A monoclonal antibody against human CRR9, its preparation method and application
By developing anti-human CRR9 monoclonal antibodies with specific CDR sequences, the problems of lack of high affinity and blocking activity in existing technologies have been solved, improving the treatment effect of lung cancer and ovarian cancer and reducing chemotherapy resistance.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-08-05
- Publication Date
- 2026-03-10
AI Technical Summary
Currently, there is a lack of monoclonal antibodies with high affinity and good blocking activity targeting CRR9, leading to drug resistance in cisplatin-based chemotherapy in cancers such as lung cancer and ovarian cancer, which affects the treatment effect.
A monoclonal antibody against human CRR9 was developed, containing specific heavy and light chain variable region (CDR) sequences, exhibiting high affinity and blocking the interaction between CRR9 and GRP78, while also killing lung cancer cells.
It achieves high affinity binding to human CRR9, exhibits good CRR9-GRP78 blocking activity, enhances the killing effect on lung cancer cells, and has the potential to improve the treatment effect of lung cancer and ovarian cancer, and reduce chemotherapy resistance.
Smart Images

Figure CN115703835B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and particularly relates to a monoclonal antibody or antibody fragment against human CRR9, a preparation method and application thereof, and further relates to a nucleic acid molecule encoding the antibody, an expression vector, a host cell, and a method for expressing the antibody. BACKGROUND
[0002] CRR9 protein (English full name: Cisplatin Resistance-Related Protein 9, Chinese full name: cisplatin resistance-related protein 9) is also known as CLPTM1L (Cleft Lip And Palate Transmembrane Protein 1-Like Protein). Human CRR9 protein (Uniprot protein database number is Q96KA5, https: / / www.uniprot.org / uniprot / Q96KA5) is a multi-transmembrane protein with a full length of 538 amino acids, with its N-terminal and C-terminal located in the cytoplasm, and three segments (32-284 amino acids, 343-346 amino acids, and 424-428 amino acids) located outside the cell membrane. The peptide segment from 32 to 284 is the largest extracellular structure of the protein, which is composed of 253 amino acids.
[0003] Cisplatin, also known as cis-diammine platinum (II) dichloride (cis-Diammineplatinum (II) dichloride), CAS NO. 15663-27-1, is a strong antitumor drug based on platinum structure, an alkylating agent, which forms a cytotoxic adduct with DNA, induces intrastrand and interstrand cross-linking, blocks DNA replication and transcription, and ultimately causes apoptosis. Cisplatin is one of the most commonly used chemotherapy drugs, and is currently used in the treatment of various cancer types such as testicular cancer, ovarian cancer, non-small cell lung cancer, head and neck cancer, bladder cancer, gastric cancer and other malignant tumors. However, cisplatin often shows inherent resistance or acquired resistance during treatment, which is the cause of treatment failure for many cancer patients. Therefore, solving platinum resistance is one of the major issues that the medical community urgently needs to address. Research has found that cisplatin resistance is mainly attributed to three molecular mechanisms: cancer cells increase DNA repair capacity, change cell accumulation (such as reducing cell absorption of platinum and promoting efflux mechanism), and increase platinum drug inactivation (Amable L. Pharmacol Res. 2016 Apr; 106: 27-36).
[0004] CRR9 was first discovered in 2001 by Japanese professor K. Yamamoto while studying cisplatin resistance in ovarian cancer cells. Because of its close association with cisplatin resistance, it was named cisplatin resistance-associated protein 9. Human CRR9 protein is a multi-transmembrane protein consisting of 538 amino acids and six transmembrane segments. Its N-terminus and C-terminus are located in the cytoplasm, while three segments (amino acids 32-284, 343-346, and 424-428) are located outside the cell membrane. The extracellular peptide segment from position 32 to 284, consisting of 253 amino acids, is the largest extracellular structure of this protein. CRR9 has also been found to be widely and highly expressed in human lung cancer tissues, and high expression of CRR9 is negatively correlated with the survival prognosis of lung cancer patients. In addition, reducing the expression level of CRR9 protein in lung cancer cell lines by in vitro intervention can inhibit the migration and invasion of tumor cells (Ni Z, et al. Cancer Biomark. 2016; 16(3):445-52).
[0005] CRR9 membrane protein holds promise as a novel target for the treatment and diagnosis of lung and ovarian cancer. Targeting CRR9 could potentially improve the treatment outcomes of lung and ovarian cancer, reduce resistance to cisplatin-based chemotherapy drugs, significantly improve treatment efficacy, and prolong the survival of cancer patients. However, there are currently no mature monoclonal antibodies targeting CRR9 that have been developed on the market.
