Heavy chain and light chain variable regions of anti-Mycoplasma hyopneumoniae monoclonal antibody and their application

Abstract

The present invention discloses a heavy chain and light chain variable region of an anti-Mycoplasma hyopneumoniae monoclonal antibody and its application. The gene sequence of the heavy chain of the monoclonal antibody is shown in SEQ ID NO.5, and its amino acid sequence is shown in SEQ ID NO.6; the gene sequence of the Kappa chain of the monoclonal antibody is shown in SEQ ID NO.7, and its amino acid sequence is shown in SEQ ID NO.8. The present invention adopts the heavy chain and light chain variable region of the anti-Mycoplasma hyopneumoniae monoclonal antibody mentioned above, and the monoclonal antibody has high affinity and detection sensitivity, which lays a foundation for establishing a competitive or blocking ELISA antibody detection method and forming the research, development and promotion of ELISA antibody detection kit products.

Description

Technical Field

[0001] The present invention relates to the technical field of porcine mycoplasma pneumonia detection, and in particular to a heavy chain and light chain variable region of an anti-mycoplasma hyopneumoniae monoclonal antibody and an application thereof. Background Art

[0002] Mycoplasma hyopneumoniae (MHP) is a chronic pneumonia caused by Mycoplasma hyopneumoniae (M.hyopneumoniae), also known as swine endemic pneumonia. The disease belongs to the second category of infectious diseases and parasitic diseases. Mycoplasma hyopneumoniae, as the pathogen of the disease, was first isolated from the lung tissue of sick pigs. The disease usually interacts with other pathogens including swine fever, swine influenza, porcine reproductive and respiratory syndrome and porcine circovirus, causing respiratory disease complex (PRDC), resulting in impaired immune function of pigs and increasing the risk and severity of infection-related diseases.

[0003] P46 protein is a cell membrane protein in MHP, which plays an important role in the pathogenicity and transmission of MHP. As an immunodominant protein, the gene sequence of P46 protein is highly conserved. When P46 protein is used in ELISA, it has good specificity and sensitivity when detecting MHP antibodies in pig serum. Summary of the invention

[0004] The purpose of the present invention is to provide a heavy chain and light chain variable region of an anti-Mycoplasma hyopneumoniae monoclonal antibody and its application. The monoclonal antibody has high affinity and detection sensitivity, and lays a foundation for establishing a competitive or blocking ELISA antibody detection method and forming the research, development and promotion of ELISA antibody detection kit products.

[0005] To achieve the above object, the present invention provides a heavy chain and light chain variable region of an anti-Mycoplasma hyopneumoniae monoclonal antibody, the gene sequence of the Heavy chain of the monoclonal antibody is shown in SEQ ID NO.5, and its amino acid sequence is shown in SEQ ID NO.6; the gene sequence of the Kappa chain of the monoclonal antibody is shown in SEQ ID NO.7, and its amino acid sequence is shown in SEQ ID NO.8.

[0006] Preferably, the complementary determining region sequences of the heavy chain variable region of the P46 protein monoclonal antibody are CDR-H1, CDR-H2, and CDR-H3, and their amino acid sequences are shown in SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.11, respectively.

[0007] Preferably, the complementary determining region sequences of the light chain variable region of the P46 protein monoclonal antibody are CDR-L1, CDR-L2, and CDR-L3, and their amino acid sequences are shown in SEQ ID NO.12, SEQ ID NO.13, and SEQ ID NO.14, respectively.

[0008] The invention discloses an application of heavy chain and light chain variable regions of an anti-Mycoplasma hyopneumoniae monoclonal antibody in preparing a detection reagent or a kit with P46 protein as a target.

[0009] The invention discloses an application of heavy chain and light chain variable regions of an anti-Mycoplasma hyopneumoniae monoclonal antibody in preparing a genetically engineered antibody or vaccine with P46 protein as a target.

[0010] Therefore, the present invention adopts the heavy chain and light chain variable regions of the above-mentioned anti-Mycoplasma hyopneumoniae monoclonal antibody, and the monoclonal antibody has high affinity and detection sensitivity, which lays a foundation for establishing a competitive or blocking ELISA antibody detection method and forming the research, development and promotion of ELISA antibody detection kit products.

