Microfluidic Chip and Its Applications

Abstract

The present invention belongs to the field of biochips, and discloses a microfluidic chip and its application. The microfluidic chip of the present invention includes a nucleic acid extraction region, a nucleic acid amplification region, and a CRISPR reaction region, and each region is connected through a microchannel; the nucleic acid extraction region includes a sample and magnetic bead mixture inlet, a first wash solution inlet, a second wash solution inlet, a sample inlet, and a nucleic acid extraction chamber; the nucleic acid amplification region includes an amplification solution inlet and a first serpentine microchannel for performing isothermal nucleic acid amplification; the CRISPR reaction region includes a CRISPR reaction reagent storage chamber and a vent. The above microfluidic chip has a simple structure and high integration. Using it for nucleic acid detection, professional technicians are not required to operate, and high-sensitivity, rapid, and specific integrated detection of nucleic acids can be achieved. The detection cost is low, and it can meet the needs of popularization and use in community clinics and township hospitals.

Description

Technical Field

[0001] The present invention belongs to the field of biochips, and particularly relates to a microfluidic chip and its applications. Background Art

[0002] Researchers are working hard to clarify the mechanism of the disease SARS-CoV-2 and find possible treatment methods. On the other hand, the Omicron variant has become the most concerned variant, so it is urgent to find a rapid, specific and sensitive gene detection method. At present, positive SARS-CoV-2 samples are still mainly detected by polymerase chain reaction (PCR), and identifying the variant type depends on gene sequencing. These techniques are time-consuming, laborious and costly, requiring complex reactions with multiple reagents, skilled operators and expensive equipment. More importantly, the above typical detection method (PCR) only allows general detection of SARS-CoV-2, but not detection of specific strains. Therefore, it is of great significance to develop a rapid, sensitive gene detection platform that can distinguish different variants in one step.

[0003] Clustered regularly interspaced short palindromic repeats (CRISPR) systems are well-known natural adaptive immune systems in microorganisms and have been developed into revolutionary genome editing tools. CRISPR / Cas technology has been widely developed and applied in the fields of gene therapy, gene detection, etc. For example, Specific High Sensitivity Enzymatic Reporter UnLOCKing (SHERLOCK) is a method that uses Cas12 or Cas13 to detect pre-amplified DNA or RNA sequences. Other methods, such as the One-hour Low-cost Multipurpose Efficient System (HOLMES), HOLMESv2 and CRISPR-Cas-only Amplification Network (CONAN) are showing the advantages of high specificity and flexibility. Such technologies have been gradually applied to different clinical scenarios: bacterial detection, genetic disease diagnosis, virus screening, etc.

[0004] It has been reported that emerging diagnostic platforms based on CRISPR / Cas target SARS-CoV-2 by combining virus purification, amplification and detection processes. These diagnostic methods make SARS-CoV-2 detection more available in different application scenarios. However, the above CRISPR-based diagnosis relies on sequence amplification, resulting in an increased demand for experimental time, complex equipment and higher costs.

[0005] Therefore, it is necessary to provide a CRISPR / Cas-based detection platform with simple equipment, low cost and short detection time. Summary of the Invention

[0006] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. For this purpose, the present invention provides a microfluidic chip, which has a simple structure, low cost, high integration, and can complete the processes of nucleic acid extraction, nucleic acid amplification, and detection in a relatively short time, so as to quickly read out the detection results.

[0007] The present invention also provides a method for nucleic acid detection using the above-mentioned microfluidic chip.

[0008] According to one aspect of the present invention, there is provided a microfluidic chip, which includes a nucleic acid extraction region, a nucleic acid amplification region, and a CRISPR reaction region, and each region is connected through a microchannel;

[0009] The nucleic acid extraction region includes a sample and magnetic bead mixture inlet, a first washing solution inlet, a second washing solution inlet, a sample inlet, and a nucleic acid extraction chamber. The sample and magnetic bead mixture inlet, the first washing solution inlet, the second washing solution inlet, and the sample inlet are respectively connected to one end of the nucleic acid extraction chamber through the microchannel;

[0010] The nucleic acid amplification region includes an amplification solution inlet and a first serpentine microchannel; the amplification solution inlet is connected to one end of the nucleic acid extraction chamber through the microchannel, and the other end of the nucleic acid extraction chamber is connected to one end of the first serpentine microchannel through the microchannel, and the first serpentine microchannel is used for isothermal nucleic acid amplification;

[0011] The CRISPR reaction region includes a CRISPR reaction reagent storage chamber and a ventilation port, and the CRISPR reaction reagent storage chamber is connected to the other end of the first serpentine microchannel and the ventilation port respectively through the microchannel.

