0222] Method A: (column: SFC instrument module: Waters Prep100q SFC system, PDA: Waters 2998, fraction collector: Waters 2767; column: Phenomenex Lux Amylose-1 (250x20mm, 5μm), column temperature: 35°C; flow rate: 100mL / min; ABPR: 170bar; eluent A: CO2, eluent B: 20mM ammonia in methanol; no gradient 10% B, time: 30min, detection: PDA (210-320nm); PDA-based fraction collection).

[0223] Method B: (column: SFC instrument module: Waters Prep100q SFC system, PDA: Waters2998, fraction collector: Waters 2767; column: Phenomenex Lux Celulose-1 (250x20mm, 5μm), column temperature: 35°C; flow rate: 100mL / min; ABPR: 170bar; eluent A: CO2, eluent B: 20mM ammonia in methanol solution; non-gradient 10% B, time: 30min, detection: PDA (210-320nm); PDA-based fraction collection).

[0224] Method C: (column: SFC instrument module: Waters Prep100q SFC System, PDA: Waters 2998; column: Chiralpak IC (100x4.6mm, 5μm), column temperature: 35°C; flow rate: 2.5mL / min; ABPR: 170bar; eluent A: CO2, eluent B: methanol containing 20mM ammonia; t=0min5%B, t=5min 50%B, t=6min 50%B, detection: PDA (210-320nm); PDA-based fraction collection).

[0225] Method D: (column: SFC instrument module: Waters Prep 100SFC UV / MS directional system; Waters 2998 Photodiode Array (PDA) detector; Waters Acquity QDa MS detector; Waters 2767 sample manager; column: Waters Torus 2-PIC 130A OBD (250x19mm, 5μm); column temperature: 35°C; flow rate: 70mL / min; ABPR: 120bar; eluent A: CO2, eluent B: methanol containing 20mM ammonia; linear gradient: t=0min 10%B, t=4min50%B, t=6min 50%B; detection: PDA (210-400nm); fraction collection based on PDA TIC).

[0226] Starting Materials

[0227] Standard reagents and solvents were obtained at highest commercial purity and used as such; specific reagents purchased were described below.

[0228]

[0229]

[0230]

[0231] Synthesis steps of key intermediates

[0232] Intermediate 1: 1-(5-(4,6-dichloropyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one

[0233]

[0234] In 1L steel autoclave, to 6-methylnicotinate methyl ester (100g, 662mmol) in acetic acid (250mL) solution, add platinum (IV) oxide (0.5g, 2.202mmol), then under 10 bar hydrogen atmosphere and stir reaction mixture at 60 ℃. Rapid hydrogen consumption is observed, and autoclave is refilled several times until hydrogen consumption stops and reduction is complete. The mixture is cooled to room temperature and filtered with diatomaceous earth. The filtrate is concentrated to provide 6-methylpiperidine-3-carboxylic acid methyl ester acetate (143.8g, 100%) as a mixture of diastereoisomers, which is used as is in the next step. GCMS (Method A): tR 2.40 (80%) and 2.48 min (20%), 100%, MS (EI) 157.1 (M) +, 142.1 (M-Me) +. To a solution of methyl 6-methylpiperidine-3-carboxylate acetate (53 g, 244 mmol) in a mixture of water (500 ml) and dichloromethane (500 ml) was carefully added sodium bicarbonate (82 g, 976 mmol) (effervescence!!) followed by slow addition of acetic anhydride (29.9 g, 293 mmol). The reaction mixture was stirred at room temperature for 2 hours. The organic layer was separated, dried over sodium sulfate, filtered and concentrated in vacuo to give methyl 1-acetyl-6-methylpiperidine-3-carboxylate (49 g, 100%) as a yellow oil. A solution of ammonia in methanol (7N, 500mL, 3.5mol) of 1-acetyl-6-methylpiperidine-3-carboxylic acid methyl ester (49g, 246mmol) was stirred at 120°C for 40 hours in a pressure vessel. The mixture was cooled to room temperature and concentrated to give a light yellow solid. The solid was dissolved in dichloromethane and filtered through a silica gel plug. The filtrate was concentrated to give 1-acetyl-6-methylpiperidine-3-carboxamide as an off-white solid, which was used as is in the next step. A solution of 1-acetyl-6-methylpiperidine-3-carboxamide (266mmol) obtained in the previous step in phosphorus oxychloride (500mL, 5.37mol) was stirred at room temperature for 16 hours. The reaction mixture was evaporated in vacuo to give a thick oil. The oil was co-evaporated twice with toluene and carefully distinguished between cold saturated sodium carbonate (effervescent!) and ethyl acetate. The organic layer was separated from the alkaline aqueous layer, dried with sodium sulfate, filtered and concentrated in vacuo to give a thick oily product, which solidified after standing. The crude product was dissolved in dichloromethane and filtered through a plug of silica gel (eluting with 10% methanol in dichloromethane). This provided 1-acetyl-6-methylpiperidine-3-carbonitrile (28 g, 63%) as an oil which solidified on standing.GCMS (Method A): tR 3.78 (63%) and 3.89 min (378%), 100%, MS (EI) 166.1 (M) +. To a solution of 1-acetyl-6-methylpiperidine-3-carbonitrile (23 g, 138 mmol) in ethanol (300 ml) was added hydroxylamine solution (50% in water, 25.4 mL, 415 mmol), and the reaction mixture was stirred at reflux for 16 hours. The reaction mixture was concentrated and co-evaporated three times with ethyl acetate to dryness to give 1-acetyl-N-hydroxy-6-methylpiperidine-3-carboximidamide as a sticky solid. LCMS (Method A): tR 0.13 min, 100%, MS (ESI) 200.2 (M+H) +. Assuming quantitative yield, the product was used as is in the next step. To the solution of 1-acetyl-N-hydroxy-6-methylpiperidine-3-carboxamidine (23g, 138mmol) in ethanol (500mL) from the previous step, acetic acid (23.79mL, 416mmol) and 50% Raney nickel slurry in water (5mL) were added, and the reaction mixture was then stirred at 50°C for 2 days under a hydrogen atmosphere. The mixture was filtered with diatomaceous earth, washed with some ethanol and concentrated to give 70g of thick oil. It was co-evaporated twice with ethyl acetate and fully dried in a vacuum to give 1-acetyl-6-methylpiperidine-3-carboxamidine acetate (33g, 98%) as a green-yellow oil for the next step. LCMS (Method A): tR 0.14min, 90%, MS (ESI) 184.1 (M+H) +. Under nitrogen atmosphere (60mL), 1-acetyl-6-methylpiperidine-3-carboximidamide acetate (32g, 132mmol) and dimethyl malonate (26.1g, 197mmol) were added to a solution of sodium (18.14g, 789mmol) in anhydrous methanol, and the reaction mixture was stirred at 50°C for 16 hours. The reaction mixture was concentrated, dissolved in water (300mL), acidified to pH 4 with 6N hydrochloric acid, and precipitated. The precipitate was filtered off to give 1-(5-(4,6-dihydroxypyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one as a yellow solid (10.4g, 31%), which was used as is in the next step. A suspension of 1-(5-(4,6-dihydroxypyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (10.4 g, 41.4 mmol) in phosphorus oxychloride (200 mL, 2146 mmol) was stirred at 50°C. After about 3 hours the solid slowly dissolved. After 5 hours the reaction mixture was concentrated in vacuo and co-evaporated twice with toluene. The remaining oil was carefully quenched with ice, neutralized with saturated aqueous sodium bicarbonate solution and extracted with ethyl acetate (2 x 100 mL).The combined organic layers were dried over sodium sulfate and concentrated in vacuo to give 1-(5-(4,6-dichloropyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (Intermediate 1, 6.8 g, 57%) as a yellow oil that solidified upon standing. LCMS (Method A): tR 1.88 min, 100%, MS (ESI) 288.1 (M+H)+.