[0011] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is the SDS-PAGE gel image of pET-32a-P46 bacterial solution induced expression;

[0013] Figure 2 This is the SDS-PAGE gel image of pET-32a-P46 after purification;

[0014] Figure 3 It is a line graph of the serum titer detection of immune mice;

[0015] Figure 4 This is the SDS-PAGE gel image after monoclonal antibody purification;

[0016] Figure 5 This is a schematic diagram of the sequence alignment of the monoclonal antibody heavy chain variable region genes;

[0017] Figure 6 This is a schematic diagram of the comparison of amino acid sequences of the heavy chain variable regions of monoclonal antibodies;

[0018] Figure 7 This is a schematic diagram of the sequence alignment of the monoclonal antibody light chain variable region genes;

[0019] Figure 8 It is a schematic diagram of the comparison results of amino acid sequences of light chain variable regions of monoclonal antibodies. DETAILED DESCRIPTION

[0020] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0021] All terms (including technical terms or scientific terms) used in the present invention have the same meanings as those understood by ordinary technicians in the field to which the present invention belongs, unless otherwise specifically defined. It should also be understood that terms defined in general dictionaries should be understood to have meanings consistent with their meanings in the context of the relevant technology, and should not be interpreted in an idealized or extremely formal sense, unless explicitly defined in this document.

[0022] Technologies, methods, and equipment known to ordinary technicians in the relevant field may not be discussed in detail, but where appropriate, the technologies, methods, and equipment should be considered as part of the specification.

[0023] The disclosed contents of the prior art documents cited in the present specification are incorporated into the present invention by reference in their entirety and are therefore part of the disclosure of the present invention.

[0024] Embodiment 1

[0025] Expression and purification of recombinant P46 protein of Mycoplasma hyopneumoniae

[0026] 1. Gene Synthesis

[0027] According to the MHP P46 gene sequence published on NCBI (GenBank Accession No.AY496283.1), the gene sequence was codon-optimized and handed over to Wuhan Jinkairui Bioengineering Co., Ltd. for gene synthesis, synthesized into the pET-32a vector, and maintained with BL21 competent host bacteria.

[0028] 2. Expression and Purification

[0029] Take the preserved pET-32a-P46 / BL21 seed solution and inoculate it into 10 mL of LB liquid medium containing Amp+ at a ratio of 1:1000, and place it in a constant temperature shaker at 37°C, 220rpm overnight. The next day, take out the activated bacterial solution and inoculate it into 500 mL of LB liquid medium containing Amp+ at a ratio of 1:100, and place it in a constant temperature shaker at 37°C, 220rpm for about 4 hours. When the bacterial solution OD 600nm When the value is 0.6, induction can be performed. Add IPTG solution with a final concentration of 0.1mM and induce at 25℃ for 8h. The next day, collect the bacteria by centrifugation at 10000rpm for 20min, take 25mL buffer A solution (50mM Tris+300mM NaCl, pH8.2) to resuspend the bacteria, and after ultrasonic disruption for 20min, the bacterial solution is clear and transparent. Centrifuge at 12000rpm for 10min to collect the supernatant.

[0030] The supernatant after crushing was purified using a Ni pre-packed column (GE). First, the column was rinsed with 10 times the column volume of double distilled water, and then the column was balanced with 10 times the column volume of buffer A. Then, the supernatant after crushing was filtered with a 0.45μm filter membrane and the sample was loaded. After the sample was loaded, the column was balanced with buffer A until the UV peak baseline was stable. First, the impurities were washed with 10% B solution (50mM Tris+300mMNaCl+500mM imidazole, pH8.2) until the UV peak baseline was stable, and then the target protein was eluted with 50% B solution. When the UV value increased, the eluate was collected until the UV peak baseline dropped below 100mAu and the collection was stopped. The collected target protein eluate was dialyzed with 1×PBS, the concentration was measured after dialysis, and it was stored at -20℃ for later use.

[0031] After the recombinant pET-32a-P46 bacterial solution was induced for expression, the expression product was detected by SDS-PAGE. It can be seen that the supernatant of the recombinant pET-32a-P46 bacterial solution after induction has an obvious band at around 60kDa. It is consistent with the expected size, and the recombinant protein is soluble. For details, see Figure 1 .

[0032] Among them, Figure 1 In the figure, lane 1 is the uninduced sample of pET-32a-P46 bacterial solution, lane 2 is the supernatant sample after induction of pET-32a-P46 bacterial solution, and lane 3 is the precipitate sample after induction of pET-32a-P46 bacterial solution.

