Functional Study of Cytochrome P450 and Its Application in the Synthesis of Ganoderma Lucidum Triterpenes

Abstract

The invention relates to a method for studying the function of cytochrome P450 and its application in the synthesis of Ganoderma lucidum triterpenes. A dual-plasmid antibiotic-regulated expression system is used in Saccharomyces cerevisiae cells. By regulating the expression of GL21117 in one plasmid and simultaneously regulating the expression of two genes, GL20421 and GL21117, in two plasmids, a class of Ganoderma lucidum triterpenes is obtained while ensuring the yield of GA-HLDOA precursor. The triterpenes include 3,15-dihydroxy-lanoster-8,24-dien-26-acid, ganoderic acid Y, 3,15,30-trihydroxy-lanoster-8,24-dien-26-acid, 7-oxo-3,15-dihydroxy-lanoster-8,24-dien-26-acid, and 24,25-dialkyl-3,30-dihydroxy-lanoster-8-enyl-26-acid.

Description

Technical Field

[0001] The present invention relates to a technology in the field of bioengineering, specifically a study on the function of cytochrome P450 and its application in the synthesis of ganoderma triterpenes. Background Art

[0002] Due to the long growth cycle of Ganoderma lucidum and its difficulty in cultivation, the rich metabolites in Ganoderma lucidum but relatively low content, and the lack of mature and comprehensive means of genetic manipulation of Ganoderma lucidum fungal cells, researchers' understanding of the biosynthetic pathway of Ganoderma lucidum triterpenoid compounds is relatively scarce and progress is slow. Summary of the Invention

[0003] In response to the above-mentioned deficiencies in the prior art, the present invention proposes a method for studying the function of cytochrome P450 and its application in the synthesis of Ganoderma triterpenes. A dual-plasmid antibiotic-regulated expression system is adopted in Saccharomyces cerevisiae cells. By adopting these two methods, GL21117 is expressed and regulated in one plasmid, and GL20421 and GL21117 are expressed and regulated simultaneously in two plasmids, the multiple functions of the two enzymes are studied while ensuring the production of GA-HLDOA precursor, thereby obtaining a series of new and unreported Ganoderma triterpenoid compounds. While revealing the biosynthetic pathway of these Ganoderma triterpenes in Ganoderma, the heterologous biosynthesis of these compounds in Saccharomyces cerevisiae cells is achieved.

[0004] The present invention is achieved through the following technical solutions:

[0005] The present invention relates to a class of Ganoderma lucidum triterpenes, comprising: 3,15-dihydroxy-lanosta-8,24-diene-26-acid (15-hydroxy-ganoderic acid HLDOA), ganoderic acid Y (ganoderic acid Y), 3,15,30-trihydroxy-lanosta-8,24-diene-26-acid (15,30-dihydroxy-ganoderic acid HLDOA), 7-oxo-3,15-dihydroxy-lanosta-8,24-diene-26-acid (7-oxo-15-hydroxy-ganoderic acid HLDOA) and 24,25-dialkyl-3,30-dihydroxy-lanosta-8-enyl-26-acid (24,25-dialkyl-30-hydroxy-ganoderic acid HLDOA), and the structural formulas thereof are as follows:

[0006]

[0007]

[0008] and

[0009] The present invention relates to a method for preparing the above-mentioned Ganoderma triterpenoids, comprising: forming a new Ganoderma triterpenoid by catalyzing Ganoderic acid HLDOA through P450 gene GL21117 or forming a new Ganoderma triterpenoid by co-catalyzing Ganoderic acid HLDOA through P450 gene GL21117 and P450 gene GL21117, that is, cloning two P450 genes GL20421 and GL21117 separately or jointly into a Saccharomyces cerevisiae overexpression plasmid, and transforming the Saccharomyces cerevisiae overexpression plasmids into recombinantly modified microorganism Saccharomyces cerevisiae for heterologous expression, and achieving the preparation by fermenting the transformed strain.

[0010] The nucleotide sequence of the P450 gene GL20421 is shown in Seq ID No. 1, and its amino acid sequence is shown in Seq ID No. 2; the nucleotide sequence of the P450 gene GL21117 is shown in Seq ID No. 3, and its amino acid sequence is shown in Seq ID No. 4.