[0235] Intermediate 2: 1-((2S,5R)-5-(4,6-dichloropyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one

[0236]

[0237] To a solution of N-acetyl-D-leucine (1 kg, 5.77 mol) in ethanol (1.5 L) was added a solution of 6-methylpiperidine-3-carboxylic acid methyl ester (934 g, 2.38 mol, prepared according to Intermediate 1) in ethyl acetate (3 L), and the mixture was heated to 40 ° C. The resulting solution was allowed to reach room temperature over 16 hours, during which time precipitation occurred. The precipitate was filtered off, washed with ether (500 mL) and air-dried to give crude (3R, 6S)-6-methylpiperidine-3-carboxylic acid methyl ester acetyl-D-leucine salt (287 g, 34%) as a white solid. Crude (3R, 6S)-6-methylpiperidine-3-carboxylic acid methyl ester acetyl-D-leucine salt (287 g, 869 mmol) was crystallized from a hot mixture of ethanol and ethyl acetate 1:2 (1 L). The precipitate was filtered off and the filter cake was ground in a mixture of ether and n-pentane 1:1 (500 mL). The precipitate was filtered out and air-dried to give (3R, 6S)-6-methylpiperidine-3-carboxylic acid methyl ester acetyl-D-leucine salt (128g, 44%) in the form of a white solid. A saturated sodium carbonate solution (1L) was added to a solution of (3R, 6S)-6-methylpiperidine-3-carboxylic acid methyl ester acetyl-D-leucine salt (128g, 387mmol) in dichloromethane (1L). The two-phase system was vigorously stirred for 10 minutes and the layers were separated. The organic layer was dried over sodium sulfate and filtered to give a clear solution. Then, triethylamine (65mL, 465mmol) and acetic anhydride (44mL, 465mmol) were added, and the mixture was stirred at room temperature for 1 hour. The mixture was washed with a saturated sodium bicarbonate solution, dried over sodium sulfate and concentrated to give (3R, 6S)-1-acetyl-6-methylpiperidine-3-carboxylic acid methyl ester (93g) in the form of a light yellow solid. To the autoclave was added (3R, 6S)-1-acetyl-6-methylpiperidine-3-carboxylic acid methyl ester (93 g, 387 mmol) dissolved in 7N ammonia water of methanol (600 mL, 4200 mmol) and heated to 60 ° C for 3 days. The mixture was concentrated to give (3R, 6S)-1-acetyl-6-methylpiperidine-3-carboxamide (102 g) as a pale yellow oil. Assuming quantitative yield, the product was used as is in the next step. Chiral LC (Method A) tR = 12.35 min, > 98% ee. To a solution of (3R, 6S)-1-acetyl-6-methylpiperidine-3-carboxamide (50 g, 271 mmol) in dichloromethane (500 mL) was added triethyloxonium tetrafluoroborate (77 g, 407 mmol) portionwise, and the mixture was stirred at room temperature for 4 hours. 7N ammonia in methanol (200 ml, 9.15 mol) was slowly added and the mixture was stirred at room temperature for 16 hours. The mixture was concentrated to give (3R,6S)-1-acetyl-6-methylpiperidine-3-carboximidamide (50 g) as a pink solid, which was used in the next step.To a 5.4M solution of sodium methoxide in methanol (99 mL, 535 mmol) in methanol (200 mL) was added a solution of (3R, 6S)-1-acetyl-6-methylpiperidine-3-carboximidamide (49 g, 267 mmol) in methanol (400 mL) and dimethyl malonate (61.4 mL, 535 mmol). The mixture was heated to 50°C and stirred for 24 hours. The mixture was acidified with concentrated hydrochloric acid (pH ~ 3) and concentrated to a small volume. The residue was filtered through silica (20% methanol in dichloromethane) and concentrated to give an orange oil. The crude product was purified by silica gel column chromatography (0% to 20% methanol in dichloromethane) to give 1-((2S, 5R)-5-(4,6-dihydroxypyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (12 g, 17%) as a colorless gum. LCMS (Method C): tR 0.17 min, 100%, MS (ESI) 252.1 (M+H)+. A solution of 1-((2S, 5R)-5-(4,6-dihydroxypyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (12 g, 47.8 mmol) in phosphorus oxychloride (80 mL, 858 mmol) was stirred at 60 °C for 24 hours. The reaction mixture was concentrated and co-evaporated twice with toluene to give a yellow oil. The oil was dissolved in ethyl acetate and washed with saturated sodium bicarbonate solution. The aqueous layer was extracted twice with ethyl acetate. The combined organic layers were washed with brine, dried over sodium sulfate and concentrated to give a yellow oil. The oil was purified by silica gel column chromatography (0% to 20% tetrahydrofuran in toluene) to give 1-((2S,5R)-5-(4,6-dichloropyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (Intermediate 2, 1.5 g, 11%) as a colorless gum. LCMS (Method B): tR 3.34 min, 100%, MS (ESI) 288.0 (M+H)+; Chiral UPLC (Method: A) tR 2.54 min, >95% ee and de.

[0238] Intermediate 3: 1-((2S,5R)-5-(4-chloro-6-(pyrazin-2-yl)pyrimidin-2-yl)-2-methylpiperidin-1-yl) Synthesis of Ethan-1-one

[0239]