[0033] After the recombinant P46 protein was purified by nickel column affinity, SDS-PAGE was performed to identify the Figure 2 A clear target band can be seen at around 60 kDa, with a purity of about 90%, which can be used to prepare monoclonal antibodies.

[0034] Among them, Figure 2 In the figure, lane 1 is the uninduced sample of pET-32a-P46 bacterial solution, lane 2 is the supernatant sample after induction of pET-32a-P46 bacterial solution, and lane 3 is the purified recombinant P46 protein sample.

[0035] Embodiment 2

[0036] Preparation of monoclonal antibodies

[0037] 1. Mouse Immunization

[0038] Four female Balb / c mice aged 6-8 weeks were taken, and each was immunized with 50 μg of recombinant P46 protein. During the first immunization, the P46 protein was emulsified with Freund's complete adjuvant in equal volumes and injected subcutaneously at multiple points to immunize the mice. A total of three immunizations were performed, once every two weeks. The second and third immunizations were both emulsified with Freund's incomplete adjuvant for antigen emulsification, and the immunization dose and method remained unchanged. One week after the third immunization, the tail vein of the mice was bled, and the serum was taken and its titer was measured by the indirect ELISA method. The titer results of the serum of mice after immunization are shown in Figure 3 The results showed that the serum titer could reach up to 1:1.024×10 6 100 μg of P46 protein was diluted to 200 μL with 1×PBS and injected intraperitoneally to immunize mice. Cell fusion was performed three days later.

[0039] 2. Cultivation of SP2 / 0 Myeloma Cells

[0040] Take out one SP2 / 0 myeloma cell frozen in liquid nitrogen and immediately transfer it to a 37°C constant temperature water bath. Gently shake the cryotube from time to time and take it out when the cells melt to a semi-ice crystal state. Operate in a sterile environment, transfer the SP2 / 0 cells in the cryotube into a 50mL sterile centrifuge tube, take 10mL of preheated 1640 complete medium and slowly drop it into the centrifuge tube, centrifuge at 1000r / min for 5min, and discard the supernatant. Gently break up the cell clusters, take 5mL of medium to resuspend the cells and transfer them to a T75 cell culture flask. Add another 5mL of culture medium, shake the cell flask in the "cross" direction, and place it in a CO 2 The cells were cultured in a cell culture incubator at 37°C. The cell status was observed under a microscope, and the SP2 / 0 cells were subcultured when the density was about 80%.

[0041] 3. Cell Fusion

[0042] (1) Blood was collected from the eye sockets of the experimental mice after the shock and collected in EP tubes. After standing at 37°C for 2 hours, the blood was centrifuged at 4000 rpm for 10 minutes. The serum was collected for subsequent screening of monoclonal antibodies as a positive control. The mice were killed by dislocating the neck and then immersed in 75% alcohol for disinfection.

[0043] (2) Preparation of spleen cells: Use sterilized scissors and tweezers to cut open the mouse skin in a biosafety cabinet, replace a new set of sterilized scissors and tweezers to cut open the mouse abdominal cavity, and then use a new set of sterilized scissors and tweezers to carefully remove the spleen and trim off excess fat. Prepare a sterile 15mL centrifuge tube, add 10mL DMEM culture medium, place the spleen in the centrifuge tube, and carefully discard the excess culture medium after the spleen is moistened. Pipette another 10 mL of DMEM medium into a sterile dish, grind the spleen with a frosted glass slide to make a single-cell suspension and filter it through a 200-mesh nylon mesh into a sterile centrifuge tube, add 30 mL of DMEM into a 50 mL sterile centrifuge tube, rinse the nylon mesh with a pipette, centrifuge the centrifuge tube containing the spleen cell suspension at 1500 rpm for 5 min, discard the supernatant, gently break up the cell clumps by hand, add 30 mL of DMEM medium to resuspend, and centrifuge again, then discard the supernatant, gently break up the cell clumps by hand, and add 10 mL of DMEM medium to resuspend.

[0044] (3) Cell fusion: 1000rpm, 5min centrifugation to collect well-grown SP2 / 0 cells in a 50 mL centrifuge tube, gently break up the SP20 cell clusters, add 30mL DMEM medium to resuspend, centrifuge once more, add 10mL DMEM medium to resuspend, then mix the spleen cell suspension with the SP2 / 0 cell suspension, centrifuge at 1000rpm for 5min, discard the supernatant, and gently break up the cell clusters. Place in a 37℃ water bath environment, draw 1mL of PEG fusion agent and drop it into the centrifuge tube, add 1mL within 1min, at this time the cell state is red homogenous quicksand, and the tube wall feels like frosted glass when rotating.