[0011] The method specifically includes any one of the following:

[0012] A) The Saccharomyces cerevisiae expression plasmid pRS426HF-GL21117-G418r is transferred into Saccharomyces cerevisiae YL-T3 to form a recombinant Saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117; the yeast expression plasmids pRS426HF-G418r and pRS425-CYP5150L8-iGLCPR-Hygr are transferred into Saccharomyces cerevisiae YL-T3 to form the corresponding Saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117 overexpressing GL21117; and the constructed Saccharomyces cerevisiae overexpression strain YL-T3-CYP5150L8-iGLCPR-GL21117 is fermented to obtain the first type of Ganoderma lucidum triterpenes from the fermentation product.

[0013] B) The Saccharomyces cerevisiae expression plasmids pRS426HF-GL21117-G418r and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr were transformed into Saccharomyces cerevisiae YL-T3 to form the recombinant Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117; the yeast expression plasmids pRS426HF-G418r and pRS425-GL20421-CYP5150L8-iGLCPR- Hygr was introduced into the cerevisiae yeast YL-T3, thereby forming the corresponding cerevisiae yeast strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 overexpressing GL21117 and GL20421; the constructed cerevisiae yeast overexpression strains YL-T3-CYP5150L8-iGLCPR-GL21117 and YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 were fermented to obtain the aforementioned class of Ganoderma lucidum triterpenes from the fermentation products. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Schematic diagram of the expression plasmid pRS426HF-G418r of the present invention;

[0015] Figure 2 Schematic diagram of the expression plasmid pRS426HF-GL21117-G418r of the present invention;

[0016] Figure 3 Schematic diagram of the expression plasmid pRS425-CYP5150L8-iGLCPR-Hygr of the present invention;

[0017] Figure 4 Schematic diagram of the expression plasmid pRS425-GL20421-CYP5150L8-iGLCPR-Hygr of the present invention;

[0018] Figure 5 HPLC spectra and MS analysis of fermentation products of Saccharomyces cerevisiae YL-T3-CYP5150L8-iGLCPR-GL21117 strain and control strain YL-T3-CYP5150L8-iGLCPR-control;

[0019] Figure 6 HPLC spectra and MS analysis of fermentation products of Saccharomyces cerevisiae YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 strain and control strain YL-T3-GL20421-CYP5150L8-iGLCPR-control;

[0020] Figures 7 to 10 The catalytic product of GL21117, 15-hydroxy-ganoderic acid HLDOA, 1 H-NMR spectrum, 13 C-NMR spectrum, HSQC spectrum, HMBC spectrum;

[0021] Figures 11 to 14 The catalytic product of GL21117, Ganoderic acid Y, is 1 H-NMR spectrum, 13 C-NMR spectrum, HSQC spectrum, HMBC spectrum;

[0022] Figures 15 to 18 The catalytic product of GL21117, 15,30-dihydroxy-ganoderic acid HLDOA, 1 H-NMR spectrum, 13 C-NMR spectrum, HSQC spectrum, HMBC spectrum;

[0023] Figures 19 to 22 The catalytic product of GL21117, 7-oxo-15-hydroxy-ganoderic acid HLDOA 1 H-NMR spectrum, 13 C-NMR spectrum, HSQC spectrum, HMBC spectrum;

[0024] Figures 23 to 26 The products of 24,25-dialkyl-30-hydroxy-ganoderic acid HLDOA catalyzed by GL21117 and GL20421 are respectively 1 H-NMR spectrum, 13 C-NMR spectrum, HSQC spectrum, HMBC spectrum;

[0025] Figure 27 Schematic diagram of the formation of different products catalyzed by GL21117 and GL20421. DETAILED DESCRIPTION

[0026] Example 1

[0027] The GL21117-overexpressing Saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117 and the control strain YL-T3-CYP5150L8-iGLCPR-control were constructed by transferring the Saccharomyces cerevisiae overexpression plasmids pRS426HF-GL21117-G418r and pRS425-CYP5150L8-iGLCPR-Hygr into Saccharomyces cerevisiae YL-T3 to form the recombinant Saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117, and the yeast expression plasmids pRS426HF-G418r and pRS425-CYP5150L8-iGLCPR-Hygr were transferred into Saccharomyces cerevisiae YL-T3 to form the corresponding control strain.

[0028] The saccharomyces cerevisiae overexpression plasmids include: pRS426HF-GL21117-G418r, pRS425-CYP5150L8-iGLCPR-Hygr and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr.