[0006] Therefore, there is an urgent need to develop a monoclonal antibody that targets CRR9 with high affinity and good blocking activity. Summary of the Invention
[0007] This invention provides an anti-human CRR9 monoclonal antibody, its preparation method, and its application. The monoclonal antibody has a high affinity for human CRR9, exhibits good CRR9-GRP78 blocking activity, and also has a killing effect on lung cancer cells.
[0008] The technical solution provided by this invention is as follows:
[0009] This invention provides an anti-human CRR9 monoclonal antibody, the antibody comprising a heavy chain variable region and a light chain variable region;
[0010] The heavy chain variable region includes CDR-H1, CDR-H2 and CDR-H3, and the light chain variable region includes CDR-L1, CDR-L2 and CDR-L3;
[0011] The amino acid sequence of the CDR-H1 is shown in SEQ ID NO: 3;
[0012] The amino acid sequence of the CDR-H2 is shown in SEQ ID NO: 4;
[0013] The amino acid sequence of the CDR-H3 is shown in SEQ ID NO: 5;
[0014] The amino acid sequence of the CDR-L1 is shown in SEQ ID NO: 6;
[0015] The amino acid sequence of the CDR-L2 is shown in SEQ ID NO: 7;
[0016] The amino acid sequence of the CDR-L3 is shown in SEQ ID NO: 8.
[0017] Preferably, the amino acid sequence of the heavy chain variable region is as shown in SEQ ID NO: 1; and the amino acid sequence of the light chain variable region is as shown in SEQ ID NO: 2.
[0018] Preferably, both the heavy chain and the light chain include constant regions, with the amino acid sequence of the heavy chain constant region as shown in SEQ ID NO: 9; and the amino acid sequence of the light chain constant region as shown in SEQ ID NO: 10.
[0019] Preferably, both the heavy chain and the light chain further include a constant region, which is a constant region of mouse or human IgG, preferably a constant region of IgG1.
[0020] The present invention further provides a nucleotide molecule encoding the aforementioned anti-human CRR9 monoclonal antibody.
[0021] Preferably, the sequence of the nucleotide molecule is selected from SEQ ID NO: 11 and SEQ ID NO: 12;
[0022] Sequence SEQ ID NO: 11 encodes the heavy chain variable region of the antibody;
[0023] The sequence SEQ ID NO: 12 encodes the light chain variable region of the antibody.
[0024] The present invention further provides an expression vector containing the aforementioned nucleotide molecules.
[0025] The present invention further provides a host cell containing the aforementioned expression vector.
[0026] Preferably, the host cell is a eukaryotic cell, and more preferably a mammalian cell.
[0027] This invention further provides a method for preparing an anti-human CRR9 monoclonal antibody, comprising the following steps:
[0028] (1) Prepare an expression vector containing a nucleotide molecule expressing the aforementioned anti-human CRR9 monoclonal antibody;
[0029] (2) Transfect eukaryotic host cells with the expression vector obtained in step (1) and culture them;
[0030] (3) Separate and purify to obtain anti-human CRR9 monoclonal antibody.
[0031] The present invention further provides antibody immunoconjugates, bispecific molecules, chimeric antigen receptors, or pharmaceutical compositions comprising the aforementioned anti-human CRR9 monoclonal antibody.
[0032] Furthermore, the pharmaceutical composition comprises a therapeutically effective amount of the anti-human CRR9 monoclonal antibody, and one or more pharmaceutically acceptable carriers, diluents, or excipients.
[0033] The present invention further provides the application of the aforementioned anti-human CRR9 monoclonal antibody in the preparation of antitumor drugs.
[0034] Preferably, the tumor includes testicular cancer, head and neck cancer, bladder cancer, stomach cancer, lung cancer, and ovarian cancer.
[0035] Beneficial effects
[0036] The anti-human CRR9 monoclonal antibody of the present invention has a high affinity for human CRR9, exhibits good CRR9-GRP78 blocking activity, and also has a killing effect on lung cancer cells. Attached Figure Description
[0037] Figure 1 To capture the binding ability of antibodies to human CRR9 protein using ELISA;
[0038] Figure 2 To evaluate the binding of the antibody to A549 cells expressing human CRR9 by flow cytometry;
[0039] Figure 3 The ligand binding blocking ELISA is used, where NC represents negative control, i.e., normal mouse IgG.
[0040] Figure 4 Bar chart showing the relative viability of A549 cells after 72 hours of treatment with anti-CRR9 monoclonal antibody. Detailed Implementation
[0041] the term
[0042] "Monoclonal antibody" refers to a preparation of an antibody molecule consisting of a single amino acid, not to the method of its production. Monoclonal antibodies or their antigen-binding fragments can be produced, for example, by hybridoma technology, recombinant technology, phage display technology, synthetic technology such as CDR grafting, or a combination of such or other techniques known in the art.