[0240] In a 1 L steel autoclave, platinum (IV) oxide (0.5 g, 2.202 mmol) was added to a solution of methyl 6-methylnicotinate (100 g, 662 mmol) in acetic acid (250 mL), and the reaction mixture was stirred at 60 ° C under 10 bar hydrogen atmosphere. Rapid hydrogen consumption was observed and the autoclave was refilled several times until hydrogen consumption ceased. The mixture was cooled to room temperature and filtered through celite. The filtrate was carefully concentrated to give methyl 6-methylpiperidine-3-carboxylate acetate (143.8 g, 100%) as a mixture of diastereoisomers for the next step. GCMS (Method A): t R 2.40 (80%) and 2.48 min (20%), 100%, MS (EI) 157.1 (M) + . 6-Methylpiperidine-3-carboxylic acid methyl ester acetate (2.1 kg, 9924 mmol) as a mixture of diastereoisomers was diluted with dichloromethane (4 L) and 4M sodium hydroxide solution was slowly added until pH ~9. The layers were separated and the aqueous layer was extracted twice with dichloromethane (after each extraction, the aqueous layer was rebasified to pH ~9 with 4M sodium hydroxide solution). The combined organic layers were dried over sodium sulfate and concentrated (35 °C, 450 mbar) to a small volume (~2 L) to give 6-methylpiperidine-3-carboxylic acid methyl ester (2.8 kg, 8905 mmol) as a ca. 50% yellow solution in dichloromethane. 1H NMR (400 MHz, CDCl3, mixture of rotamers) δ5.10 (s, .3H), 3.63 (s, 1H), 3.49–3.42 (m, 2.2H), 3.41–3.34 (m, 0.8H), 3.18–3.10 (m, 0.8H), 3.09–3.03 (m, 0.2H), 2.64–2.54 (m, 0.8H), 2.53–2.34 (m, 1.2H), 2.30–2.20 (m, 1H), 1.95–1.7 6 (m, 1H), 1.53–1.36 (m, 1H), 1.35–1.21 (m, 1H), 1.04–0.90 (m, 1H), 0.89–0.84 (m, 0.8H), 0.83–0.76 (m, 2.2H). A solution of 6-methylpiperidine-3-carboxylic acid methyl ester (934 g, 2.38 mol) in ethyl acetate (3 L) was added to a solution of N-acetyl-D-leucine (1 kg, 5.77 mol) in ethanol (1.5 L), and the mixture was heated to 40°C. The resulting solution was allowed to reach room temperature over 16 hours, during which time precipitation occurred. The precipitate was filtered off, washed with ether (500 mL) and air-dried to give crude (3R, 6S)-6-methylpiperidine-3-carboxylic acid methyl ester acetyl-D-leucine salt (287 g, 34%) as a white solid. The crude product (3R, 6S)-6-methylpiperidine-3-carboxylic acid methyl ester acetyl-D-leucine salt (287 g, 869 mmol) was crystallized from a hot mixture of ethanol and ethyl acetate 1:2 (1 L). The precipitate was filtered off and the filter cake was ground in a mixture of ether and n-pentane 1:1 (500 mL). The precipitate was filtered off and air-dried to give (3R, 6S)-6-methylpiperidine-3-carboxylic acid methyl ester acetyl-D-leucine salt (128 g, 44%) as a white solid. 1H-NMR(400MHz,DMSO-d6)δ7.80(d,J=8.2Hz,1H),5.80–5.00(s,2H),4.20–4.04(m,1H),3.63(s,3H),3.32–3.21(m,1H),2.93–2.80(m,2H),2. 73–2.65(m,1H),2.04–1.94(m,1H),1.82(s,3H),1.68–1.49(m,3H),1. 49–1.37(m,2H),1.30–1.15(m,1H),1.02(d,J=6.4Hz,3H),0.85(m,6H). Saturated sodium carbonate solution (1L) was added to a solution of (3R, 6S)-6-methylpiperidine-3-carboxylic acid methyl ester acetyl-D-leucine salt (128g, 387mmol) in dichloromethane (1L). The two-phase system was vigorously stirred for 10 minutes and the layers were separated. The organic layer was dried over sodium sulfate and filtered to obtain a clear solution. Then, triethylamine (65mL, 465mmol) and acetic anhydride (44mL, 465mmol) were added and the mixture was stirred at room temperature for 1 hour. The mixture was washed with saturated sodium bicarbonate aqueous solution, dried over sodium sulfate and concentrated to obtain (3R, 6S)-1-acetyl-6-methylpiperidine-3-carboxylic acid methyl ester (93g) in the form of a pale yellow solid. 1 H-NMR (400 MHz, CDCl3, mixture of rotamers) δ5.02–4.87 (m, 0.5H), 4.84–4.68 (m, 0.5H), 4.18–4.05 (m, 0.5H), 3.89–3.77 (m, 0.5H), 3.71 (d, J=11.6 Hz, 3H), 3.31–3.18 (m, 0.5H), 2.79–2.67 (m, 0.5H), 2.51–2.31 (m, 1H) , 2.11 (d, J = 6.7 Hz, 3H), 2.01–1.90 (m, 1H), 1.88–1.55 (m, 3H), 1.33–1.21 (m, 1.5H), 1.20–1.06 (m, 1.5H). A solution of (3R, 6S)-1-acetyl-6-methylpiperidine-3-carboxylic acid methyl ester (93 g, 387 mmol) in 7N ammonia (600 mL, 4200 mmol) methanol was added to an autoclave and heated to 60 ° C for 3 days. The mixture was concentrated to give (3R, 6S)-1-acetyl-6-methylpiperidine-3-carboxamide (102 g) as a light yellow oil. Assuming quantitative yield, the product was used as is in the next step. 1H-NMR (400 MHz, DMSO-d6, mixture of rotamers) δ7.38 (s, 1H), 6.89 (d, J=24.7 Hz, 1H), 4.76–4.59 (m, 0.5H), 4.39–4.24 (m, 0.5H), 4.16–4.01 (m, 0.5H), 3.72–3.51 (m, 0.5H), 3.14–2.99 (m, 0.5H), 2.68–2.51 (m, 0.5H), 2.30–2.12 (m, 0.5H), 2.11–1.92 (m, 3.5H), 1.78–1.38 (m, 4H), 1.23–1.11 (m, 1.5H), 1.09–0.94 (m, 1.5H); Chiral LC (method A) t R =12.35min,>98%ee.To a solution of (3R,6S)-1-acetyl-6-methylpiperidine-3-carboxamide (50g, 271mmol) in dichloromethane (500mL) was added triethyloxonium tetrafluoroborate (77g, 407mmol) portionwise, and the mixture was stirred at room temperature for 4 hours. A 7N ammonia solution in methanol (200mL, 9.15mol) was slowly added, and the mixture was stirred at room temperature for 16 hours. The mixture was concentrated to give (3R,6S)-1-acetyl-6-methylpiperidine-3-carboxamidine (50g) in the form of a pink solid for the next step. To a 5.4M solution of sodium methoxide in methanol (99 mL, 535 mmol) in methanol (200 mL) was added a solution of (3R, 6S)-1-acetyl-6-methylpiperidine-3-carboximidamide (49 g, 267 mmol) in methanol (400 mL) and dimethyl malonate (61.4 mL, 535 mmol). The mixture was heated to 50°C and stirred for 24 hours. The mixture was acidified (pH ~ 3) with concentrated hydrochloric acid and concentrated to a small volume. The residue was filtered through silica (20% methanol in dichloromethane) and concentrated to give an orange oil. The crude product was purified by silica gel column chromatography (0% to 20% methanol in dichloromethane) to give 1-((2S, 5R)-5-(4,6-dihydroxypyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (12 g, 17%) as a colorless gum. LCMS (Method C): t R 0.17min,100%,MS(ESI)252.1(M+H) +.A solution of 1-((2S,5R)-5-(4,6-dihydroxypyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (12 g, 47.8 mmol) in phosphorus oxychloride (80 mL, 858 mmol) was stirred at 60 °C for 24 hours. The reaction mixture was concentrated and co-evaporated twice with toluene to give a yellow oil. The oil was dissolved in ethyl acetate and washed with saturated sodium bicarbonate solution. The aqueous layer was extracted twice with ethyl acetate. The combined organic layers were washed with brine, dried over sodium sulfate and concentrated to give a yellow oil. The oil was purified by silica gel column chromatography (0% to 20% tetrahydrofuran in toluene) to give 1-((2S,5R)-5-(4,6-dichloropyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (1.5 g, 11%) as a colorless gum. 1 H-NMR (400 MHz, DMSO-d6, mixture of rotamers) δ7.95 (d, J=7.3 Hz, 1H), 4.85–4.72 (m, 1H), 4.69–4.62 (m, 1H), 4.23–4.13 (m, 1H), 4.07–3.98 (m, 1H), 3.97–3.88 (m, 1H), 3.00–2.89 (m, 1H), 2.81–2.67 (m, 1H), 2.09–1.72 (m, 7H), 1.71–1.58 (m, 2H), 1.25–1.14 (m, 3H), 1.12–1.05 (m, 2H); LCMS (method B): t R 3.34min,MS(ESI)288.0(M+H) + ; Chiral UPLC (Method: A)t R 2.54 min, >95% ee and de. Under argon, a solution of 2-tributylstannylpyrazine (607 mg, 1.65 mmol), 1-((2S,5R)-5-(4,6-dichloropyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (500 mg, 1.74 mmol) and bis(triphenylphosphine)palladium(II) chloride (244 mg, 0.34 mmol) in 1,4-dioxane (20 mL) was heated to 100° C. and stirred for 32 hours. The mixture was diluted with 1% triethylamine in dichloromethane and coated on silica. Purification by silica gel column chromatography (0% to 40% acetonitrile in dichloromethane with 1% triethylamine) gave 1-((2S,5R)-5-(4-chloro-6-(pyrazin-2-yl)pyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (Intermediate 3, 134 mg, 18%) as an orange gum. 1H-NMR (400 MHz, DMSO-d6, mixture of rotamers) δ9.46–9.41 (m, 1H), 8.80–8.76 (m, 1H), 8.65–8.59 (m, 1H), 8.33–8.29 (m, 1H), 7.66–7.59 (m, 1H), 4.86–4.70 (m, 0.5H), 4.27–4.17 (m, 0.5H), 4.09–3.97 (m, 0.5H),3.55–3.41(m,0.5H),3.06–2.98(m,0.5H),2.88–2.82(m,0.5H),2.10–1.90(m,6H),1.8 9–1.76(m,0.5H),1.75–1.61(m,1.5H),1.29–1.20(m,1.5H),1.17–1.10(m,1.5H); LCMS (Method C): t R 1.81min,MS(ESI)331.1(M+H) + .

[0241] Synthesis procedure of final product

[0242] Example 1: Synthesis of 1-((2S,5R)-2-methyl-5-(4-((5-methylpyridin-3-yl)amino)-6-(pyrazin-2-yl)pyrimidin-2-yl)piperidin-1-yl)ethan-1-one (00001) and 1-((2R,5S)-2-methyl-5-(4-((5-methylpyridin-3-yl)amino)-6-(pyrazin-2-yl)pyrimidin-2-yl)piperidin-1-yl)ethan-1-one (00002)

[0243]

[0244] 1M bis(trimethylsilyl)lithium amide in tetrahydrofuran (6.94mL, 6.94mmol) solution was added to a solution of 3-amino-5-methylpyridine (0.751g, 6.94mmol) in tetrahydrofuran (20mL), and the mixture was stirred at room temperature for 10 minutes. Next, a solution of 1-(5-(4,6-dichloropyrimidine-2-yl)-2-methylpiperidin-1-yl)ethyl-1-one (intermediate 1.1g, 3.47mmol) in tetrahydrofuran (20ml) was added, and the mixture was stirred at room temperature for 2 hours. The mixture was poured into a saturated ammonium chloride solution and extracted twice with ethyl acetate. The combined organic layer was washed once with brine, dried over sodium sulfate and concentrated to give a yellow solid. The solid was purified by silica gel column chromatography (0% to 5% methanol in dichloromethane) to give 1-(5-(4-chloro-6-((5-methylpyridin-3-yl)amino)pyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (788 mg, 60%) as a yellow foam. LCMS (Method B): tR 1.81 min, 100%, MS (ESI) 360.1 (M+H) +. Under nitrogen, 2-(tributylstannyl)pyrazine (103 mg, 0.28 mmol), 1-(5-(4-chloro-6-((5-methylpyridin-3-yl)amino)pyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (50 mg, 0.14 mmol) and bis(triphenylphosphine)palladium(II) dichloride (9.75 mg, 0.01 mmol) were dissolved in N,N-dimethylformamide (3 mL). The mixture was heated to 80° C. for 24 hours and then cooled to room temperature. The mixture was eluted through a C18 plug using acetonitrile and the filtrate was purified by reverse phase chromatography (Method B) and lyophilized to give 1-(2-methyl-5-(4-((5-methylpyridin-3-yl)amino)-6-(pyrazin-2-yl)pyrimidin-2-yl)piperidin-1-yl)ethan-1-one (22 mg, 37%) as a white solid. The obtained mixture of cis enantiomers was submitted to chiral preparative SFC (Method A) and lyophilized to give two stereoisomers.1-((2S,5R)-2-methyl-5-(4-((5-methylpyridin-3-yl)amino)-6-(pyrazin-2-yl)pyrimidin-2-yl)piperidin-1-yl)ethan-1-one (5 mg, 22%) LCMS (Method D): tR 3.17 min, 100%, MS (ESI) 404.1 (M+H)+; Chiral UPLC (Method: A): tR 3.17 min,>95% ee and de. 1-((2R,5S)-2-methyl-5-(4-((5-methylpyridin-3-yl)amino)-6-(pyrazin-2-yl)pyrimidin-2-yl)piperidin-1-yl)ethan-1-one (6 mg, 27%) LCMS (Method D): tR 3.17 min, 100%, MS (ESI) 404.2 (M+H)+; Chiral UPLC (Method A): tR 4.60 min, >95% ee and de.