[0029] The yeast overexpression plasmid is constructed by PCR amplification to obtain coding region sequence fragments of the P450 genes GL20421, GL21117, and CYP5150L8. The expression vector pRS426, the GL21117 coding region sequence fragment, the yeast HXT7p promoter, the yeast FBA1t terminator, and the KanMX gene expression cassette containing the truncated Ura3 promoter (tP-Ura3) are then recombined and ligated using homologous recombination or other methods to obtain the corresponding recombinant overexpression plasmid pRS426HF-GL21117-G418r. The expression vector pRS425, the CYP5150L8 coding region sequence fragment, the yeast HXT7p promoter, the yeast FBA1t terminator, the iGLCPR expression cassette, and the HygromycinB gene expression cassette containing the truncated Ura3 promoter (tP-Ura3) were recombined and ligated to generate the corresponding recombinant overexpression plasmid pRS425-CYP5150L8-iGLCPR-Hygr. The expression vector pRS425-CYP5150L8-iGLCPR-Hygr, the Tdh3p promoter, the GL20421 coding region sequence fragment, and the Tef1t terminator were ligated via homologous recombination to generate the overexpression plasmid pRS425-GL20421-CYP5150L8-iGLCPR-Hygr. The expression product of the GL19526 gene is a cytochrome P450 reductase (CPR) iGLCPR.

[0030] The recombinantly modified Saccharomyces cerevisiae cell YL-T3 refers to the genetically engineered BY4742 strain YL-T3, which can be obtained by referring to the literature (Dai, Z., et al., Producing aglycons of ginsenosides in bakers' yeast. Sci Rep, 2014.4: p.3698). BY4742 is a commercial yeast host commonly used by those skilled in the art. Several genes upstream of the lanosterol biosynthesis pathway are overexpressed in this strain to increase lanosterol production.

[0031] This embodiment specifically includes:

[0032] 1.1) Construction of yeast expression plasmid pRS425-CYP5150L8-iGLCPR-Hygr.

[0033] 1.1.1) was modified based on pRS425-iGLCPR-Hygr, wherein the pRS425-iGLCPR-Hygr plasmid can be constructed by reference to the literature (Lan, X., et al., Efficient biosynthesis of antitumor ganoderic acidHLDOA using a dual tunable system for optimizing the expression of CYP5150L8and a Ganoderma P450 reductase. Biotechnol Bioeng, 2019.116(12): p.3301-3311). First, the plasmid pRS425-iGLCPR-Hygr was digested with Pmel enzyme to obtain a linearized plasmid vector fragment.

[0034] 1.1.2) Then, the primer pair HF-CYP5150L8-F and HF-CYP5150L8-R was used to amplify the CYP5150L8 expression cassette containing the homology arms using pRS426-HXT7p-CYP5150L8-FBA1t

[11] as a template. The specific primer sequences are shown in Table 1:

[0035] Table 1: Primer sequences for amplifying the expression cassette of CYP5150L8 containing homology arms

[0036] Primer name Serial number Sequence (5′ to 3′) HF-CYP5150L8-F Seq ID No.5 ggcaaaggaataatctcgagtcatgtaattagttatgtca HF-CYP5150L8-R Seq ID No.6 cgagcggtctaaggcggtttatacttctcgtaggaacaattt

[0037] F and R indicate forward and reverse primers, respectively.

[0038] 1.1.3) Then, the linearized pRS425-iGLCPR-Hygr vector fragment and the CYP5150L8 expression cassette fragment containing the homology arms were ligated by homologous recombination. The specific steps are as follows:

[0039] 1.1.3.1) Ligation system: 0.03 pmol of linearized pRS425-iGLCPR-Hygr plasmid, 0.06 pmol of the amplified CYP5150L8 expression cassette containing the homology arms, 4 μL of CE II Buffer, 2 μL of Exnase II, and make up to 20 μL with sterile water. Mix well, react at 37°C for 30 min, and incubate on ice for 5 min.

[0040] 1.1.3.2) Remove 50 μL of DH5α competent cells from -80°C freezer and place on ice until completely thawed (approximately 5 minutes).

[0041] 1.1.3.3) Transfer the ligation product to 50 μL of DH5α competent cells, mix thoroughly, avoiding bubbles, and place on ice for 20 minutes. Heat shock at 42°C for 60 seconds, then place on ice for 2 minutes. Add 900 μL of LB medium and incubate at 37°C for 60 minutes. Then, spread the plate with 100 μg / mL of Amp-resistant LB medium and incubate inverted at 37°C overnight.