[0045] (4) Termination of fusion: 9 mL of preheated DMEM medium was aspirated to terminate fusion, which was divided into three stages. The first stage was to add 1 mL within 1 minute, the second stage was to add 1 mL within 1 minute, and the third stage was to add the remaining 7 mL of medium within 3 minutes. Then, the cells were placed in a 37°C water bath for 5 minutes and centrifuged at 800 rpm for 5 minutes.

[0046] (5) Plating: Discard the supernatant, gently break up the cell clumps, add HAT medium (for example, if you want to plate 5 96-well plates, add 200 μL / well, excluding the 100 μL / well feeder layer cells that have been plated in advance, then add 50 mL of HAT medium). After mixing the cells, evenly plate the fused cell suspension in the 96-well cell plate that has been added with the feeder layer cells, 100 μL / well, and place in CO. 2 The cells were cultured in a 37°C incubator.

[0047] 4. Screening of positive hybridoma cells

[0048] 7 days after cell fusion, when the cell clusters are relatively large, the cell supernatant is detected by indirect ELISA. 1μg / mL recombinant P46 protein and ALV recombinant P27 protein (with His tag) are used as antigens for detection, respectively. The positive control is the serum of fused mice, and the negative control is the serum of PBS immunized mice. The hybridoma cell wells with the strongest color reaction and no reaction with ALV recombinant P27 protein are selected as positive wells. The screened positive hybridoma cells are subcloned by limiting dilution method. The hybridoma cell lines that can stably secrete monoclonal antibodies identified after subcloning are expanded and transferred to T75 cell bottles. When the cell number is about 80%, they can be collected to prepare ascites.

[0049] 5. Ascites Preparation

[0050] Add 10 mL of sterile 1×PBS to the cell bottle, blow off the cell layer, resuspend and transfer it to a 15mL centrifuge tube, and centrifuge at 1000r / min for 10min. Discard the supernatant, take another 1mL of sterile 1×PBS to resuspend the precipitate and mix it well, and draw it up with a 1mL syringe. Inject about 500μL of cell suspension into each mouse, pay attention to the growth status of the mouse, and collect ascites when the mouse abdomen swells after one week. Collect the mouse ascites in a centrifuge tube, centrifuge at 8000r / min for 20min, and draw up the middle ascites layer.

[0051] VI. Purification of Monoclonal Antibodies

[0052] The collected ascites was first crudely purified by the caprylic acid-ammonium sulfate method, and then the crudely purified monoclonal antibody was secondary purified using a Protein G pre-packed column. The purity of the purified monoclonal antibody was identified by SDS-PAGE. The results are shown in Figure 4 The purity was about 95%, and the concentration of the monoclonal antibody was measured to be 2.56 mg / mL.

[0053] Embodiment 3

[0054] Sensitivity, specificity and subclass identification of monoclonal antibodies against P46 protein of Mycoplasma hyopneumoniae

[0055] 1. Identification of monoclonal antibody sensitivity and specificity

[0056] The sensitivity and specificity of the monoclonal antibody against P46 protein were detected by indirect ELISA. The P46 protein was coated at 1 μg / mL, and the monoclonal antibody at 1 mg / mL was diluted in series to verify the sensitivity of the monoclonal antibody. The results are shown in Table 1. The sensitivity of the monoclonal antibody can reach a dilution of 1:50000. MHP P46 protein, PRRSV N protein, CSFV E2 protein and PCV VP1 protein were coated at 1 μg / mL, and the monoclonal antibody P46 at 1 mg / mL was diluted 1:5000 to verify the specificity of the monoclonal antibody. The results are shown in Table 2.

[0057] Table 1 Monoclonal antibody sensitivity verification

[0058]

[0059] Table 2 Validation of monoclonal antibody specificity

[0060]

[0061] 2. Monoclonal Antibody Subclass Identification

[0062] The subclass of the monoclonal antibody against the P46 protein of Mycoplasma hyopneumoniae was detected using an IgG subclass detection kit (Sigma, USA), and the results are shown in Table 3. The monoclonal antibody against the P46 protein was of IgG1 / Kappa type.