[0245] Compound 00003 (which is also referred to herein as Compound B) and 00004 (which is also referred to herein as Compound A) were prepared using a method similar to Example 1 using appropriate starting materials.

[0246]

[0247] Example 2: Synthesis of 1-((2S,5R)-5-(4-(imidazo[1,2-a]pyridin-6-ylamino)-6-(pyridin-3-yl)pyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (00013)

[0248]

[0249] Under argon, a solution of 3-(tributylstannyl)pyridine (607 mg, 1.65 mmol), 1-((2S,5R)-5-(4,6-dichloropyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (Intermediate 2, 500 mg, 1.74 mmol) and bis(triphenylphosphine)palladium(II) chloride (244 mg, 0.34 mmol) in 1,4-dioxane (20 mL) was heated to 100° C. and stirred for 32 hours. The mixture was diluted with 1% triethylamine in dichloromethane and coated on silica. Purification by silica gel column chromatography (0% to 40% acetonitrile in dichloromethane with 1% triethylamine) gave 1-((2S,5R)-5-(4-chloro-6-(pyridin-3-yl)pyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (134 mg, 18%) as an orange gum. LCMS (Method C): tR 1.81 min, 100%, MS (ESI) 331.1 (M+H) +. To a solution of 1-((2S,5R)-5-(4-chloro-6-(pyridin-3-yl)pyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (30 mg, 0.09 mmol) in 2-propanol (2 ml) was added imidazo[1,2-a]pyridin-6-amine (36.2 mg, 0.27 mmol) and hydrochloric acid (0.02 mL, 0.27 mmol). The mixture was stirred at 60° C. for 16 hours, poured into saturated aqueous sodium bicarbonate solution, and extracted twice with ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated to give a yellow oil. The oil was purified by reverse phase chromatography (Method B) and lyophilized to give 1-((2S,5R)-5-(4-(imidazo[1,2-a]pyridin-6-ylamino)-6-(pyridin-3-yl)pyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one as a cyan solid. LCMS (Method B): tR 2.19 min, 100%, MS (ESI) 428.1 (M+H)+.

[0250] Compound 00030 was prepared in a similar manner to Example 2 using appropriate starting materials.

[0251]

[0252] Example 3A: Synthesis of 1-((2S,5R)-2-methyl-5-(4-((2-methylpyridin-4-yl)amino)-6-(pyridin-3-yl)pyrimidin-2-yl)piperidin-1-yl)ethan-1-one (00071)

[0253]

[0254] To a solution of 2-methylpyridine-4-amine (3.19 g, 29.5 mmol) in anhydrous tetrahydrofuran (100 mL) was added a 1 M solution of lithium bis(trimethylsilyl)amide in tetrahydrofuran (29.5 mL, 29.5 mmol), and the mixture was stirred for 10 minutes. Next, a solution of 1-((2S, 5R)-5-(4,6-dichloropyrimidine-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (intermediate 2, 850 mg, 2.95 mmol) in anhydrous tetrahydrofuran (100 mL) was added within 10 minutes, and the mixture was stirred at room temperature for 2 hours. The mixture was poured into a saturated ammonium chloride solution and extracted twice with ethyl acetate. The combined organic layer was washed once with brine, dried over sodium sulfate and concentrated to give a brown oil. The oil was purified by silica gel column chromatography (80% to 100% ethyl acetate in n-heptane, then 0% to 10% methanol in dichloromethane) to give 1-((2S,5R)-5-(4-chloro-6-((2-methylpyridin-4-yl)amino)pyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (275 mg 25%) as a yellow oil. LCMS (Method A): tR 1.49 min, 100%, MS (ESI) 360.1 (M+H)+. Under nitrogen, 1-((2S,5R)-5-(4-chloro-6-((2-methylpyridin-4-yl)amino)pyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (275 mg, 0.76 mmol), sodium carbonate (162 mg, 1.53 mmol), pyridine-3-boronic acid (188 mg, 1.53 mmol) and PdCl2(dppf)-CH2Cl2 adduct (62.4 mg, 0.08 mmol) were dissolved in a mixture of 1,2-dimethoxyethane (6 mL) and water (2 mL). The mixture was heated to 80° C. for 1 hour, filtered through a C18 plug and concentrated to give a dark residue. The residue was purified by reverse phase chromatography (Method B) and lyophilized to give a pale yellow solid. The product was further purified by chiral preparative SFC (Method B) and lyophilized to give 1-((2S,5R)-2-methyl-5-(4-((2-methylpyridin-4-yl)amino)-6-(pyridin-3-yl)pyrimidin-2-yl)piperidin-1-yl)ethan-1-one (135 mg, 41%) as a beige solid. LCMS (Method D): tR 3.06 min, 100%, MS (ESI) 403.2 (M+H)+; Chiral SFC (Method B): tR 3.60 min, >95% ee and de.

[0255] Example 3B: Synthesis of 1-((2S,5R)-2-methyl-5-(4-((3-(1-methyl-1H-1,2,3-triazol-4-yl)phenyl)amino)-6-(pyrazin-2-yl)pyrimidin-2-yl)piperidin-1-yl)ethan-1-one (Compound C)

[0256]

[0257] 3-(1-methyl-1H-1,2,3-triazol-4-yl)aniline (188 mg, 1.08 mmol) and hydrochloric acid (0.08 mL, 1.08 mmol) were added to a solution of 1-((2S,5R)-5-(4-chloro-6-(pyrazin-2-yl)pyrimidin-2-yl)-2-methylpiperidin-1-yl)ethan-1-one (Intermediate 3, 120 mg, 0.36 mmol) in 2-propanol (2 mL). The mixture was stirred at 70 ° C for 16 hours, poured into saturated sodium bicarbonate aqueous solution, and extracted twice with ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated to give a yellow oil. The oil was purified by reverse phase chromatography (Method B) and lyophilized to give 1-((2S,5R)-2-methyl-5-(4-((3-(1-methyl 1H-1,2,3-triazol-4-yl)phenyl)amino)-6-(pyrazin-2-yl)pyrimidin-2-yl)piperidin-1-yl)ethan-1-one (Compound C, 102 mg, 60%) as a white solid. 1 H-NMR (400 MHz, DMSO-d6, mixture of rotamers) δ10.01 (d, J=5.6 Hz, 1H), 9.56 (dd, J=11.0, 1.1 Hz, 1H), 8.80 (d, J=1.5 Hz, 2H), 8.54–8.42 (m, 2H), 7.72–7.54 (m, 2H), 7.53–7.39 (m, 2H), 4.86–4.76 (m, 1H), 4.27–4.16 (m, 0.5H) ,4.15–4.03(m,3.5H),3.58–3.42(m,0.5H),3.00–2.86(m,1H),2.86–2.68(m,0.5H),2.17–1.96(m,5H),1 .93–1.77(m,0.5H),1.76–1.64(m,1.5H),1.27(d,J=6.8Hz,1.5H),1.13(d,J=7.0Hz,1.5H); LCMS (Method D): t R 3.31min,MS(ESI)470.2(M+H) + .

[0258] Example 4: Crystal structure of human CREBBP bromodomain in complex with compound 00004 and BROMOscan of compound A, compound C and CCS1477 TM Results

[0259] Crystallization

[0260] Experimental setup: The construct used for crystallization contained residues 1081 to 1197. Crystals of CREBBP in complex with compound 00004 were obtained using a hanging drop vapor diffusion apparatus. CREBBP (10 mM Hepes, 500 mM NaCl, 5% glycerol, 0.5 mM TCEP, pH 7.4) at a concentration of 20.3 mg / ml was pre-incubated with 4.3 mM (3.0-fold molar excess) of 00004 (150 mM in DMSO) for 1 hour. 1 μl of protein solution was then mixed with 1 μl of reservoir solution (0.1 M MgCl2, 0.1 M MES / NaOH pH 6.3, 18% (w / v) PEG 6000 and 10% (v / v) ethylene glycol) and equilibrated with 0.4 ml of reservoir solution at 4°C. Well-diffracting crystals appeared and grew to full size within 4 days.

[0261] Data Collection

[0262] Prior to mounting, crystals were cryoprotected by adding 10% glycerol (final concentration) to the crystallization drop. The complete crystals of CREBBP / 00004 were collected at the Diamond Light Source (Didcot, UK, beamline i03). Datasets,The data were integrated, analyzed, and scaled by XDS, Pointless, and Aimless within the,autoPROC pipeline (Table 1).

[0263] Table 1: Data collection statistics

[0264]

[0265] Structure determination and refinement

[0266] Molecular replacement was performed using the previously determined CREBBP structure as a starting model. Several rounds of alternating manual reconstruction and refinement using REFMAC5 produced the final model (Table 2). Atomic displacement factors were modeled using an isotropic B factor per atom.