[0012] According to a preferred embodiment of the present invention, it has at least the following beneficial effects:

[0013] Based on the isothermal nucleic acid amplification technology and the CRISPR detection technology, the present invention highly integrates nucleic acid extraction, nucleic acid amplification, and CRISPR reaction on a microfluidic chip. Without the operation of professional technicians, it can achieve highly sensitive, rapid, and specific integrated detection of nucleic acids, with low detection cost, and can meet the needs of popularization and use in community clinics and township hospitals; and the chip can be used to distinguish different mutations of the virus in one step.

[0014] In some embodiments of the present invention, the sample inlet is used for introducing air and water.

[0015] In some embodiments of the present invention, the microfluidic chip is obtained by bonding an upper chip and a lower chip.

[0016] Specifically, the upper chip includes the sample and magnetic bead mixture inlet, the nucleic acid extraction chamber, the first serpentine microchannel, the CRISPR reaction reagent storage cavity, and the vent.

[0017] Specifically, the lower chip includes the first washing solution inlet, the second washing solution inlet, the sample inlet, and the amplification solution inlet.

[0018] Specifically, on the lower chip, the first washing solution inlet, the second washing solution inlet, the sample inlet, and the amplification solution inlet are respectively connected to the nucleic acid extraction chamber of the upper chip through the microchannel.

[0019] In some embodiments of the present invention, the height of the upper chip is 0.2 - 0.3 mm.

[0020] In some preferred embodiments of the present invention, the height of the upper chip is 0.25 mm.

[0021] In some embodiments of the present invention, the height of the lower chip is 0.2 - 0.3 mm.

[0022] In some preferred embodiments of the present invention, the height of the lower chip is 0.25 mm.

[0023] In some embodiments of the present invention, the height of the microfluidic chip is 0.4 - 0.6 mm.

[0024] In some preferred embodiments of the present invention, the height of the microfluidic chip is 0.5 mm.

[0025] In some embodiments of the present invention, the microfluidic chip can be provided with two sets of symmetric nucleic acid extraction regions, nucleic acid amplification regions, and CRISPR reaction regions to simultaneously detect two samples.

[0026] In some embodiments of the present invention, the nucleic acid extraction region further includes a dispersion zone and a second serpentine microchannel.

[0027] In some embodiments of the present invention, one end of the dispersion zone is connected to the sample and magnetic bead mixture inlet through the microchannel, and the other end of the dispersion zone is connected to the nucleic acid extraction chamber through the second serpentine microchannel.

[0028] In some embodiments of the present invention, the dispersion zone includes several micro triangular prism structures for dispersing the magnetic beads in the sample and magnetic bead mixture to make the magnetic beads and the sample evenly mixed.

[0029] In some embodiments of the present invention, a magnet unit is provided on the outside of the upper chip.

[0030] Specifically, the magnet unit corresponds to the nucleic acid extraction chamber and is used to adsorb the magnetic beads.

[0031] In some embodiments of the present invention, the microfluidic chip further includes a first waste liquid outlet and a second waste liquid outlet.

[0032] In some embodiments of the present invention, the first waste liquid outlet is located on the upper chip.

[0033] In some embodiments of the present invention, the third end of the nucleic acid extraction chamber is connected to the first waste liquid outlet through the microchannel.

[0034] Specifically, the lower chip further includes micropores corresponding to the first waste liquid outlet. These micropores are designed to overlap with the first waste liquid outlet to reduce the flow resistance of the liquid.

[0035] In some embodiments of the present invention, the second waste liquid outlet is located on the lower chip.

[0036] In some embodiments of the present invention, the second waste liquid outlet communicates with the microchannel.

[0037] In some embodiments of the present invention, the CRISPR reaction region further includes a liquid inlet.

[0038] In some embodiments of the present invention, the liquid inlet is connected to the CRISPR reaction reagent storage chamber through the microchannel.

[0039] In some embodiments of the present invention, the liquid inlet is used to introduce the CRISPR reaction reagent for storage in the CRISPR reaction reagent storage chamber.