[0063] Table 3 Subclass identification of monoclonal antibodies

[0064]

[0065] Embodiment 4

[0066] Monoclonal antibody heavy and light chain variable region gene cloning

[0067] 1. Hybridoma Cell Culture and Total RNA Extraction

[0068] Hybridoma cells were cultured in RPMI 1640 complete medium at 37°C and 5% carbon dioxide until the cell number reached 1×10 7 Total RNA was extracted from cells using a total RNA extraction kit (purchased from Tiangen).

[0069] 2. Synthesis of the first strand of cDNA

[0070] The first-strand cDNA was synthesized using a transcription kit (purchased from TAKARA) with the extracted total RNA as the amplification template.

[0071] 3. Gene Amplification

[0072] Design downstream primers for Lambda chain, Kappa chain, Heavy chain and upstream universal primers.

[0073] Primer: F:AAGCAGTGGTATCAACGCAGA (SEQ ID NO.1)

[0074] Rκ:AACATTGATGTCTTTGGGGTAGAA (SEQ ID NO.2)

[0075] Rλ:AATCGTACACACCAGTGTGTGGG (SEQ ID NO.3)

[0076] RH:AGGGATCCAGAGTTCCAGGT (SEQ ID NO.4)

[0077] PCR amplification was performed using the first strand of cDNA as a template, and the reaction system was 50 μL, including 3 μL of template, 2.5 μL of upstream primer (10 μM), 2.5 μL of downstream primer (10 μM), 25 μL of 2× Taq enzyme, and 17 μL of sterile water.

[0078] The touchdown PCR reaction conditions were as follows: 98°C for 30 s; 98°C for 15 s, 64°C-58°C for 30 s, decreasing by 0.5°C each time until 58°C, for 10 cycles; 72°C for 30 s; 98°C for 15 s, 56°C for 30 s, 72°C for 30 s, for 15 cycles; the program was terminated at 72°C for 7 min.

[0079] IV. Cloning and Screening of PCR Amplification Products

[0080] The PCR products were subjected to 1% agarose gel electrophoresis, and the Kappa chain, Lambda chain and Heavy chain amplified fragments were recovered using a PCR product recovery kit (purchased from Tiangen). The recovered and purified target fragments were inserted into the pLB vector using a pLB zero background rapid cloning kit (purchased from Tiangen), transformed into DH5α competent cells (ampicillin resistance), and the recombinant positive clones were screened and sequenced.

[0081] The gene sequence of the Heavy chain is shown in SEQ ID NO.5, and its amino acid sequence is shown in SEQ ID NO.6; the gene sequence of the Kappa chain is shown in SEQ ID NO.7, and its amino acid sequence is shown in SEQ ID NO.8.

[0082] 5. Variable region amino acid sequence and homology analysis

[0083] The heavy chain and light chain gene sequences were compared and analyzed in the NCBI database. The analysis results showed that the monoclonal antibody heavy chain variable region gene sequence had the highest homology with the mouse immunoglobulin heavy chain variable region (Sequence ID: BC010327.1), with a homology of 513 / 593 and a homology percentage of 87%. Figure 5 The amino acid sequence of the variable region of the heavy chain of the monoclonal antibody has the highest homology with the amino acid sequence of the variable region of the heavy chain of the mouse immunoglobulin (Sequence ID: 707F-H), with a homology of 142 / 166 and a homology percentage of 86%. The results are shown in Figure 6The monoclonal antibody light chain variable region gene sequence has the highest homology with the mouse immunoglobulin Kappa chain variable region (Sequence ID: BC091754.1), with a homology of 488 / 511 and a homology percentage of 95%. The results are shown in Figure 7 The amino acid sequence of the variable region of the monoclonal antibody light chain has the highest homology with the amino acid sequence of the variable region of the mouse immunoglobulin Kappa chain (Sequence ID: AAG12167.1), with a homology of 145 / 165 and a homology percentage of 88%. The results are shown in Figure 8 The results of homology analysis of the gene sequences and amino acid sequences encoding the heavy and light chain variable regions of the monoclonal antibody showed that no sequence identical to the present invention was found. This result is consistent with the identification of the monoclonal antibody and IgG1 / Kappa using an IgG subclass detection kit (Sigma, USA).

[0084] 6. CDR region analysis

[0085] The heavy chain variable region and light chain variable region sequences were analyzed at https: / / www.novopro.cn / tools / cdr.html to obtain their CDR regions.