[0042] 1.1.3.4) After a single colony grows on the plate, select a single colony and transfer it to 3 mL of liquid LB medium containing 100 μg / mL Amp resistance and culture overnight at 37°C and 220 rpm.

[0043] 1.1.3.5) After the bacterial culture reaches the stable phase, extract the plasmids and perform PCR verification using sequencing primers. Then, select plasmids that may be correct for the gene and sequence them. Compare the sequencing results to obtain the correct recombinant plasmid pRS425-CYP5150L8-iGLCPR-Hygr.

[0044] The sequencing primers used are shown in Table 2:

[0045] Table 2: Sequencing primer sequences for verifying the correctness of the recombinant plasmid pRS425-CYP5150L8-iGLCPR-Hygr

[0046] Primer name Serial number Sequence (5′ to 3′) HF-CYP5150L8-CX-F Seq ID No.7 atttcgatgatgcagcttgg HF-CYP5150L8-CX-R Seq ID No.8 acatcaaaatccacattctc

[0047] 1.2) Construction of yeast expression plasmid pRS426HF-GL21117-G418r.

[0048] 1.2.1) was modified based on pRS426HF-G418r, wherein the pRS426HF-G418r plasmid can be constructed by reference to the literature (Lan, X., et al., Efficient biosynthesis of antitumor ganoderic acid HLDOA using a dual tunable system for optimizing the expression of CYP5150L8 and aGanoderma P450 reductase. Biotechnol Bioeng, 2019. 116 (12): p. 3301-3311). First, the plasmid pRS426HF-G418r was digested with Pmel enzyme to obtain a linearized plasmid vector fragment.

[0049] 1.2.2) Then, using Ganoderma lucidum cDNA as a template and primer pair GL21117-F and GL21117-R, PCR amplification was performed to obtain the GL21117 coding region gene fragment containing the homology arms.

[0050] The primer pairs GL21117-F and GL21117-R are shown in Table 3:

[0051] Table 3: Primer sequences used to amplify the GL21117 coding region gene fragment

[0052] Primer name Serial number Sequence (5′ to 3′) GL21117-F Seq ID No.9 TAATTTTAATCAAAAAGTTTATGGCGACGTTGGAGGACCC GL21117-R Seq ID No.10 ATTAATTTGAATTAACGTTTTCAAGAAGCCTGCGCATGCC

[0053] F and R indicate forward and reverse primers, respectively.

[0054] 1.2.3) Ligate the linearized vector fragment to the GL21117 coding region gene fragment containing the homology arms by homologous recombination. The specific steps are as follows:

[0055] 1.2.3.1) Ligation system: 0.03 pmol of the linearized pRS426HF-G418r plasmid fragment, 0.06 pmol of the amplified GL21117 gene coding region fragment, 4 μL of CE II Buffer, 2 μL of Exnase II, and make up to 20 μL with sterile water. Mix well, react at 37°C for 30 min, and then incubate on ice for 5 min.

[0056] 1.2.3.2) Same as 1.1.3.2 in Example 1;

[0057] 1.2.3.3) Same as 1.1.3.3 in Example 1;

[0058] 1.2.3.4) Same as 1.1.3.4 in Example 1;

[0059] 1.2.3.5) After the bacterial culture reaches the stable phase, extract the plasmids and perform PCR verification using sequencing primers. Then, select plasmids that may be correct for the gene and sequence them. Compare the sequencing results to obtain the correct recombinant plasmid pRS426HF-GL21117-G418r.

[0060] The sequencing primers used are shown in Table 4:

[0061] Table 4: Sequencing primer sequences for verifying the correctness of the recombinant plasmid pRS426HF-GL21117-G418r

[0062] Primer name Serial number Sequence (5′ to 3′) P450-CX-F Seq ID No.11 gccaatacttcacaatgttc P450-CX-R Seq ID No.12 tcattttgtcattgaccttc

[0063] 1.3) The expression plasmids pRS426HF-GL21117-G418r and pRS425-CYP5150L8-iGLCPR-Hygr were transformed into the recombinant Saccharomyces cerevisiae cells YL-T3 by the lithium acetate method

[21] . The transformed yeast was spread on SC-His-Leu-Ura (SC-HLU) solid medium (yeast nitrogen base without amino acids (YNB), 6.7 g / L; glucose, 20 g / L; yeast synthetic drop-out media (SD) Y2001, 1.39 g / L; tryptophan, 76 mg / L; agar powder, 2%) and cultured in a 30°C incubator for 1.5 to 3 days. When transformants appeared, single clones were selected to obtain the Saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117 overexpressing GL21117.