[0040] In some embodiments of the present invention, the CRISPR reaction reagent includes CRISPR / Cas protein, crRNA, and single-stranded nucleic acid probe.

[0041] In some embodiments of the present invention, the CRISPR / Cas protein includes at least one of Cas12 or Cas13 protein.

[0042] In some embodiments of the present invention, the single-stranded nucleic acid probe includes a fluorophore and a quencher.

[0043] Specifically, the fluorophore includes at least one of FAM, FITC, JOE, CY3, CY5, or ROX.

[0044] Specifically, the quencher includes at least one of BHQ1, BHQ2, or BHQ3.

[0045] In some embodiments of the present invention, the number of the CRISPR reaction reagent storage chambers is not limited, and the corresponding number of storage chambers can be set according to actual detection needs. Different CRISPR reaction reagents are placed in each storage chamber to detect different nucleic acids in the sample.

[0046] Specifically, the different CRISPR reaction reagents are mainly different in the crRNA, so as to identify different nucleic acid fragments.

[0047] In some embodiments of the present invention, the number of the ventilation ports corresponds to the number of the CRISPR reaction reagent storage chambers.

[0048] Specifically, the ventilation ports are provided to ensure that the amplification reaction solution and the CRISPR reaction reagents can enter the CRISPR reaction reagent storage chambers normally.

[0049] In some embodiments of the present invention, the lower chip further includes micropores corresponding to the sample and magnetic bead mixture inlet, the CRISPR reaction reagent storage chambers, the inlet and the ventilation ports. These micropores are designed to overlap with the sample and magnetic bead mixture inlet, the CRISPR reaction reagent storage chambers, the inlet and the ventilation ports, so as to reduce the flow resistance of the added reagents.

[0050] Specifically, the diameter of the micropores is larger than the width of the microchannel.

[0051] In some embodiments of the present invention, the microfluidic chip is connected to an injection pump for controlling the introduction of each reagent or sample and the discharge of waste liquid.

[0052] Specifically, the sample inlet or waste liquid outlet of the microfluidic chip is connected to the injection pump through a pipeline.

[0053] Specifically, the control of the introduction of the reagent or sample and the discharge of waste liquid by the injection pump is realized by a programmed system.

[0054] Specifically, a computer is connected to the injection pump, and the opening or closing of the injection pump is controlled through the programmed system of the computer, so as to control the introduction of the reagent or sample and the discharge of waste liquid.

[0055] According to the second aspect of the present invention, a method for nucleic acid detection using the microfluidic chip is provided, including the following steps:

[0056] S1: Introduce the sample and magnetic bead mixture into the nucleic acid extraction chamber through the sample and magnetic bead mixture inlet, perform nucleic acid extraction, and adsorb the extracted nucleic acid on the magnetic beads;

[0057] S2: Sequentially introduce the first washing solution and the second washing solution into the nucleic acid extraction chamber through the first washing solution inlet and the second washing solution inlet to wash the magnetic beads adsorbed with nucleic acid;

[0058] S3: Sequentially introduce air and water into the nucleic acid extraction chamber through the sample inlet to elute the nucleic acid;

[0059] S4: Introduce the amplification solution into the first serpentine microchannel through the amplification solution inlet to perform isothermal amplification on the nucleic acid to obtain an amplification reaction solution;

[0060] S5: The amplification reaction solution enters the CRISPR reaction reagent storage cavity to perform a CRISPR reaction, and the reaction result is detected after the reaction ends.

[0061] In some embodiments of the present invention, the sample and magnetic bead mixture further includes proteinase K and carrier RNA.

[0062] In some embodiments of the present invention, the sample is serum, plasma or lymph fluid.

[0063] In some embodiments of the present invention, in step S2, the first washing solution and the second washing solution wash the magnetic beads adsorbed with nucleic acid 7 - 8 times.

[0064] In some embodiments of the present invention, in step S3, the air is introduced for 5 - 10 min.

[0065] In some embodiments of the present invention, the water introduced in step S3 is RNase - free water.

[0066] In some embodiments of the present invention, after introducing water in step S3, the microfluidic chip is heated to 55 - 57 °C and maintained for 2 - 2.5 min to elute the nucleic acid.

[0067] In some embodiments of the present invention, in step S4, the amplification solution is introduced and mixed with the nucleic acid for 5 min to achieve amplification of the nucleic acid.

[0068] In some embodiments of the present invention, the amplification solution is any one of an RPA amplification solution and an RAA amplification solution.