[0267] Table 2: Detailed statistics

[0268]

[0269] Results: We prepared CREBBP / 00004 crystals, which diffracted to The resolution of the protein-ligand complex was 1.37 × 10.84 nm and the three-dimensional structure of the protein-ligand complex was determined. In the Fo-Fc omit map of the initial model, the clear electron density of the compound binding site in each chain of CREBBP revealed the binding of the entire compound ( Figure 7 ) and allowed its unambiguous placement. In addition, the structure also confirmed the absolute stereochemistry of compound 00004 (2S, 5R on the piperidine moiety).

[0270] BromoKdMAX-Assay

[0271] BromoKdMAX was performed in DiscoverX. This assay can be used to determine if a compound binds to the bromodomain of p300 and / or the bromodomain of CBP with a specific Kd (eg, 100 nM or lower).

[0272] The assay principle is as follows: BROMOscan TM It is a new industry-leading platform for identifying small molecule bromodomain inhibitors. TM Technology, BROMOscan TM A proprietary ligand binding site-specific competition assay is used to quantitatively measure the interaction between test compounds and bromodomains. This robust and reliable panel is suitable for high-throughput screening and provides quantitative ligand binding data to facilitate the identification and optimization of potent and selective small molecule bromodomain inhibitors. BROMOscan TM The assay includes trace bromodomain concentrations (<0.1 nM), thereby reporting true thermodynamic inhibitor Kd values ​​over a wide affinity range (<0.1 nM to >10 uM).

[0273] The assay was performed as follows: For bromodomain analysis, T7 phage strains displaying bromodomains were grown in parallel in 24-well blocks in E. coli hosts from BL21 strains. E. coli were grown to logarithmic growth phase, infected with T7 phage from frozen stock (infection multiplicity = 0.4), and incubated with shaking at 32°C until lysis (90-150 minutes). The lysate was centrifuged (5000 x g) and filtered (0.2 μm) to remove cell debris. Streptavidin-coated magnetic beads were treated with biotinylated small molecules or acetylated peptide ligands for 30 minutes at room temperature to generate affinity resins for bromodomain assays. Liganded beads were blocked with excess biotin and washed with blocking buffer (SeaBlock (Pierce), 1% BSA, 0.05% Tween 20, 1 mM DTT) to remove unbound ligands and reduce nonspecific phage binding. Binding reactions were assembled by combining bromodomains, liganded affinity beads and test compounds (i.e., Compound A, Compound C, or CCS1477) in 1x binding buffer (17% SeaBlock, 0.33x PBS, 0.04% Tween 20, 0.02% BSA, 0.004% sodium azide, 7.4mM DTT). Test compounds were prepared as 1000X stocks in 100% DMSO. Kd was determined using an 11-point 3-fold compound dilution series and one DMSO control point. All compounds used for Kd measurements were dispensed in 100% DMSO by acoustic transfer (non-contact dispensing). Compounds were then diluted directly into the assay to a final DMSO concentration of 0.09%. All reactions were performed in polypropylene 384-well plates. The final volume of each aliquot was 0.02 ml. The assay plates were incubated with shaking at room temperature for 1 hour and the affinity beads were washed with wash buffer (1x PBS, 0.05% Tween 20). The beads were then resuspended in elution buffer (1x PBS, 0.05% Tween 20, 2 μM non-biotinylated affinity ligand) and incubated for 30 minutes at room temperature with shaking. The bromodomain concentration in the eluate was measured by qPCR.

[0274] The results are as follows:

[0275]

[0276]

[0277]

[0278] The corresponding data are publicly available i) for SGC-CBP30, e.g. in the supplementary information of Wu et al., NATURE COMMUNICATIONS (2019) 10:1915 https: / / doi.org / 10.1038 / s41467-09672-2; ii) for GNE-781, e.g. in Romero et al., J. Med. Chem. 2017, 60, 9162-9183; and iii) for FT-6876, e.g. in poster #3079 presented at the AACR Annual Meeting 2020, Virtual Session II, June 22-24, 2020 (titled “FT-6876, a potent and selective inhibitor of CBP / p300 with antitumor activity in AR-positive breast cancer”).

[0279] Example 5

[0280] Materials and methods

[0281] Gene expression analysis:

[0282] One day before drug treatment, 250,000 HCC827 (ATCC; CRL 2868; with EGFR exon 19 deletion E746-A750) cells / well or 200,000 NCI-H1975 (ATCC; CRL 5908; with EGFR L858R and T790M) cells / well were seeded in 6-well culture dishes (Greiner Bio-One, 7657160) in RPMI medium containing 10% FCS and 2 mM L-glutamine. Then treat with DMSO, EGFR inhibitor (for HCC827 gefitinib [final 100nM, LC Laboratories G-4408]; for NCI-H1975 osimertinib [final 20nM, LC Laboratories; O-7200]) with or without 1μM compound A (compound A is also referred to as compound 00004 herein), CCS1477 (Chemgood; C1505), A-485 (Lucerna-Chem; HY-107455) or ICG-001 (Selleckchem, S2662) for 24 hours. The cells were then washed 3 times with 2ml PBS and lysed in 300μl lysis buffer (RA1+1% TCEP [Sigma 646547]). RNA was extracted according to Macherey-Nagel NucleoSpin 8RNA Kit protocol for vacuum (740698.5) for RNA extraction and eluted in H2O. 0.5-2 μg RNA was reverse transcribed using the Thermo Scientific High Capacity cDNA Reverse Transcription Kit (4368813). Equal amounts of cDNA were then subjected to qPCR analysis using the KapaSYBR Fast Kit (KK4611) in a 384-well format in a Roche Light Cycler 480. Gene expression of genes was assessed by subtracting the CT value of the watchdog gene (b-Actin) from the CT of the gene of interest and calculating the ΔΔCT by subtracting the DMSO control value from the sample of interest, and finally calculating the fold change difference between the treated sample and the control treated sample.

[0283] Primers:

[0284] ACTB (b-Actin): fwd 5`GCC CCAGCTCACCATGGAT 3` (SEQ ID NO: 1), rev 5`TGGGCCTCGTCGCCCACATA 3` (SEQ ID NO: 2);

[0285] ALPP: fwd 5`AGAAAGCAGGGAAGTCAGTGG 3` (SEQ ID NO: 3), rev5`CGAGTACCAGTTGCGGTTCA 3` (SEQ ID NO: 4);

[0286] HOPX: fwd 5`GACCATGTCGGCGGAGACC 3` (SEQ ID NO: 5), rev 5`GCGCTGCTTAAACCATTTCTGGG 3` (SEQ ID NO: 6).

[0287] Bromodomain- and HAT-domain-binding CBP / p300 inhibitors, but not inhibitors that block the interaction between CBP and β-catenin, blunted EGFR inhibitor-induced gene expression in EGFR-mutant non-small cell lung cancer (NSCLC) cells.

[0288] Gene expression of Compound A was evaluated in parallel with other CBP / p300 inhibitors (CBP-I) with different modes of action (i.e., binding to different protein domains of CBP / p300). Compound A and CCS1477 bind to the bromodomain of CBP / p300 (BRD-I), A-485 targets the catalytic histone acetyltransferase (HAT) activity of CBP / p300 (HAT-I), and ICG-001 disrupts the interaction of CBP with β-catenin (CBP / β-Cat-I).

[0289] Figure 1 shows the results, and the regulated genes shown are ALPP (alkaline phosphatase, placental type; Figure 1A and Figure 1C) and HOPX (homeodomain-only protein; Figure 1B and Figure 1D). Gene expression in HCC827 exposed to 20nM gefitinib (EGFR inhibitor) or exposed to 1μM different CBP inhibitors in the presence of 20nM gefitinib for 24 hours (Figure 1A-B). Gene expression in NCI-H1975 (carrying the EGFR T790M mutation that causes gefitinib resistance) was exposed to 20nM osimertinib (third generation EGFR inhibitor) or in 1μM different CBP / p300 inhibitors in the presence of 20nM osimertinib for 24 hours. Data are from two independent experiments of qPCRs (mean ± SEM) (Figure 1C-D).

[0290] Results: Two EGFR-mutated NSCLC cell lines responded to treatment with two different EGFR inhibitors (first-generation gefitinib and third-generation osimertinib) with upregulation of the example genes ALPP and HOPX. Compounds A and CCS1477 (both CBP / p300 bromodomain binders) and A-485 (catalytic inhibition of CBP / p300) reversed EGFR inhibitor-induced gene expression. A different mode-of-action compound (ICG001) that blocks the interaction of CBP with β-catenin did not blunt EGFR-induced gene expression.

[0291] Example 6

[0292] Materials and methods

[0293] Cell counting:

[0294] One day before drug treatment in RPMI medium containing 10% FCS and 2 mm L-glutamine, 2000 HCC 827 (ATCC; CRL 2868) cells / well were seeded into 96-well plates (Greiner BioOne 655090). Several plates were seeded and one plate was fixed and stained for analysis for each time point of cell counting. The next day, cells were treated with the indicated compounds and concentrations in combination with DMSO or gefitinib (20 nM in Figure 2 or 300 nM in Figure 3). [Figure 2 shows compounds A and B; Figure 3 shows compound A, CCS 1477 (Chemgood; C1505), SGC-CBP 30 (Selleckchem; S7256 CAS No.: 1613695-14-9), A-485 (Lucerna-Chem; HY-107455), compound 00071, and compound 00030]. Cell cultures were continued until the fixation and analysis time for each plate. For extended time points, media and drugs were replenished twice weekly.