[0043] "Affinity" refers to the strength of the sum of all non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless otherwise stated, "binding affinity" herein refers to the intrinsic binding affinity that reflects a 1:1 interaction between an antibody and an antigen. Affinity can be measured by methods commonly known in the art, including those known in the prior art and those described herein.
[0044] The term "competition" in the context of competing antigen-binding proteins (e.g., neutralizing antigen-binding proteins or neutralizing antibodies) for the same epitope refers to competition between antigen-binding proteins, as determined by an assay in which the antigen-binding protein to be detected (e.g., an antibody or its immunologically functional fragment) prevents or inhibits (e.g., reduces) the specific binding of a reference antigen-binding protein (e.g., a ligand or reference antibody) to a common antigen (e.g., CRR9 or a fragment thereof). Numerous types of competitive binding assays can be used to determine whether one antigen-binding protein is competing with another. Competitive inhibition is measured by measuring the amount of a label bound to a solid surface or cell in the presence of the antigen-binding protein being tested. Typically, the antigen-binding protein being tested is present in excess. Antigen-binding proteins identified by competitive assays (competing antigen-binding proteins) include: antigen-binding proteins that bind to the same epitope as a reference antigen-binding protein; and antigen-binding proteins that bind to a neighboring epitope sufficiently close to the binding epitope of the reference antigen-binding protein, the two epitopes spatially preventing each other from binding.
[0045] Methods for producing and purifying antibodies and antigen-binding fragments are well-known and publicly available in the prior art, such as the Cold Spring Harbor Guide to Antibody Laboratory Techniques. For example, mice can be immunized with human CRR9 or fragments thereof, and the resulting antibodies can be refolded, purified, and subjected to amino acid sequencing using conventional methods. Antigen-binding fragments can also be prepared using conventional methods.
[0046] "Treatment" means administering an oral or topical therapeutic agent, such as a composition containing a CRR9 antibody or its antigen-binding fragment, to a patient who has symptoms of one or more diseases. Typically, a therapeutic agent is administered in a treated patient or population in an amount that effectively relieves symptoms of one or more diseases, whether by inducing the regression of such symptoms or inhibiting their progression to any clinically measurable extent. The amount of a therapeutic agent that effectively relieves any specific disease symptom (also called the "therapeutic effective dose") can vary depending on a variety of factors, such as the patient's disease state, age, and weight, and the drug's ability to produce the desired therapeutic effect. Whether the disease symptoms have been relieved can be evaluated using any clinical test that a physician or other healthcare professional typically uses to assess the severity or progression of the symptoms.
[0047] An "effective dose" includes a dose sufficient to improve or prevent the symptoms or condition of a medical condition. An effective dose also means a dose sufficient to allow or facilitate diagnosis. The effective dose for a particular patient or veterinary subject can vary depending on factors such as the condition to be treated, the patient's overall health, the route and dosage of administration, and the severity of side effects. An effective dose can be the maximum dose or administration regimen that avoids significant side effects or toxicity.
[0048] "Pharmaceutical composition" refers to a mixture containing one or more of the CRR9 antibodies or their antigen-binding fragments described herein, along with other pharmaceutical components such as physiological / pharmaceutical-grade carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration to a living organism, thereby promoting the absorption of the active ingredient and the exertment of its biological activity.
[0049] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Reagents not specifically named are commercially available, conventional reagents.
[0050] Example 1: Obtaining a mouse monoclonal antibody specifically against CRR9 using fusion hybridoma technology.
[0051] 1.1 Animal Immunization
[0052] Mice were immunized according to the methods commonly used in the literature (E Harlow, D. Lane, Antibody: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1998). Recombinant human CRR9 protein (i.e., human CRR9-TEV-Fc protein, prepared internally, wherein the human CRR9 protein sequence was selected from Uniprot No. Q96KA5, 32-284aa) was used as the immunogen.
[0053] To enhance the immune response, Freund's complete adjuvant and Freund's incomplete adjuvant (Sigma, St. Louis, Mo., USA) were used for the initial immunization and booster immunizations, respectively. Briefly, a human CRR9-TEV-Fc antigen protein solution was prepared with PBS, and the required amount of Freund's adjuvant was added to prepare an adjuvant-antigen mixture. The adjuvant and protein antigen solutions were thoroughly mixed by vortexing, and the antigen was emulsified using a syringe to form a stable water-in-oil solution, which was then injected into the animals. Based on serum titer results, 2 to 3 booster immunizations are usually required after the initial immunization to achieve a good immune effect. Mice with high serum titers were selected for intraperitoneal injection, and cell fusion was performed after the final immunization.