[0069] In some embodiments of the present invention, the amplification performed in step S4 is RPA amplification or RAA amplification.

[0070] In some embodiments of the present invention, the CRISPR reaction reagent storage cavity in step S5 is pre - stored with a CRISPR reaction reagent, and the CRISPR reaction reagent is introduced into the CRISPR reaction reagent storage cavity through the liquid inlet.

[0071] In some embodiments of the present invention, the CRISPR reaction reagent includes a CRISPR / Cas protein, a crRNA, and a single-stranded nucleic acid probe.

[0072] In some embodiments of the present invention, after the reaction in step S5 is completed, the fluorescence signal is detected by a fluorescence detector or visually observed to determine the reaction result.

[0073] Specifically, the reaction product of step S5 is irradiated with blue light or ultraviolet light to check whether fluorescence is generated.

[0074] Specifically, if there is a nucleic acid to be detected in the sample, the crRNA binds complementarily to the amplification product in the amplification reaction solution, activates the cleavage activity of the CRISPR / Cas protein, cleaves the fluorophore of the single-stranded nucleic acid probe into a free state and emits fluorescence. At this time, a fluorescence signal can be detected, and the fluorescence intensity of the emitted fluorescence signal can be further measured.

[0075] If the sample does not contain the nucleic acid to be detected, no amplification product binds to the crRNA, the cleavage activity of the CRISPR / Cas protein is not activated, the fluorophore of the single-stranded nucleic acid probe is not cleaved, and due to the presence of the quenching group, the fluorophore cannot emit fluorescence. At this time, no fluorescence signal will be detected. BRIEF DESCRIPTION OF THE DRAWINGS

[0076] The present invention will be further described below in conjunction with the drawings and embodiments, where:

[0077] Figure 1 is a schematic structural diagram of the upper chip and the lower chip of the microfluidic chip in Embodiment 1 of the present invention;

[0078] Figure 2 is Figure 1 an enlarged view of part A in

[0079] Figure 3 is a physical diagram of the microfluidic chip in Embodiment 2 of the present invention;

[0080] Figure 4 is the fluorescence image and fluorescence intensity image of the CRISPR reaction chamber detected in Embodiment 2 of the present invention; where, N - negative control; P - positive control;

[0081] Figure 5 is the fluorescence image and fluorescence intensity image of the CRISPR reaction chamber detected in Embodiment 3 of the present invention; where, N - negative control; P - positive control;

[0082] Figure 6This is the phosphor and fluorescence intensity map of the CRISPR reaction chamber detected in Example 4 of the present invention; where, N - negative control; P - positive control;

[0083] Figure 7 This is the phosphor and fluorescence intensity map of the CRISPR reaction chamber detected in Example 5 of the present invention; where, N - negative control; P - positive control;

[0084] Figure 8 This is the result diagram of detecting the detection limits of the genes of SARS-CoV-2, BA.1, BA.2, and BA.5 of the novel coronavirus in the embodiments of the present invention.

[0085] Reference numerals:

[0086] Upper chip - 10; lower chip - 20; 110 - liquid inlet for sample and magnetic bead mixture; 111 - first wash solution inlet; 112 - second wash solution inlet; 113 - sample injection port; 114 - dispersion area; 115 - second serpentine microchannel; 116 - nucleic acid extraction chamber; 120 - first micropore; 121 - micro triangular prism structure; 210 - amplification solution inlet; 211 - first serpentine microchannel; 310 - liquid inlet; 311 - CRISPR reaction reagent storage chamber; 312 - vent port; 320 - second micropore; 321 - third micropore; 322 - fourth micropore; 410 - first waste liquid outlet; 411 - second waste liquid outlet; 420 - fifth micropore. Detailed implementation manners

[0087] The embodiments of the present invention will be described in detail below. The examples of the embodiments are shown in the drawings, where the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the drawings are exemplary and are only used to explain the present invention and should not be construed as a limitation of the present invention.

[0088] In the description of the present invention, it should be understood that with respect to the orientation description, such as up, down, left, right, etc., the indicated orientation or positional relationship is based on the orientation or positional relationship shown in the drawings, and is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore should not be construed as a limitation of the present invention.

[0089] In the description of the present invention, the meaning of several is more than one. If there is a description of first and second, it is only for the purpose of distinguishing technical features and should not be construed as indicating or implying relative importance or implicitly indicating the quantity of the indicated technical features or implicitly indicating the sequence relationship of the indicated technical features.