[0295] Fixation and imaging:

[0296] At a given time, the plate was washed 3 times with PBS and the cells were fixed with 80 μl of 4% PFA for 10 min, RT. After washing 3 times with PBS, the cells were stained with 10 μg / ml Hoechst 33342 (Thermo Scientific h 12492) in 100 μl PBS for 2 h, RT, dark. After 3 PBS washing steps, the Hoechst 33342 signal was collected in automatic imaging mode using a Zeiss Apotome with an electric X / Y platform and a 5x objective. Image analysis and determination of Hoechst 33342 spots (nuclei) were performed using ImageJ. The number of nuclei was plotted as a function of time using GraphPad Prism.

[0297] Label-free assay for cell proliferation:

[0298] One day before drug treatment in RPMI medium containing 10% FCS and 2mM L-glutamine, 2000HCC827 (ATCC; CRL 2868) cells / well or 2000NCI-H1975 (ATCC; CRL 5908) were seeded into 96-well plates (GreinerBioOne 655090). The next day, the wells were imaged label-free using brightfield imaging on a CELIGO imaging blood cell counter to determine the initial cell number. Subsequently, cells were treated with DMSO, a single drug or a drug combination, and imaged regularly for several weeks using brightfield mode (CELIGO imaging blood cell counter) to track cell proliferation in each well over time. Growth medium and treatment were supplemented twice a week. Drugs and concentrations of HCC827: 300nM gefitinib, 1μM compound A, and 300nM gefitinib + 1μM compound A. Drugs and concentrations: NCI-H1975: 50 nM osimertinib (LC Laboratories; O-7200), 0.125, 0.5 or 2 μM CCS 1477 (Chemgood; C1505) and 0.125, 0.5 or 2 μM Compound A or combinations as indicated in the figures. Cell numbers were determined in brightfield mode using the built-in “Direct Cell Counting” analysis tool of the CELIGO software.

[0299] Only the enantiomer that binds to the CBP / p300 bromodomain (Compound A), but not the enantiomer that does not bind to the CBP / p300 bromodomain (Compound B), enhanced the EGFR inhibitor-mediated inhibition of NSCLC cell proliferation in a concentration-dependent manner.

[0300] The cell number of EGFR mutant HCC827 cells was monitored over time. Figure 2AShown are cells treated with DMSO alone (filled circles), 20 nM EGFR inhibitor (gefitinib; first generation EGFR inhibitor, open circles) alone, or in combination with the active enantiomer of the CBP / p300 BRD inhibitor Compound A (upper panel) or its enantiomer Compound B that does not bind to the bromodomain of CBP / p300 (Compound B is also referred to herein as Compound 00003) (lower panel) at the indicated compound concentrations. Figure 2B HCC827 cells were exposed to Compounds A & B in the absence of EGFR inhibitors. Graphs presented are from one experiment with three replicates per time point and condition (mean ± SD).

[0301] Results: HCC827 cell numbers initially decreased under 20 nM gefitinib treatment but began to regrow with continued gefitinib exposure. Regrowth was suppressed by BRD-I compound A over the study period through inhibition of CBP / p300, whereas there was no inhibition with the corresponding non-bromodomain binding enantiomer, compound B. Interestingly, although BRD-I had no effect as a single agent, its effect in preventing regrowth was present in combination therapy.

[0302] Compound A and benchmark CBP / p300 inhibitor in combination with EGFR inhibitor mediated inhibition of HCC827 cell proliferation.

[0303] Figure 3 (A), (B), (C), (D) and (E) show the cell number of EGFR-mutated NSCLC cell line HCC827 as a function of drug treatment time [days] measured using nuclear fluorescence staining in 96-well plates (symbols in the graph legends). Figure 3 (A) and (B) and (C) Left: Compound A ( Figure 3A )、CCS1477( Figure 3B )、SGC-CBP30( Figure 3C ) or A485 were treated with a single agent. Figure 3 (A) and (B) and (C) right and Figure 3 (C) and (D): Compound A ( Figure 3A ) and CCS1477(CBP / p300 BRD-I)( Figure 3B ) and compound SGC-CBP30( Figure 3C ) and compound 00071( Figure 3D ) and compound 00030( Figure 3E ) and A485 (CBP / p300 HAT-I). The curves presented are from one experiment performed in triplicate (mean ± SD), and similar results were obtained in similar experiments.

[0304] Figure 4A shows the evaluation of the number of HCC827 cells over time [h]. In the absence of EGFR inhibitors, compound A does not affect the cell proliferation of EGFR-mutated NSCLC cells, but when used in combination with EGFR inhibitors, it can prevent the development of resistance (showing 1 example plate, gefitinib n = 24 wells, gefitinib + compound A treatment n = 24 wells, DMSO: n = 6, compound A: n = 6, mean ± SD). Figure 4B depicts the number of cells per well treated with gefitinib or gefitinib + compound A for 0 or 22 days (from 2 experimental plates as in A, n = 48 wells per condition), as shown in the dot plot. Figure 4C Shown are waterfall plots of wells from 2 plates (n=48 wells / condition) analyzed in Figure 4A treated with 300 nM gefitinib or 300 nM gefitinib + 1 μM Compound A. The increase in cell number per well on day 22 was calculated as the log fold change from the initial cell number per well before drug treatment (day 0).

[0305] result:

[0306] Figure 3A , 3B , 3C, 3D, and 3E: After treatment with 300 nM gefitinib, HCC827 cell numbers initially decreased but began to regrow with continued exposure to gefitinib. During the study period, regrowth was inhibited by inhibiting CBP / p300 using five independent BRD-I or HAT-I. Interestingly, although BRD-I did not work as a single agent, its effect in preventing regrowth was present in combination therapy.

[0307] Figure 4A 4B and 4C: Compound A alone had little / no effect on cell number, while 300 nM gefitinib initially completely blocked cell proliferation. However, in long-term culture, cells re-grew if treated with gefitinib alone, while co-treatment with Compound A significantly delayed or completely prevented re-growth over the time period studied (>22 days).

[0308] Compound A and benchmark CBP / p300 inhibitor combined with EGFR inhibitor mediated inhibition of NSCLC cell proliferation-NCI-H1975.

[0309] Figure 5(A) shows the evaluation of NCI-H1975 cell number as a function of time [h] in the presence of DMSO, 50nM osimertinib, 2μM Compound A, or a combination of 50nM osimertinib and 2.0, 0.5, or 0.125μM Compound A. Figure 5(B) shows the evaluation of NCI-H1975 cell growth in the presence of DMSO, 50nM osimertinib, 2μM CCS1477, or a combination of 50nM osimertinib and 2.0, 0.5, or 0.125μM CCS1477. (Example figures show a copy of each data and time point, and logistic growth curve fits were calculated in GraphPad Prism).

[0310] Results: Figure 5: The combined effect of CBP / p300BRD-I and EGFR-I holds for further EGFR-mutated NSCLC cell lines and different EGFR-I compounds. Compound A and CCS1477 alone had no / weak effects on cell number, whereas 50 nM osimertinib initially blocked cell proliferation. However, in the long term, cells continued to grow at a slow rate even in the presence of 50 nM osimertinib, which was delayed by combined treatment with compound A or CCS1477 in a dose-dependent manner.

[0311] Example 7

[0312] Xenografts: 2 million NCI-H1975 cells (ATCC; CRL 5908) were injected into both flanks of NMRI nude mice (Janvier). 3 Around 20:00, mice were divided into treatment groups. Mice were treated orally with the following daily: vehicle (30% PEG300 / H2O; 202371Sigma-Aldrich), 20mg / kg CCS 1477 (ChemieTek; CT-CCS1477), 2mg / kg osimertinib (O-7200LC Laboratories) or a combination of 2mg / kg osimertinib and 20mg / kg CCS1477 (premixed DMSO stock solution). Tumor volume was measured two to three times a week with a manual caliper. Tumor volume was calculated using the following formula: larger tumor diameter × smaller tumor diameter squared divided by 2. Based on the linear fit of the mean tumor volume, the slope of the curve was compared by regression analysis (two-tailed). Significant differences were detected between the osimertinib group and the osimertinib / CCS1477 group. No significant differences were observed between vehicle and CCS1477 monotherapy.

[0313] The response was determined by comparing the change in tumor volume at time t to its baseline: % tumor volume change = ΔVolt = 100% × ((Vt–Vinitial) / Vinitial). The best response was the minimum value of ΔVolt at t≥10d. For each time t, the average of ΔVolt from t=0 to t was also calculated. The best average response was defined as the minimum value of this average at t≥10d. This metric captures the combination of speed, intensity, and durability of the response into a single value. The response criteria (mRECIST) were adapted from RECIST criteria 21 and are defined as follows (applied in this order): mCR, best response <-95% and best mean response <-40%; mPR, best response <-50% and best mean response <-20%; mSD, best response <35% and best mean response <30%; mPD, not otherwise classified. Mice sacrificed due to adverse events before completing the 14-day trial were removed from the data set.