[0054] 1.2 Hybridoma Fusion and Screening
[0055] Prior to cell fusion, mouse myeloma cells (SP2 / 0-Ag14, ATCC#CRL-1581) were in logarithmic growth phase. Following the method described by Kohler G and Milstein C in “Continuous cultures of fused cells secreting antibody of predefined specificity,” Nature, 256:495-497 (1975), immunized mice were sacrificed, their spleens were harvested in a sterile environment, and fused with myeloma cells.
[0056] The fused "hybrid cells" were then aliquoted into 96-well cell culture media containing HAT. Viable hybridoma cells were typically observed under a microscope 7-10 days after fusion. Two weeks after cell seeding, the culture supernatant from each well was collected, and hybridomas were screened using ELISA with recombinant human CRR9-TEV-Fc protein antigen. In short, the ELISA plate was coated overnight with human CRR9-TEV-Fc protein at 4°C. The plate was washed four times with PBST (PBS solution containing 0.05% Tween 20) and then blocked with 200 μl / well of blocking buffer (PBST containing 5% skim milk powder). Diluted mouse immune serum (for determining mouse serum titer) or hybridoma supernatant was added to each well, and the plate was incubated at 37°C for 40 minutes. After washing four more times with PBST, the plate was detected using GAM(Fc)-HRP (Jackson ImmunoResearch, Cat#115-035-071). After washing the plate four times with PBST, add 100 μl / well of TMB (InnoReagents, Cat#TMB-S-002) chromogenic substrate and incubate at room temperature for 5 to 15 minutes. Then stop the incubation with 1M sulfuric acid solution and measure the absorbance at 450 nm for each well. Pick out the hybridoma cells that are positive for ELISA binding and transfer them to 24-well plates for further culture.
[0057] Hybridoma clones that produce antibodies with high specificity binding to human CRR9 and blocking activity with CRR9 / GRP78 ligands are subcloned using the limiting dilution method to ensure the clonability of the cell line, and then mouse monoclonal antibodies are prepared and purified.
[0058] Example 2: Study on the binding activity of mouse anti-CRR9 monoclonal antibody
[0059] The mouse anti-CRR9 monoclonal antibodies (mAbs) generated from the hybridoma clone in Example 1 were further tested for their binding activity using the following method.
[0060] 2.1 Measurement of antibody binding ability based on capture ELISA
[0061] 96-well ELISA plates were coated with GAM(Fc) (Jackson Immuno Research, Cat#115-006-071, 100 μl / well) prepared in PBS to a final concentration of 2 μg / ml and incubated at 37°C for at least 2 h. The ELISA plates were washed four times with PBST, then blocked with 200 μl / well of 5% w / v skim milk-PBST buffer and incubated at 37°C for 40 min. After washing four times with PBST, the plates were incubated with 100 μl / well of different concentrations (serially diluted 5-fold) of CRR9 mouse monoclonal antibody at 37°C for 40 min, followed by four more washes. The ELISA plate containing the CRR9-capturing antibody was incubated with 100 μl / well of biotin-labeled human CRR9-TEV-Fc protein (0.2 μg / ml) at 37°C for 40 minutes. The plate was then washed four times with PBST and incubated with secondary antibody SA-HRP (Jackson Immuno Research, Cat#016-030-084) at 37°C for 40 minutes. Finally, 100 μl / well of ELISA substrate TMB was added, and the reaction was terminated within 15 minutes with 50 μl / well of 1M H2SO4 at 25°C. The absorbance at 450 nm was measured. The results are shown in Table 1. Figure 1 .
[0062] Table 1 and Figure 1 The results show that the antibody A1C3G3B2 of the present invention has a good binding ability to human CRR9 protein.
[0063] 2.2 Flow cytometry (FACS) was used to determine the binding of the CRR9 monoclonal antibody to the A549 cell line expressing human CRR9.
[0064] A549 lung cancer cell line expressing human CRR9 was collected from cell culture flasks, washed twice, and resuspended in FACS buffer (PBS phosphate-buffered saline containing 2% v / v fetal bovine serum). 2 × 10⁶ cells / well were then placed in each well of a 96-well plate. 5Cells were incubated on ice for 40 minutes with FACS buffer containing different concentrations of CRR9 antibody. Cells were washed three times with FACS buffer, and 100 μL / well of R-Phycoerythrin affinity-purified F(ab')2 fragment goat anti-mouse IgG specific F(ab')2 fragment (diluted 1:1000 with FACS buffer, Jackson Immunoresearch, cat#115-116-072) secondary antibody was added. After incubation at 4°C in the dark for 40 minutes, cells were washed three times and resuspended in FACS buffer. Fluorescence was measured using a Becton Dickinson FACS CantoII-HTS instrument. Data were analyzed using Graphpad Prism software to obtain antibody-cell binding curves. The results are shown in [Figure number missing]. Figure 2 .