[0090] In the description of the present invention, unless otherwise clearly defined, terms such as "arrangement" and "connection" should be understood in a broad sense, and those skilled in the art can reasonably determine the specific meanings of the above terms in the present invention in combination with the specific content of the technical solution.

[0091] In the description of the present invention, the description referring to terms such as "one embodiment" and "some embodiments" means that the specific features, structures or characteristics described in connection with the embodiment are included in at least one embodiment of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment. Moreover, the specific features, structures or characteristics described can be combined in a suitable manner in any one or more embodiments.

[0092] Unless otherwise specified, the test methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, are all reagents and materials that can be obtained from commercial channels.

[0093] Example 1

[0094] This example presents a microfluidic chip, and the schematic structural diagrams of the upper chip and the lower chip are as Figure 1 shown. Refer to Figure 1 to describe the structure of this microfluidic chip:

[0095] The microfluidic chip includes a nucleic acid extraction region, a nucleic acid amplification region, and a CRISPR reaction region, and each region is connected through a microchannel. And this microfluidic chip is obtained by bonding the upper chip 10 and the lower chip 20, and includes two sets of symmetric nucleic acid extraction regions, nucleic acid amplification regions, and CRISPR reaction regions, and can detect two samples simultaneously. Specifically:

[0096] The nucleic acid extraction region includes a sample and magnetic bead mixture inlet 110, a first washing solution inlet 111, a second washing solution inlet 112, a sample inlet 113, a dispersion zone 114, a second serpentine microchannel 115, and a nucleic acid extraction chamber 116. The sample and magnetic bead mixture inlet 110 is connected to the left end of the dispersion zone 114 through a microchannel, and the right end of the dispersion zone 114 is connected to the left end of the nucleic acid extraction chamber 116 through the second serpentine microchannel 115, wherein the dispersion zone 114 includes a number of micro triangular prism structures 121 (the enlarged structure of the dispersion zone 114 is as Figure 2 shown), which are used to disperse the magnetic beads in the sample and magnetic bead mixture and make the magnetic beads and the sample evenly mixed; the first washing solution inlet 111, the second washing solution inlet 112, and the sample inlet 113 are respectively connected to the left end of the nucleic acid extraction chamber 116 through microchannels;

[0097] The nucleic acid amplification region includes an amplification solution inlet 210 and a first serpentine microchannel 211. The amplification solution inlet 210 is connected to the left end of the nucleic acid extraction chamber 116 through a microchannel. The right end of the nucleic acid extraction chamber 116 is connected to one end of the first serpentine microchannel 211 through a microchannel. The first serpentine microchannel 211 is used for isothermal nucleic acid amplification, which can be RAA amplification or RPA amplification;

[0098] The CRISPR reaction region includes an inlet 310, a CRISPR reaction reagent storage chamber 311, and a vent 312. There are 5 CRISPR reaction reagent storage chambers 311 and corresponding 5 vents 312. Different CRISPR reaction reagents are placed in each CRISPR reaction reagent storage chamber 311, and 5 kinds of nucleic acids in a sample can be detected simultaneously. The inlet 310 is connected to the CRISPR reaction reagent storage chamber 311 through a microchannel. The CRISPR reaction reagent is introduced into the CRISPR reaction reagent storage chamber 311 from the inlet 310 and stored in the CRSIPR reaction reagent storage chamber 311 for subsequent reactions. The CRISPR reaction reagent storage chamber 311 is connected to the other end of the first serpentine microchannel 211 and the vent 312 through microchannels respectively;

[0099] The microfluidic chip also includes a first waste liquid outlet 410 and a second waste liquid outlet 411. The third end of the nucleic acid extraction chamber 116 is connected to the first waste liquid outlet 410 through a microchannel. The second waste liquid outlet 411 is communicated with the microchannel.

[0100] The microfluidic chip includes an upper chip 10 and a lower chip 20. Among them, the height of the upper chip is 0.25 mm, the height of the lower chip is 0.25 mm, and the height of the microfluidic chip is 0.5 mm. The upper chip 10 includes a sample and magnetic bead mixture inlet 110, a dispersion zone 114, a second serpentine microchannel 115, a nucleic acid extraction chamber 116, a first serpentine microchannel 211, an inlet 310, a CRISPR reaction reagent storage chamber 311, a vent 312, and a first waste liquid outlet 410. A magnet unit is also provided outside the upper chip 10, corresponding to the nucleic acid extraction chamber 116, for adsorbing magnetic beads.