[0064] 1.4) The expression plasmids pRS426HF-G418r and pRS425-CYP5150L8-iGLCPR-Hygr were transformed into the recombinant Saccharomyces cerevisiae cells YL-T3 by the lithium acetate method

[21] (Gietz et al., 2007). The specific operation steps were the same as those in 1.3 of Example 1. Finally, the control strain YL-T3-CYP5150L8-iGLCPR-GL21117 strain overexpressing GL21117 was obtained.

[0065] The control strains are: for the Saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117 overexpressing GL21117, the control strain is a strain containing two plasmids, pRS426HF-G418r and pRS425-CYP5150L8-iGLCPR-Hygr, namely YL-T3-CYP5150L8-iGLCPR-control; for the Saccharomyces cerevisiae strain overexpressing GL21117, the control strain is a strain containing two plasmids, pRS426HF-G418r and pRS425-CYP5150L8-iGLCPR-Hygr, namely YL-T3-CYP5150L8-iGLCPR-control; The Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 containing 7 and GL20421, and the control strain was the Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-control containing two plasmids: pRS426HF-G418r and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr.

[0066] Example 2

[0067] The Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117, which simultaneously overexpresses GL21117 and GL20421, and the control strain YL-T3-GL20421-CYP5150L8-iGLCPR-control were constructed. The Saccharomyces cerevisiae expression plasmids pRS426HF-GL21117-G418r and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr were transferred into Saccharomyces cerevisiae YL-T3 to form the recombinant Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117. The yeast expression plasmids pRS426HF-G418r and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr were transformed into Saccharomyces cerevisiae YL-T3 to form the corresponding control strain YL-T3-GL20421-CYP5150L8-iGLCPR-control, specifically including:

[0068] 2.1) Construction of yeast expression plasmid pRS425-GL20421-CYP5150L8-iGLCPR-Hygr.

[0069] 2.1.1) was constructed based on pRS425-ERG1-CYP5150L8-iGLCPR-HygB, where the pRS425-ERG1-CYP5150L8-iGLCPR-HygB plasmid can be obtained by reference to the literature (Lan, X., et al., Efficient biosynthesis of antitumor ganoderic acid HLDOA using a dual tunable system for optimizing the expression of CYP5150L8 and a Ganoderma P450 reductase. Biotechnol Bioeng, 2019.116(12): p.3301-3311.).

[0070] 2.1.2) Using the pRS425-ERG1-CYP5150L8-iGLCPR-HygB plasmid as a template, PCR amplification was performed using primer pairs P1-F and P1-R, P2-F and P2-R, and P3-F and P3-R, respectively. The vector was amplified into three fragments.

[0071] 2.1.3) Then, using Ganoderma lucidum cDNA as a template and primer pair A9-GL20421-F and A9-GL20421-R, PCR amplification was performed to obtain the GL20421 coding region gene fragment containing the homology arms.

[0072] The primer pairs used to construct the plasmid pRS425-GL20421-CYP5150L8-iGLCPR-Hygr are shown in Table 5:

[0073] Table 5: Primer sequence list used to construct plasmid pRS425-GL20421-CYP5150L8-iGLCPR-Hygr

[0074] Primer name Serial number Sequence (5′ to 3′) P1-F Seq ID No.13 tttgtttgtttatgtgtgtttattcg P1-R Seq ID No.14 cttgaccgcagttaactgtg P2-F Seq ID No.15 cacagttaactgcggtcaag P2-R Seq ID No.16 gttgcgcagcctgaatggcg P3-F Seq ID No.17 cgccattcaggctgcgcaac P3-R Seq ID No.18 ggagattgataagacttttctag A9-GL20421-F Seq ID No.19 gaaaagtcttatcaatctccTCAGTCTGCACGACGCAC A9-GL20421-R Seq ID No.20 aacacacataaacaaacaaaATGATCATCCCAGTAGACAT

[0075] F and R indicate forward and reverse primers, respectively.