[0065] Figure 2 The results showed that the antibody A1C3G3B2 of the present invention had a strong binding ability to A549 cells expressing human CRR9.
[0066] Table 1. Binding activity of mouse anti-CRR9 antibody
[0067]
[0068] Example 3: Competitive functional blocking ability of mouse anti-CRR9 monoclonal antibody against CRR9-GRP78 interaction
[0069] Ligand blocking ELISA was used to detect the blocking ability of antibodies against CRR9-GRP78 interaction. Studies have shown (William R Clarke et al. Int J Cancer. 2019 Mar 15; 144(6): 1367-1378.) that the extracellular domain of CRR9 protein interacts with GRP78 protein on the membrane surface, thereby activating intracellular survival signals. This CRR9 / GRP78 pathway may be involved in CRR9-mediated chemotherapy drug resistance in cancer cells. Therefore, antibodies that block CRR9 / GRP78 interaction may have the functional activity of inhibiting cancer cell proliferation. In short, human GRP78-his protein (internal expression, where the human GRP78 sequence is selected from Uniprot No. P11021, 19-654aa) was added at 200 ng / well to a 96-well microplate and incubated overnight at 4°C. The plates were then washed with PBST and blocked at 37°C for 2 h with PBST containing 5% w / v skim milk powder. Wash the plate four more times with PBST.
[0070] CRR9 antibody was diluted with biotin-labeled human CRR9-TEV-Fc buffer (fixed concentration 0.2 μg / ml) (antibody was diluted 5-fold sequentially starting at 66.7 nM) and incubated at room temperature for 40 minutes. The antibody / CRR9-biotin mixture was then added to GRP78-coated plates and incubated at 37°C for 40 minutes, followed by washing four times with PBST. Secondary antibody SA-HRP (Jackson Immuno Research, Cat#016-030-084) was then added and incubated at 37°C for 40 minutes, followed by washing four times with PBST. Finally, TMB was added, and the reaction was terminated with 1 M H2SO4. The absorbance was measured at 450 nm. The data were analyzed using Graphpad Prism software to obtain the IC50 values. 50 Values, specific results are shown in Table 2 and Figure 3 .
[0071] From Table 2 and Figure 3 It can be seen that the antibody A1C3G3B2 of the present invention can block human CRR9-GRP78 interaction and has good CRR9-GRP78 blocking activity.
[0072] Table 2. Ability of anti-CRR9 antibodies to block CRR9-GRP78 interaction
[0073]
[0074]
[0075] Example 4: Killing effect of anti-CRR9 monoclonal antibody on lung cancer cells
[0076] To verify the inhibitory effect of anti-CRR9 monoclonal antibodies on tumor cell growth, A549 cells were used in the experiment. Example 2 shows that monoclonal antibody A1C3G3B2 can detect the expression of CRR9 on the surface of A549 cells. A549 cells were treated with the anti-CRR9 antagonist monoclonal antibody A1C3G3B2, and the relative viability of A549 cells was observed after 72 hours of treatment. The results are shown in [Figure 2]. Figure 4 .
[0077] Figure 4 The results showed that the monoclonal antibody A1C3G3B2 could inhibit cell proliferation in a dose-dependent manner, indicating that the anti-CRR9 monoclonal antibody had a killing effect on lung cancer cells.
[0078] Example 5: DNA cloning and sequencing, sequence analysis of anti-CRR9 antibody
[0079] Total RNA was extracted from the hybridoma cells of Example 1 using Trizol reagent (Invitrogen, catalog #15596-018).
[0080] The process is briefly described below: Centrifuge and collect 5 × 10⁵ samples. 6 Cells were transferred to 1.5 ml centrifuge tubes, and the supernatant was aspirated. 1 ml of Trizol reagent was added, and the tubes were repeatedly pipetted several times before incubating at 25°C for 5 minutes to lyse the cells. Immediately afterwards, 0.2 ml of chloroform solution was added to each tube, and the tubes were vigorously vortexed for 15 seconds, then incubated at room temperature for 3 minutes. The tubes were then centrifuged at 12000 g for 10 minutes at 4°C. The upper aqueous phase was transferred to a new 1.5 ml centrifuge tube, and 0.4 ml of isopropanol was added to precipitate RNA from the aqueous phase. The EP tubes were manually mixed and incubated at 25°C for 10 minutes, then centrifuged at 12000 g for 10 minutes at 4°C, and the supernatant was discarded. 1 ml of 75% ethanol was added, and the tubes were centrifuged again at 7500 rpm for 5 minutes at 4°C, and the supernatant was discarded. The RNA precipitate at the bottom of the tube was allowed to dry at room temperature for 10 minutes, and then 30 to 50 μL of sterile DEPC-treated water was added to dissolve the RNA sample.