[0086] Antibody heavy chain CDR region:

[0087] CDR-H1:DYGH (SEQ ID NO.9)

[0088] CDR-H2: YINSGSTTIYYADTVKG (SEQ ID NO.10)

[0089] CDR-H3: ELWLRRIDY (SEQ ID NO.11)

[0090] Antibody light chain CDR region:

[0091] CDR-L1: QDVTTA (SEQ ID NO.12)

[0092] CDR-L2: LIHWASTR (SEQ ID NO.13)

[0093] CDR-L3: QQYSSYPLT (SEQ ID NO.14)

[0094] Embodiment 5

[0095] The Mycoplasma hyopneumoniae blocking ELISA antibody detection kit was prepared and tested for 38 pig serum samples. Compared with the purchased Mycoplasma hyopneumoniae blocking ELISA antibody detection kit (Ingena), the test results of 2 samples were not in compliance with the standard. The detailed results are shown in Table 4. The total compliance rate can reach 95%.

[0096] Table 4 Comparison of sample compliance rates

[0097]

[0098] Note: The judgment criteria of the purchased Mycoplasma hyopneumoniae blocking ELISA antibody detection kit (Ingena) are: CUT OFF(-)=0.45×negative control OD value, CUT OFF(+)=0.4×negative control OD value; if the sample OD value is ≤CUT OFF(+), the sample is positive; if the sample OD value is ≥CUT OFF(-), the sample is negative; if it is between the two, the sample is suspicious.

[0099] The determination criteria of the kit of the present invention: Calculation of blocking rate (IN): IN = (negative control OD 450nm Mean-sample OD 450nm value) / negative control OD 450nm Mean × 100%. When the sample test result IN ≥ 50%, it is judged as positive; when the sample test result IN < 40%, it is judged as negative; when the sample test result 40% ≤ IN < 50%, it is a suspected sample.

[0100] Sensitivity quality control serum samples were selected for minimum detection study. The results showed that the Mycoplasma hyopneumoniae blocking ELISA antibody detection kit of the present invention can detect 8-fold diluted sensitivity samples; the purchased Mycoplasma hyopneumoniae blocking ELISA antibody detection kit (Ingena) can also detect 8-fold diluted sensitivity samples. Detailed results are shown in Table 5. This result shows that the trial-produced Mycoplasma hyopneumoniae blocking ELISA antibody detection kit has good sensitivity.

[0101] Table 5 Test results of sensitivity quality control products

[0102]

[0103] Five negative samples were tested respectively with the trial-produced Mycoplasma hyopneumoniae blocking ELISA antibody detection kit of the present invention and the purchased Mycoplasma hyopneumoniae blocking ELISA antibody detection kit (Ingena), and the results were all negative, as shown in Table 6. This shows that the trial-produced Mycoplasma hyopneumoniae blocking ELISA antibody detection kit has good specificity.

[0104] Table 6 Specific quality control test results

[0105]

[0106] Therefore, the present invention adopts the heavy chain and light chain variable regions of the above-mentioned anti-Mycoplasma hyopneumoniae monoclonal antibody, and the monoclonal antibody has high affinity and detection sensitivity, which lays a foundation for establishing a competitive or blocking ELISA antibody detection method and forming the research, development and promotion of ELISA antibody detection kit products.

[0107] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. An anti-Mycoplasma hyopneumoniae monoclonal antibody, characterized in that: The monoclonal antibody comprises heavy chain and light chain variable regions, the gene sequence of the heavy chain variable region of the monoclonal antibody is shown in SEQ ID NO.5, and its amino acid sequence is shown in SEQ ID NO.6; the gene sequence of the light chain variable region of the monoclonal antibody is shown in SEQ ID NO.7, and its amino acid sequence is shown in SEQ ID NO.8; The complementary determining region sequences of the heavy chain variable region of the monoclonal antibody are CDR-H1, CDR-H2, and CDR-H3, and their amino acid sequences are shown in SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.11, respectively; The complementary determining region sequences of the monoclonal antibody light chain variable region are CDR-L1, CDR-L2, and CDR-L3, and their amino acid sequences are shown in SEQ ID NO.12, SEQ ID NO.13, and SEQ ID NO.14, respectively.

2. Use of the anti-Mycoplasma hyopneumoniae monoclonal antibody as claimed in claim 1 in the preparation of a detection reagent or a kit targeting P46 protein.

Images