[0314] In vivo efficacy of the combination of EGFRi and CBP / p300i

[0315] Fig. 6 (A) shows the mean tumor volume (+ SEM) of EGFR mutant NCI-H1975 xenografts plotted over time. Four different treatment groups are described: vehicle (30% PEG300 / H2O; cross circles; n = 4), 20 mg / kg CCS1477 (open circles; n = 4), 2 mg / kg osimertinib (solid circles; n = 9) or a combination of 2 mg / kg osimertinib and 20 mg / kg CCS1477 (half-solid circles; n = 10). Fig. 6 (B) shows the best average response of all 4 treatment groups shown in the waterfall graph (vehicle is gray, 20 mg / kg CCS1477 is white, 2 mg / kg osimertinib is black and 2 mg / kg osimertinib and 20 mg / kg CCS1477 are squares. The dotted line indicates that the initial tumor volume is reduced by 30%.

[0316] Results: Figure 6: When bromodomain inhibitors of CBP / p300 were used without EGFR inhibitors, they had no effect on the growth of EGFR-mutated non-small cell lung cancer xenografts. However, when they were combined with EGFR inhibitors, the response to treatment increased and tumor size was better controlled throughout the treatment course. Surprisingly, when the bromodomain binding inhibitor (CCS1477) was combined with the EGFR inhibitor (osimertinib), the response rate to treatment was improved despite the lack of response to the bromodomain binding inhibitor (CCS1477) alone.

[0317] Example 8

[0318] Materials and methods:

[0319] CBP bromodomain binding assay (TR-FRET):

[0320] 10mM compound DMSO solution was pre-diluted to 25x DMSO stock solution in DSMO. Then diluted to 4x in detection buffer. A series of dilutions were performed in detection buffer to keep the DMSO concentration stable. 5μl of compound in assay buffer was transferred into the assay plate (provided by the assay kit) and the TR-FRET assay (Cayman chemicals; 600850) was performed according to the manufacturer's instructions. After incubation in the dark for 1 hour at room temperature, the assay plate was read in the TecanM1000 plate reader using the TR-FRET mode (top reading; excitation 340nM bandwidth 20nM; emission 620nM bandwidth 7nM; optimal gain determined for the first well, number of flashes: 5; flash frequency 100Hz; integration time: 500μs, lag time: 100μs, room temperature). The TR-FRET ratio was calculated by dividing the 670nm emission by the 620nm emission. EC50 was calculated based on the normalized value (DMSO=1) and the positive control (0). Values ​​were log-transformed and fitted to dose-response curves using nonlinear regression (4 parameters) with variable slope to estimate EC50 values ​​(see Table 3 below).

[0321] Table 3:

[0322] EC50: A*<0.2μM <A<1μM<B<10μM<C

[0323]

[0324] TR-FRET data indicated that compound 00003, with an EC50 > 10 μM, did not meet the definition of a CBP / p300 bromodomain inhibitor in this paper.

[0325] Example 9

[0326] Materials and methods

[0327] Label-free assay for cell proliferation:

[0328] The day before drug treatment in RPMI medium containing 10% FCS and 2mM L-glutamine, 2000 HCC4006 (ATCC; CRL2871; with EGFR exon 19 deletion L747 to E749) were seeded into 96-well plates (GreinerBioOne 655090). The next day, the wells were imaged label-free using bright field imaging on a CELIGO ImageCytometer to determine the initial cell number. Subsequently, the cells were treated with DMSO, a single drug, or a combination of drugs and imaged regularly over several weeks using bright field mode (CELIGO imaging blood cell counter) to track the proliferation of cells in each well over time. Growth medium and treatments were replenished twice a week. Drugs and concentrations of HCC4006: 300nM gefitinib (LCLaboratories; G-4408), 1μM compound A, and 300nM gefitinib + 1μM compound A. Cell numbers were determined in bright field mode using the “Direct Cell Counting” analysis tool built into the CELIGO software.

[0329] Figure 8 A shows the evaluation of the change in HCC4006 cell number over time [in days]. In the absence of EGFR inhibitors, compound A did not affect the cell proliferation of EGFR-mutated NSCLC cells, but when combined with EGFR inhibitors, it prevented the development of drug resistance (DMSO: n=6, compound A: n=6, gefitinib: n=24, gefitinib + compound A: n=24, mean ± SD). Figure 8 B depicts the number of cells per well treated with gefitinib or gefitinib + Compound A for 0 or 20 days as shown in dot plots (based on the experiment in A, 24 wells per condition, "+" in the x-axis label indicates gefitinib + Compound A). Figure 8 C shows waterfall plots of wells treated with 300 nM gefitinib or 300 nM gefitinib + 1 μM Compound A (24 wells / each condition), as analyzed in Figure 4A. The increase in cell number on day 20 in each well was calculated as the log fold change from the initial cell number in each well before drug treatment (day 0).

[0330] result: Figure 8 A, 8B and 8C: Compound A alone had no / at best very weak effects on HCC4006 cell number, whereas 300 nM gefitinib initially completely blocked cell proliferation. In long-term cultures, HCC4006 cells could regrow if treated with gefitinib alone, whereas co-treatment with Compound A completely prevented regrowth over the time period studied (>20 days).

[0331] Example 10

[0332] Materials and methods

[0333] Label-free assay for cell proliferation:

[0334] One day before drug treatment in RPMI medium containing 10% FCS and 2mM L-glutamine, 2000 HCC 827 (ATCC; CRL 2868) were seeded into 96-well plates (Greiner BioOne 655090). The next day, the wells were imaged label-free using bright field imaging on a CELIGO image cytometer to determine the initial cell number. Cells were then treated with DMSO, a single drug (osimertinib and each CBP / p300 bromodomain inhibitor) or a drug combination of 100nM osimertinib and a CBP / p300 bromodomain inhibitor, and the drug concentrations were as follows. The plates were imaged regularly for several weeks using bright field mode (CELIGO imaging blood cell counter) to track the proliferation of cells in each well over time. Growth medium and treatments were replenished twice a week. Drugs and concentrations for HCC827: 100 nM osimertinib (EGFR-inhibitor, LC Laboratories; O-7200) and for CBP / p300 bromodomain inhibitors: 1 μM compound A, 0.2 μM compound C, 0.2 μM CCS1477 (ChemiTek; CT-CCS1477), 1 μM FT-6876 ("CBP / P300-IN-8", MedChemExpress; HY-136920) and 0.2 μM GNE-781 (MedChemExpress; HY-108696). Cell number was determined in bright field mode using the built-in "direct cell counting" analysis tool of the CELIGO software.

[0335] Fig. 9 AE shows the evaluation of HCC827 cell numbers over 21 days. In the absence of EGFR inhibitors, CBP / p300 bromodomain inhibitors [(A) Compound A, (B) Compound C, (C) CCS1477, (D) FT-6876, and (E) GNE-781)] did not affect the proliferation of EGFR-mutated NSCLC cells but prevented the development of resistance to 100 nM osimertinib when combined with osimertinib. Note that Fig. 9 In AE, DMSO curves and time courses for 100 nM osimertinib treatment are identical because all conditions were run in parallel (DMSO: 18 wells, CBP / p300 bromodomain inhibitors: 6 wells each, osimertinib: 12 wells, and all combinations of osimertinib + CBP / p300 bromodomain inhibitors: 12 wells, mean ± SD).

[0336] result: Fig. 9 AE: CBP / p300 bromodomain inhibitors alone had no / at most weak effects on HCC827 cell numbers, whereas 100 nM osimertinib initially blocked cell proliferation. In long-term cultures, HCC827 cells could regrow if treated with osimertinib alone, whereas combined treatment with different CBP / p300 bromodomain inhibitors completely prevented regrowth over the 21-day period studied.

[0337] Embodiment 11

[0338] Materials and methods

[0339] Label-free assay for cell proliferation:

[0340] 2000 HCC4006 (ATCC; CRL2871) were seeded into 96-well plates (Greiner BioOne655090) one day before drug treatment in RPMI medium containing 10% FCS and 2mM L-glutamine. The next day, the wells were imaged label-free using bright field imaging on a CELIGO image flow cytometer to determine the initial cell number. Subsequently, cells were treated with DMSO, a single drug (osimertinib and each CBP / p300 bromodomain inhibitor) or a drug combination of 100nM osimertinib and a CBP / p300 bromodomain inhibitor (drug concentrations are shown below). The plates were imaged regularly for several weeks using bright field mode (CELIGO imaging blood cell counter) to track the proliferation of cells in each well over time. Growth medium and treatments were replenished twice a week. Drugs and concentrations for HCC827: 100 nM osimertinib (EGFR-inhibitor, LC Laboratories; O-7200) and for CBP / p300 bromodomain inhibitors: 1 μM compound A, 0.2 μM compound C, 0.2 μM CCS1477 (ChemiTek; CT-CCS1477), 1 μM FT-6876 ("CBP / P300-IN-8", MedChemExpress; HY-136920) and 0.2 μM GNE-781 (MedChemExpress; HY-108696). Cell number was determined in bright field mode using the "direct cell counting" analysis tool built into the CELIGO software.