[0081] Next, the total RNA was converted into cDNA using Taraka's reverse transcription cDNA kit (catalog #6110A). The experimental system was prepared as follows: 5 μl total RNA + 0.5 μl Oligo(dT) + 8.5 μl RNase-free water (total 14 μl). The mixture was first pre-denatured at 65°C for 5 min, then placed on ice for 2 min. Next, 4 μl 5× buffer + 1 μl dNTP mixture + 0.5 μl RNase inhibitor + 1 μl reverse transcriptase (total 20.5 μl) were added, mixed well, and incubated at 40°C for 50 min, followed by incubation at 70°C for 10 min to complete cDNA synthesis. The cDNA was further poly-G added to the 3' end. The reaction system was prepared as follows: 5 μl cDNA sample + 33.5 μl ddH2O + 5 μl 10×TdT buffer + 5 μl CoCl2 + 1 μl dGTP + 0.5 μl terminal deoxynucleotidyl transferase (total volume 50 μl). The mixture was incubated at 37 °C for 30 min, and then at 70 °C for 10 min to complete the poly-G tailing.
[0082] Further, the tailed cDNA was used as a template for gene amplification of the antibody variable region. For amplifying the antibody heavy chain variable region sequence, the PCR reaction system was prepared as follows: 5 μl 10×Taq enzyme buffer + 0.5 μl universal poly C primer (forward primer) + 0.5 μl mouse IgG1 reverse primer + 1 μl dNTP + 1 μl Taq polymerase + 1 μl cDNA + 41 μl ddH2O. For amplifying the antibody light chain variable region sequence, the PCR reaction system was prepared as follows: 5 μl 10×Taq enzyme buffer + 0.5 μl universal poly C primer (forward primer) + 0.5 μl mouse IgG kappa chain reverse primer + 1 μl dNTP + 1 μl Taq polymerase + 1 μl cDNA + 41 μl ddH2O. The temperature cycling for PCR amplification of the antibody heavy and light chain variable regions was as follows (steps 2 to 4 were repeated 25 times):
[0083] 1) Pre-denaturation at 95℃ for 5 minutes;
[0084] 2) Denaturation at 95℃ for 20 seconds;
[0085] 3) Anneal at 56℃ for 20 seconds;
[0086] 4) Extend to 72℃ for 30 seconds;
[0087] 5) Store at 25℃ for 60 minutes.
[0088] PCR products were analyzed by 1% agarose gel electrophoresis, and corresponding DNA bands (VH approximately 600 bp, VK approximately 500 bp) were excised. DNA extraction was performed using the QIAquick Gel DNA Recovery Kit (catalog #28704). The procedure is briefly described as follows: The gel was weighed, and 3 volumes of QG buffer were added. The gel was then incubated at 50°C for 10 minutes until completely dissolved. 1 volume of isopropanol was added and mixed thoroughly. The sample was then transferred to a QIA purification column and centrifuged at 13000 rpm for 1 minute. 750 μl of PE buffer was added to the column, and the column was centrifuged again at 13000 rpm for 1 minute. A second centrifugation at 13000 rpm was performed to remove any remaining liquid. 30 μl of water was added, and the column was eluted by centrifugation at 13000 rpm for 1 minute to obtain the prepared DNA sample. The purified PCR product was sequenced to obtain the variable region sequence of the antibody.
[0089] The sequence information of the clones of this invention is shown in Table 3.
[0090] Table 3. Sequence information of anti-human CRR9 antibodies
[0091]
[0092]
[0093] The nucleotide sequence of VH is SEQ ID NO: 11
[0094] CAGATCCAGTTGGTGCAGTCTGGACCTGAACTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAAACTATGGAATGAGCTGGGTGAGGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCAACACTGGAGAGCCAACATATGC TGAAGAGTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTTCAAGAGATTATTACTATGGTGGTAGAGGCTACTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCA;
[0095] VL's nucleotide sequence SEQ ID NO: 12
[0096] CAAATTGTTCTCACCCAGTCTCCAGCAATCATGTCTGCATCTCCAGGGGAGAAGGTCACCATGACCTGCAGTGCCACCTCAATTGTAAGTTACATGCACTGGTACCAGCAGAAGTCAGGCACCTCCCCCAAAAGATGGATTTATGACACATCCAAACTG GCTTCTGGAGTCCCTGCTCGCTTCAGTGGCAGTGGGTCTGGGACCTCTTACTCTCTCACAATCAGCAGCATGGAGGCTGCAGATGCTGCCACTTATTACTGCCAGCAGTGGAGTTATAATCCGCTCACGTTCGGTTCTGGGACCAAGCTGGAGCTGAAG.