[0101] The lower chip 20 includes a first rinsing solution inlet 111, a second rinsing solution inlet 112, a sample inlet 113, an amplification solution inlet 210, and a second waste liquid outlet 411. The first rinsing solution inlet 111, the second rinsing solution inlet 112, the sample inlet 113, and the amplification solution inlet 210 are respectively connected to the nucleic acid extraction chamber 116 of the upper chip 10 through microchannels, and the second waste liquid outlet 411 communicates with the microchannels. The lower chip 20 further includes a first micropore 120 corresponding to the sample and magnetic bead mixture inlet 110, a second micropore 320 corresponding to the inlet 310, a third micropore 321 corresponding to the CRISPR reaction reagent storage chamber 311, a fourth micropore 322 corresponding to the vent 312, and a fifth micropore 420 corresponding to the first waste liquid outlet 410. These micropores are designed on the lower chip 20 to overlap with the corresponding structures on the upper chip, so as to reduce the flow resistance of the liquid.

[0102] Example 2

[0103] In this example, the microfluidic chip of Example 1 (the physical diagram is as Figure 3 shown) is used to detect the SARS-CoV-2 gene in the serum of patients with novel coronavirus. The introduction of various reagents and samples and the discharge of waste liquid are completed by controlling the opening or closing of the injection pump by a programmed system of a computer. The specific process is as follows:

[0104] (1) Take 200 μL of serum sample (the sample needs to be balanced to room temperature) into a 1.5 mL centrifuge tube, and add 15 μL of magnetic bead suspension G, 20 μL of proteinase K, and 300 μL of Carrier RNA working solution to the centrifuge tube respectively to prepare a sample and magnetic bead mixture;

[0105] (2) Slowly introduce the sample and magnetic bead mixture in (1) through the sample and magnetic bead mixture inlet 110 so that it reaches the nucleic acid extraction chamber 116 for DNA extraction. The extracted DNA is adsorbed on the magnetic beads, and the magnetic beads adsorbed with DNA are fixed by the magnet unit outside the upper chip 10;

[0106] (3) Introduce the first rinsing solution PWC from the first rinsing solution inlet 111 to rinse the magnetic beads adsorbed with DNA;

[0107] Introduce the second rinsing solution PWE from the second rinsing solution inlet 112 to rinse the magnetic beads adsorbed with DNA;

[0108] (4) Repeat step (3) 7 - 8 times, and the waste liquid is discharged from the first waste liquid outlet 410; then introduce air from the sample inlet 113 into the nucleic acid extraction chamber 116 and maintain for 8 min; then introduce nuclease-free double-distilled water from the sample inlet 113 into the nucleic acid extraction chamber 116, place the microfluidic chip on a heating plate, heat to 56 °C, and maintain for 2 min to elute the DNA on the magnetic beads;

[0109] (5) The eluted DNA enters the first serpentine microchannel 211, and the RPA amplification solution is introduced into the first serpentine microchannel 211 through the amplification solution inlet 210 and maintained for 5 min to amplify the above DNA to obtain an amplification reaction solution. The nucleic acid sequences of the amplification primers are shown in SEQ ID NO:1 (TAATTATATATTACCAGATGATCTTACAGG C) and SEQ ID NO:2 (GAGATTAGTCTTCCTAAACAATCTATACCG).