[0076] 2.1.4) The three vector fragments amplified using the pRS425-ERG1-CYP5150L8-iGLCPR-HygB plasmid as a template and the GL20421 coding region gene fragment containing the homology arms were then homologously ligated. The specific steps are as follows:

[0077] 2.1.4.1) Ligation System: For each of the three vector fragments and the GL20421 coding region gene fragment containing the homology arms, add 0.03 pmol of each fragment, 4 μL of CE II Buffer, 2 μL of Exnase II, and make up to 20 μL with sterile water. Mix well, react at 37°C for 30 minutes, and then cool on ice for 5 minutes.

[0078] 2.1.4.2) Same as 1.1.3.2 in Example 1;

[0079] 2.1.4.3) Same as 1.1.3.3 in Example 1;

[0080] 2.1.4.4) Same as 1.1.3.4 in Example 1;

[0081] 2.1.4.5) After the bacterial culture reaches the stable phase, the plasmid is extracted and verified by PCR using sequencing primers. Then, the plasmids that may be correct are selected for sequencing and the sequencing results are compared to obtain the correct recombinant plasmid pRS425-GL20421-CYP5150L8-iGLCPR-Hygr

[0082] The sequencing primers used are shown in Table 6:

[0083] Table 6: Sequencing primer sequences for verifying the correctness of the recombinant plasmid pRS425-GL20421-CYP5150L8-iGLCPR-Hygr

[0084] Primer name Serial number Sequence (5′ to 3′) P1-P2-FP Seq ID No.21 gtaagacgattgctaaccac P2-P3-FP Seq ID No.22 gttgagtgttgttccagtttg P3-P4-FP Seq ID No.23 atgtgatttcgaccattgac P1-P4-RP Seq ID No.24 aagacggtaggtattgattg

[0085] F and R indicate forward and reverse primers, respectively.

[0086] 2.2) The constructed pRS425-GL20421-CYP5150L8-iGLCPR-Hygr plasmids and pRS426HF-GL21117-G418r were transformed into recombinant Saccharomyces cerevisiae YL-T3 cells via the lithium acetate method. The transformed yeast was plated on SC-His-Leu-Ura (SC-HLU) solid medium (yeast nitrogen base without amino acids (YNB), 6.7 g / L; glucose, 20 g / L; yeast synthetic drop-out media (SD) Y2001, 1.39 g / L; tryptophan, 76 mg / L; agar powder, 2%) and cultured in a 30°C incubator for 1.5-3 days. When transformants appeared, single clones were selected to obtain the Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 that simultaneously overexpressed GL21117 and GL20421.

[0087] 2.3) The constructed pRS425-GL20421-CYP5150L8-iGLCPR-Hygr plasmids and pRS426HF-G418r were transformed into recombinant Saccharomyces cerevisiae YL-T3 cells via the lithium acetate method. The transformed yeast was plated on SC-His-Leu-Ura (SC-HLU) solid medium (yeast nitrogen base without amino acids (YNB), 6.7 g / L; glucose, 20 g / L; yeast synthetic drop-out media (SD) Y2001, 1.39 g / L; tryptophan, 76 mg / L; agar powder, 2%) and cultured in a 30°C incubator for 1.5–3 days. When transformants appeared, single clones were selected to obtain the Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 that simultaneously overexpressed GL21117 and GL20421, and the control strain YL-T3-GL20421-CYP5150L8-iGLCPR-control.

[0088] Example 3

[0089] Fermentation and product extraction of overexpression Saccharomyces cerevisiae strains and control strains: The constructed Saccharomyces cerevisiae overexpression strains YL-T3-CYP5150L8-iGLCPR-GL21117 and YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 and the corresponding control strains YL-T3-CYP5150L8-iGLCPR-control and YL-T3-GL20421-CYP5150L8-iGLCPR-control without the GL21117 gene were fermented. By comparing the differences in metabolites in the fermentation bacteria, the catalytic activities of GL21117 and GL20421 were preliminarily determined.