[0341] Fig.10AE shows the evaluation of HCC4006 cell numbers over 21 days. In the absence of EGFR inhibitors, CBP / p300 bromodomain inhibitors [(A) Compound A, (B) Compound C, (C) CCS1477, (D) FT-6876, and (E) GNE-781)] did not affect the proliferation of EGFR-mutant NSCLC cells but prevented the development of resistance to 100 nM osimertinib when co-administered with osimertinib. Note that in panels (AE), the DMSO curves and time course of 100 nM osimertinib treatment are identical because all conditions were run in parallel (DMSO: 18 wells, CBP / p300 bromodomain inhibitors: 6 wells each, osimertinib: 12 wells, and all combinations of osimertinib + CBP / p300 bromodomain inhibitors: 12 wells, mean ± SD).

[0342] result: Fig.10 AE: CBP / p300 bromodomain inhibitors alone had no / at most weak effects on HCC4006 cell numbers, whereas 100 nM osimertinib initially blocked cell proliferation. In long-term culture, HCC4006 cells re-grew if treated with osimertinib alone, whereas co-treatment with different CBP / p300 bromodomain inhibitors significantly delayed or completely blocked re-growth over the 21-day study period.

[0343] Example 12

[0344] This xenograft example was performed according to the method of Example 7 above. Thus, 2 million NCI-H1975 cells (ATCC; CRL 5908) were injected into both flanks of NMRI nude mice (Janvier). When the larger tumors reached 200 mm 3Mice were divided into treatment groups at 400 mg / kg and 200 mg / kg of compound C. The mice were treated with vehicle (0.8% (vol) DMSO (CAS [67-68-5]; 5% (vol) NMP (CAS [872-50-4]), 4.2% (vol) DMA (CAS [127-19-5]), 90% (vol) of 40% (wt / vol) Captisol (CAS [182410-00-0]) in pH 4 acetate buffer 0.1 M) daily. Mice were treated orally with 2 mg / kg osimertinib and 90 mg / kg compound C (premixed) or a combination of 2 mg / kg osimertinib and 90 mg / kg compound C (premixed). Tumor volume was measured two to three times a week using a caliper. The calculation formula for tumor volume is: the square of the larger tumor diameter x the smaller tumor diameter divided by 2. Based on the linear fit of the mean tumor volume, the slope of the curve was compared by regression analysis (two-tailed). Significant differences were detected between the osimertinib and osimertinib / compound C groups. No significant differences were observed between vehicle and compound C single agent treatment.

[0345] The response was determined by comparing the change in tumor volume at time t to its baseline: % tumor volume change = ΔVolt = 100% × ((Vt–Vinitial) / Vinitial). The best response was the minimum value of ΔVolt at t≥6d. For each time t, the average of ΔVolt from t=0 to t was also calculated. The best average response was defined as the minimum of this average at t≥10d. This metric captures the combination of speed, intensity, and durability of the response into one value. The response criteria (mRECIST) were adapted from RECIST criteria 21 and are defined as follows (applied in this order): mCR, best response <-95% and best mean response <-40%; mPR, best response <-50% and best mean response <-20%; mSD, best response <35% and best mean response <30%; mPD, not otherwise classified. Mice sacrificed due to adverse events before completing the 14-day trial were removed from the data set.

[0346] Figure 11 (A) shows the mean tumor volume (+SEM) of EGFR mutant NCI-H1975 xenografts plotted over time. Four different treatment groups are depicted: vehicle; crossed circles; n = 8, 90 mg / kg compound C (open circles; n = 6), 2 mg / kg osimertinib (filled circles; n = 9) or 2 mg / kg osimertinib combined with 90 mg / kg compound C (half-filled circles; n = 12). A linear regression fit was performed on the mean tumor volume over treatment time, and the slopes were compared for osimertinib and osimertinib combined with compound C. A significant difference in the slope between the two groups could be detected, which was positive (+6.4) in the osimertinib group and negative (-7.4) in the combination group, respectively. Figure 11 (B) shows the best mean response of all 4 treatment groups in a waterfall plot (vehicle in grey, 90 mg / kg Compound C in white, 2 mg / kg osimertinib in black, and the combination of 2 mg / kg osimertinib and 90 mg / kg Compound C in squares). The dashed line represents a 30% reduction in initial tumor volume.

[0347] Results: The results confirmed the results obtained in Example 7 above, this time with Compound C replacing CCS1477 as the CBP / p300 bromodomain inhibitor, where the two inhibitors are structurally unrelated but have the same function. Thus, when the CBP / p300 bromodomain inhibitor was used in the absence of an EGFR inhibitor, there was no effect on the growth of EGFR-mutated NSCLC xenograft tumors. However, when the CBP / p300 bromodomain inhibitor (CCS1477 in Example 7, Compound C in this example) was combined with an EGFR inhibitor (here osimertinib), the response to treatment was significantly increased and tumor size was better controlled during treatment. Sequence Listing <110> Torremo Therapeutics AG <120> Combination of CBP / p300 bromodomain inhibitor and EGFR inhibitor for the treatment of EGFR mutant NSCLC <130> T08537WO <160> 6 <170> PatentIn Version 3.5 <210> 1 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Primer b-Actin fwd <400> 1 gccccagctc accatggat 19 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer b-actin rev <400> 2 tgggcctcgt cgcccacata 20 <210> 3 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primer ALPP fwd <400> 3 agaaagcagg gaagtcagtg g 21 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer ALPP rev <400> 4 cgagtaccag ttgcggttca 20 <210> 5 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Primer HOPX fwd <400> 5 gaccatgtcg gcggagacc 19 <210> 6 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Primer HOPX rev <400> 6 gcgctgctta aaccatttct gg 22

Claims

1. Use of a combination of (i) a CBP / p300 bromodomain inhibitor and (ii) an EGFR inhibitor in the preparation of a medicament for treating a patient suffering from non-small cell lung cancer (NSCLC), wherein the NSCLC exhibits oncogenic alterations in EGFR, wherein the CBP / p300 bromodomain inhibitor is selected from Compound A, Compound 00030, Compound 00071, Compound C, CCS1477, FT-6876 and GNE-781, And wherein the EGFR inhibitor is selected from osimertinib and gefitinib.

2. Use of the combination according to claim 1, wherein the oncogenic alterations in EGFR lead to overactivation of EGFR.

3. Use of the combination according to claim 1 or 2, wherein the oncogenic changes are caused by: deletions and / or insertions in exon 18, exon 19 or exon 20 of the EGFR gene; duplication of the kinase domain in the EGFR gene; amplification of the EGFR gene; at least one base mutation in the EGFR gene resulting in an amino acid substitution in EGFR, the amino acid substitution being selected from L858R, G719S, G719A, G719C, V765A, T783A, S768I, S768V, L861Q, E709X, L819Q, A750P and combinations thereof, wherein X represents any amino acid; and any combination of the foregoing.

4. Use of the combination according to claim 1 or 2, wherein the oncogenic changes are caused by: a deletion in exon 19 of the EGFR gene; at least one base mutation in the EGFR gene resulting in the amino acid substitution L858R or A750P in EGFR; and combinations thereof.

5. Use of the combination according to claim 4, wherein the deletion results in the deletion of E746-A750 or L747-E749 in EGFR.

6. Use of a combination according to claim 1 or 2, provided that if the NSCLC additionally exhibits a resistant alteration in EGFR due to previous administration of an EGFR inhibitor, the EGFR inhibitor of the combination is not a previously administered EGFR inhibitor.

7. Use of the combination according to claim 6, wherein the resistance change in EGFR is caused by at least one base mutation in the EGFR gene, which base mutation leads to an amino acid substitution in EGFR selected from the following: T790M, C797X, L792X, G796X, L718Q, L718V, G724S, D761Y, V834L, T854A and combinations thereof, wherein X represents any amino acid.

8. Use of the combination according to claim 6, wherein the resistance change in EGFR is caused by at least one base mutation in the EGFR gene leading to the amino acid substitution T790M in EGFR.

9. Use of a combination according to claim 1 or 2, wherein the combination is administered to the patient in each treatment cycle.

10. Use of a combination according to claim 1 or 2, wherein (i) and (ii) are administered in separate dosage forms or are contained in a single dosage form.

11. Use of a combination according to claim 10, wherein if (i) and (ii) are administered as separate dosage forms, the administration during each treatment cycle is concomitant or sequential.

12. Use of a combination according to claim 1 or 2, wherein the treatment results in a prolonged duration of the therapeutic effect compared to the duration of the therapeutic effect when the EGFR inhibitor is administered as the only active agent.

13. Use of a combination according to claim 1 or 2, wherein said treatment results in increased therapeutic efficacy compared to the therapeutic efficacy of said EGFR inhibitor when administered as the sole active agent.

14. Use of the combination according to claim 1 or 2, wherein the treatment results in preventing resistance to the EGFR inhibitor.

Images