[0110] (6) The amplification reaction solution enters the CRISPR reaction reagent storage chamber 311 (previously, the cryopreserved CRISPR reaction reagent was introduced into the CRISPR reaction reagent storage chamber 311 through the inlet 310 for storage. The CRISPR reaction reagents in the 5 storage chambers are, from left to right: 1. Negative control - that is, there is no crRNA corresponding to the novel coronavirus gene; 2. Positive control - containing crRNA corresponding to the SARS-CoV-2 gene (such as SEQ ID NO:3: UAAUUUCUCCUAAGUGUAGAUCCCCCAACGCUUCAGCGUUC); 3. BA.1 - containing crRNA corresponding to the variant BA.1 gene (such as SEQ ID NO:4: UAAUUUCUACUAAGUGUAGAUAAUGAUAUCUUUU CACGUCU); 4. BA.2 - containing crRNA corresponding to the variant BA.2 gene (such as SEQ IDNO:5: U AAUUUCUACUAAGUGUAGAUCGAGCAUAUGGUUUCCGACC); 5. BA.5 - containing crRNA corresponding to the variant BA.5 gene (such as SEQ ID NO:6: UAAUUUCUACUAAGUGUAGA UACCGUUAAUUAUAAUUACCA)). It undergoes a CRISPR reaction with the CRISPR reaction reagent. After the reaction, the microfluidic chip is placed in a fluorescence detector, and the reaction result is detected by the fluorescence excited by blue light, and the fluorescence signal is read. The CRISPR reaction reagent includes Cas12 protein, crRNA, and a single-stranded nucleic acid probe. The nucleic acid sequence of the single-stranded nucleic acid probe is (SEQ ID NO:7 (such as GAACCTTAAGCCTGTTCGAACTAA GATTCCAACC)(A / 6FAM / (THF) / BHQ-1 / CC)SEQ ID NO:8 (such as ATTAATATTAA TG) / CCC-spacer).

[0111] The results are as follows:

[0112] The fluorescence images and fluorescence intensity images of the CRISPR reaction chamber 311 after detection by the fluorescence detector for the microfluidic chip are as follows Figure 4 As shown, among the 5 CRISPR reaction chambers 311, only the second one shows fluorescence, and the fluorescence intensity image also shows the same result, indicating that the serum sample is from a SARS-CoV-2 patient.

[0113] Example 3

[0114] In this example, the microfluidic chip of Example 1 was used to detect the BA.1 gene in the serum of a patient with the novel coronavirus variant BA.1, and the method was the same as in Example 2. The detection results are as follows Figure 5 As shown, among the 5 CRISPR reaction chambers 311, only the second and the third ones show fluorescence, and the fluorescence intensity also shows the same result, indicating that the serum sample is from the variant BA.1.

[0115] Example 4

[0116] In this example, the microfluidic chip of Example 1 was used to detect the BA.2 gene in the serum of a patient with the novel coronavirus variant BA.2, and the method was the same as in Example 2. The detection results are as follows Figure 6 As shown, among the 5 CRISPR reaction chambers 311, only the second and the fourth ones show fluorescence, and the fluorescence intensity also shows the same result, indicating that the serum sample is from the variant BA.2.

[0117] Example 5

[0118] In this example, the microfluidic chip of Example 1 was used to detect the BA.5 gene in the serum of a patient with the novel coronavirus variant BA.5, and the method was the same as in Example 2. The detection results are as follows Figure 7 As shown, among the 5 CRISPR reaction chambers 311, only the second and the fifth ones show fluorescence, and the fluorescence intensity also shows the same result, indicating that the serum sample is from the variant BA.5.

[0119] In addition, the detection limits of the above four target substances, namely the genes of the novel coronavirus SARS-CoV-2, BA.1, BA.2, and BA.5, were detected using the microfluidic chip of Example 1 and the corresponding method, and the results are as follows Figure 8 As shown. Figure 8 It shows that as the DNA concentration increases, the fluorescence intensity gradually increases, and the two are positively correlated; when the DNA concentration is 100 copies / mL, the fluorescence intensity can be detected, indicating that when using the microfluidic chip of the present invention for nucleic acid detection, the detection limit is 100 copies / mL, and the sensitivity is relatively high.

[0120] The above has made a detailed description of the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those of ordinary skill in the art, various changes can be made without departing from the gist of the present invention. In addition, in the case of no conflict, the embodiments of the present invention and the features in the embodiments can be combined with each other.