[0097] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above. Therefore, the scope of protection of the present invention should be defined by the appended claims. sequence list <110> Bio-Sens Biotechnology (Nanjing) Co., Ltd. <120> A monoclonal antibody against human CRR9, its preparation method and application <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 121 <212> PRT <213> Artificial Sequence <400> 1 Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu 1 5 10 15 Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr 20 25 30 Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Lys Trp Met 35 40 45 Gly Trp Ile Asn Thr Asn Thr Gly Glu Pro Thr Tyr Ala Glu Glu Phe 50 55 60 Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Ala Ser Thr Ala Tyr 65 70 75 80 Leu Gln Ile Asn Asn Leu Lys Asn Glu Asp Thr Ala Thr Tyr Phe Cys 85 90 95 Ser Arg Asp Tyr Tyr Tyr Gly Gly Arg Gly Tyr Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Thr Leu Thr Val Ser Ser 115 120 <210> 2 <211> 106 <212> PRT <213> Artificial Sequence <400> 2 Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly 1 5 10 15 Glu Lys Val Thr Met Thr Cys Ser Ala Thr Ser Ile Val Ser Tyr Met 20 25 30 His Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr 35 40 45 Asp Thr Ser Lys Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser 50 55 60 Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Ala 65 70 75 80 Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Tyr Asn Pro Leu Thr 85 90 95 Phe Gly Ser Gly Thr Lys Leu Glu Leu Lys 100 105 <210> 3 <211> 5 <212> PRT <213> Artificial Sequence <400> 3 Asn Tyr Gly Met Ser 1 5 <210> 4 <211> 17 <212> PRT <213> Artificial Sequence <400> 4 Trp Ile Asn Thr Asn Thr Gly Glu Pro Thr Tyr Ala Glu Glu Phe Lys 1 5 10 15 Gly <210> 5 <211> 12 <212> PRT <213> Artificial Sequence <400> 5 Asp Tyr Tyr Tyr Gly Gly Arg Gly Tyr Phe Asp Tyr 1 5 10 <210> 6 <211> 10 <212> PRT <213> Artificial Sequence <400> 6 Ser Ala Thr Ser Ile Val Ser Tyr Met His 1 5 10 <210> 7 <211> 7 <212> PRT <213> Artificial Sequence <400> 7 Asp Thr Ser Lys Leu Ala Ser 1 5 <210> 8 <211> 9 <212> PRT <213> Artificial Sequence <400> 8 Gln Gln Trp Ser Tyr Asn Pro Leu Thr 1 5 <210> 9 <211> 336 <212> PRT <213> Artificial Sequence <400> 9 Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Cys Gly 1 5 10 15 Asp Thr Thr Gly Ser Ser Val Thr Leu Gly Cys Leu Val Lys Gly Tyr 20 25 30 Phe Pro Glu Ser Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser 35 40 45 Ser Val His Thr Phe Pro Ala Leu Leu Gln Ser Gly Leu Tyr Thr Met 50 55 60 Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Gln Thr Val 65 70 75 80 Thr Cys Ser Val Ala His Pro Ala Ser Ser Thr Thr Val Asp Lys Lys 85 90 95 Leu Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro Cys Pro Pro Cys 100 105 110 Lys Glu Cys His Lys Cys Pro Ala Pro Asn Leu Glu Gly Gly Pro Ser 115 120 125 Val Phe Ile Phe Pro Pro Asn Ile Lys Asp Val Leu Met Ile Ser Leu 130 135 140 Thr Pro Lys Val Thr Cys Val Val Val Asp Val Ser Glu Asp Asp Pro 145 150 155 160 Asp Val Gln Ile Ser Trp Phe Val Asn Asn Val Glu Val His Thr Ala 165 170 175 Gln Thr Gln Thr His Arg Glu Asp Tyr Asn Ser Thr Ile Arg Val Val 180 185 190 Ser Thr Leu Pro Ile Gln His Gln Asp Trp Met Ser Gly Lys Glu Phe 195 200 205 Lys Cys Lys Val Asn Asn Lys Asp Leu Pro Ser Pro Ile Glu Arg Thr 210 215 220 Ile Ser Lys Ile Lys Gly Leu Val Arg Ala Pro Gln Val Tyr Ile Leu 225 230 235 240 Pro Pro Pro Ala Glu Gln Leu Ser Arg Lys Asp Val Ser Leu Thr Cys 245 250 255 Leu Val Val Gly Phe Asn Pro Gly Asp Ile Ser Val Glu Trp Thr Ser 260 265 270 Asn Gly His Thr Glu Glu Asn Tyr Lys Asp Thr Ala Pro Val Leu Asp 275 280 285 Ser Asp Gly Ser Tyr Phe Ile Tyr Ser Lys Leu Asn Met Lys Thr Ser 290 295 300 Lys Trp Glu Lys Thr Asp Ser Phe Ser Cys Asn Val Arg His Glu Gly 305 310 315 320 Leu Lys Asn Tyr Tyr Leu Lys Lys Thr Ile Ser Arg Ser Pro Gly Lys 325 330 335 <210> 10 <211> 107 <212> PRT <213> Artificial Sequence <400> 10 Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu 1 5 10 15 Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe 20 25 30 Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg 35 40 45[[ID=ID=31]] Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser 50 55 60 Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu 65 70 75 80 Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser 85 90 95 Pro Ile Val Lys Ser Phe Asn Arg Gly Glu Cys 100 105 <210> 11 <211> 363 <212> DNA <213> Artificial Sequence <400> 11 cagatccagt tggtgcagtc tggacctgaa ctgaagaagc ctggagagac agtcaagatc 60 tcctgcaagg cttctgggta taccttcaca aactatggaa tgagctgggt gaggcaggct 120 ccaggaaagg gtttaaagtg gatgggctgg ataaacacca acactggaga gccaacatat 180 gctgaagagt tcaagggacg gtttgccttc tctttggaaa cctctgccag cactgcctat 240 ttgcagatca acaacctcaa aaatgaggac acggctacat atttctgttc aagagattat 300 tactatggtg gtagaggcta ctttgactac tggggccaag gcaccactct cacagtctcc 360 tca 363 <210> 12 <211> 318 <212> DNA <213> Artificial Sequence <400> 12 caaattgttc tcacccagtc tccagcaatc atgtctgcat ctccagggga gaaggtcacc 60 atgacctgca gtgccacctc aattgtaagt tacatgcact ggtaccagca gaagtcaggc 120 acctccccca aaagatggat ttatgacaca tccaaactgg cttctggagt ccctgctcgc 180 ttcagtggca gtgggtctgg gacctcttac tctctcacaa tcagcagcat ggaggctgca 240 gatgctgcca cttattactg ccagcagtgg agttataatc cgctcacgtt cggttctggg 300 accaagctgg agctgaag 318
Claims
1. An anti-human CRR9 monoclonal antibody, characterized in that, The antibody comprises a heavy chain variable region and a light chain variable region; The heavy chain variable region comprises CDR-H1, CDR-H2 and CDR-H3, and the light chain variable region comprises CDR-L1, CDR-L2 and CDR-L3; The amino acid sequence of CDR-H1 is shown as SEQ ID NO: 3; The amino acid sequence of CDR-H2 is shown as SEQ ID NO: 4; The amino acid sequence of CDR-H3 is shown as SEQ ID NO: 5; The amino acid sequence of CDR-L1 is shown as SEQ ID NO: 6; The amino acid sequence of CDR-L2 is shown as SEQ ID NO: 7; The amino acid sequence of CDR-L3 is shown as SEQ ID NO:
8.
2. The monoclonal antibody of claim 1, wherein the antibody is an antibody against human CRR9. The amino acid sequence of the heavy chain variable region is shown as SEQ ID NO: 1, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO:
2.
3. The monoclonal antibody of claim 1, wherein the antibody is an antibody against human CRR9. Both the heavy chain and the light chain comprise a constant region, the amino acid sequence of the heavy chain constant region is shown as SEQ ID NO: 9, and the amino acid sequence of the light chain constant region is shown as SEQ ID NO:
10.
4. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the anti-human CRR9 monoclonal antibody according to any one of claims 1-3.
5. The nucleic acid molecule of claim 4, wherein The sequence of the nucleic acid molecule comprises SEQ ID NO: 11 and SEQ ID NO: 12; The sequence of SEQ ID NO: 11 encodes the heavy chain variable region of the antibody; The sequence of SEQ ID NO: 12 encodes the light chain variable region of the antibody.
6. An expression vector, characterized by, The expression vector comprises the nucleic acid molecule according to claim 4 or 5.
7. A host cell, characterized in that, The host cell comprises the expression vector according to claim 6.
8. The method of producing the anti-human CCR9 monoclonal antibody according to any one of claims 1 to 3, wherein Comprising the following steps: Preparation of an expression vector comprising a nucleic acid molecule expressing the anti-human CRR9 monoclonal antibody according to any one of claims 1-3; Transfection of the obtained expression vector into a eukaryotic host cell and culture; Isolation and purification to obtain the anti-human CRR9 monoclonal antibody.
9. A pharmaceutical composition comprising the anti-human CRR9 monoclonal antibody according to any one of claims 1-3.
Citation Information
Patent Citations
Gene inducing apoptosis
JP2000210089A