Claims

1. A microfluidic chip, characterized in that, It includes a nucleic acid extraction region, a nucleic acid amplification region, and a CRISPR reaction region, and each region is connected by a microfluidic channel; The nucleic acid extraction region includes a sample and magnetic bead mixture inlet, a first washing solution inlet, a second washing solution inlet, a sample inlet, and a nucleic acid extraction chamber. The sample and magnetic bead mixture inlet, the first washing solution inlet, the second washing solution inlet, and the sample inlet are respectively connected to one end of the nucleic acid extraction chamber through the microfluidic channel; The nucleic acid amplification region includes an amplification solution inlet and a first serpentine microfluidic channel; The amplification solution inlet is connected to one end of the nucleic acid extraction chamber through the microfluidic channel. The other end of the nucleic acid extraction chamber is connected to one end of the first serpentine microfluidic channel through the microfluidic channel, and the first serpentine microfluidic channel is used for isothermal nucleic acid amplification; The CRISPR reaction region includes a CRISPR reaction reagent storage chamber and a vent. The CRISPR reaction reagent storage chamber is connected to the other end of the first serpentine microfluidic channel and the vent respectively through the microfluidic channel; Wherein, the nucleic acid extraction region further includes a dispersion region and a second serpentine microfluidic channel. One end of the dispersion region is connected to the sample and magnetic bead mixture inlet through the microfluidic channel, and the other end of the dispersion region is connected to the nucleic acid extraction chamber through the second serpentine microfluidic channel. The dispersion region includes a micro triangular prism structure for dispersing magnetic beads in the sample and magnetic bead mixture; The microfluidic chip is obtained by bonding an upper chip and a lower chip. The upper chip includes the sample and magnetic bead mixture inlet, the nucleic acid extraction chamber, the first serpentine microfluidic channel, the CRISPR reaction reagent storage chamber, and the vent. The lower chip includes the first washing solution inlet, the second washing solution inlet, the sample inlet, and the amplification solution inlet. On the lower chip, the first washing solution inlet, the second washing solution inlet, the sample inlet, and the amplification solution inlet are respectively connected to the nucleic acid extraction chamber of the upper chip through the microfluidic channel; The lower chip further includes micropores corresponding to the sample and magnetic bead mixture inlet, the CRISPR reaction reagent storage chamber, the inlet, and the vent for lapping with the sample and magnetic bead mixture inlet, the CRISPR reaction reagent storage chamber, the inlet, and the vent; A magnet unit is arranged outside the upper chip, and the magnet unit corresponds to the nucleic acid extraction chamber for adsorbing magnetic beads.

2. The microfluidic chip according to claim 1, characterized in that, The CRISPR reaction region further includes an inlet, and the inlet is connected to the CRISPR reaction reagent storage chamber through the microfluidic channel for introducing CRISPR reaction reagents to be stored in the CRISPR reaction reagent storage chamber.

3. The microfluidic chip according to claim 2, wherein, The CRISPR reaction reagents include CRISPR / Cas proteins, crRNAs, and single-stranded nucleic acid probes.

4. The microfluidic chip according to claim 1, wherein The height of the upper chip is 0.2 - 0.3 mm.

5. The microfluidic chip according to claim 1, characterized in that, The height of the lower chip is 0.2 - 0.3 mm.

6. The microfluidic chip according to claim 1, wherein, The height of the microfluidic chip is 0.4 - 0.6 mm.

7. The microfluidic chip according to claim 1, wherein The microfluidic chip further includes a first waste liquid outlet and a second waste liquid outlet; The first waste liquid outlet is located on the upper chip, and the first waste liquid outlet is connected to the third end of the nucleic acid extraction chamber through the microchannel.

8. The microfluidic chip according to claim 7, wherein, The lower chip further includes micropores corresponding to the first waste liquid outlet for lapping with the first waste liquid outlet; The second waste liquid outlet is located on the lower chip, and the second waste liquid outlet communicates with the microchannel.

9. A method for nucleic acid detection using the microfluidic chip according to any one of claims 1 to 8, characterized in that, It includes the following steps: S1: The sample and magnetic bead mixture is introduced into the nucleic acid extraction chamber through the sample and magnetic bead mixture inlet, and nucleic acid extraction is carried out to adsorb the extracted nucleic acid on the magnetic beads; S2: The first washing solution and the second washing solution are sequentially introduced into the nucleic acid extraction chamber through the first washing solution inlet and the second washing solution inlet to wash the magnetic beads adsorbed with nucleic acid; S3: Air and water are sequentially introduced into the nucleic acid extraction chamber through the sample inlet to elute the nucleic acid; S4: The amplification solution is introduced into the first serpentine microchannel through the amplification solution inlet to perform isothermal amplification of the nucleic acid to obtain an amplification reaction solution; S5: The amplification reaction solution enters the CRISPR reaction reagent storage chamber to perform a CRISPR reaction, and the reaction result is detected after the reaction ends.

10. The method according to claim 9, characterized in that The amplification solution is any one of an RPA amplification solution and an RAA amplification solution.

11. The method according to claim 9, wherein After the reaction in step S5 ends, the fluorescence signal is detected by a fluorescence detector or visually observed to judge the reaction result.

Images