[0090] The overexpression plasmid is transformed into Saccharomyces cerevisiae cells and compared with the control strain after fermentation. The overexpression plasmid is transformed into the recombinant Saccharomyces cerevisiae cells YL-T3 by the standard lithium acetate transformation method (Gietz, RD and RH Schiestl, High-efficiency yeast transformation using the LiAc / SS carrier DNA / PEG method. Nat Protoc, 2007. 2(1): p. 31-4.), thereby constructing the corresponding experimental strain. One overexpression strain is a Saccharomyces cerevisiae strain overexpressing GL21117, YL-T3-CYP5150L8-iGLCPR-GL21117, i.e., a YL-T3 strain transformed with two plasmids, pRS426HF-GL21117-G418r and pRS425-CYP5150L8-iGLCPR-Hygr. The second overexpression strain was a Saccharomyces cerevisiae strain overexpressing both GL21117 and GL20421, YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117. This strain was transformed with the plasmids pRS426HF-GL21117-G418r and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr. These two strains and a control strain were fermented in YPD24 medium. The fermentation pellet was then extracted with methanol, and the extract was analyzed by HPLC (high-performance liquid chromatography) to observe the presence of new peaks compared to the control strain, thereby preliminarily determining the formation of new products.

[0091] The specific steps of this embodiment include:

[0092] 3.1) The constructed Saccharomyces cerevisiae transformants were transferred to SC-His-Leu-Ura (SC-HLU) liquid medium (yeast nitrogen base without amino acids (YNB), 6.7 g / L; glucose, 20 g / L; yeast synthetic drop-out media (SD) Y2001, 1.39 g / L; tryptophan, 76 mg / L) and cultured at 30°C and 220 rpm until the cells grew to a stable size.

[0093] 3.2) The cultured bacterial suspension was then transferred to SC-HLU liquid medium at a ratio of 3% and cultured at 30°C and 220 rpm until the bacteria reached the logarithmic phase. The seed bacterial suspension was then prepared.

[0094] 3.3) The seed solution was then inoculated into YPD24 medium (10 g / L yeast powder, 20 g / L beef peptone, 20 g / L glucose, 40 g / L glycerol) at a ratio of 3%, and then fermented at 30°C and 220 rpm for 5 days.

[0095] The YPD24 culture medium comprises 10 g / L yeast powder, 20 g / L beef peptone, 20 g / L glucose and 40 g / L glycerol.

[0096] 3.4) After fermentation, the fermented bacterial solution was removed and the supernatant was removed by centrifugation. The cell pellet was extracted with methanol. After centrifugation, the supernatant was filtered through a 0.22 μm syringe filter to obtain a crude extract of the recombinant strain fermentation. The fermentation product was then analyzed by HPLC.

[0097] 3.5) By observing and comparing the differences in the HPLC spectra between the test strain and the control strain, mainly to see whether there are new peaks, we can preliminarily determine whether new Ganoderma triterpenoids are produced.

[0098] Example 4

[0099] HPLC testing of fermentation products of transformed Saccharomyces cerevisiae strains, including:

[0100] 4.1) HPLC analysis of fermentation products:

[0101] Instrument: Agilent 1260 Infinity II HPLC analysis system, DAD (Diode array detector) detector.

[0102] Chromatographic column: Kinetex Biphenyl analytical column (2.6 μm, 150 mm × 4.6 mm, Phenomenex, Torrance, CA).

[0103] Column temperature: 30°C; flow rate: 0.5 mL / min; injection volume: 20 μL, detection wavelength: 214 nm.

[0104] Phase A: ultrapure water, phase B: methanol (containing 0.1% acetic acid).

[0105] For YL-T3-CYP5150L8-iGLCPR-GL21117 and its control strain YL-T3-CYP5150L8-iGLCPR-control, gradient elution was used with the following program: 0-30 min, 80%-100% B phase; 30-35 min, 100% B phase; 35-36 min, 100%-80% B phase; 36-45 min, 80% B phase.

[0106] For YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 and its control strain YL-T3-GL20421-CYP5150L8-iGLCPR-control, the gradient elution program used was: 0-30 min, 73%-100% B phase; 30-35 min, 100% B phase; 35-36 min, 100%-73% B phase; 36-45 min, 73% B phase.

[0107] 4.2) Comparison of HPLC peaks of fermentation products with those of control strains ( Figure 5 and Figure 6 ), some new peaks were discovered, which are speculated to be new Ganoderma triterpenoid products generated by catalysis. Further mass spectrometry identification is required to confirm whether the compounds corresponding to the new peaks are Ganoderma triterpenoid products.

[0108] Example 5

[0109] LC-MS detection of fermentation products, including:

[0110] Instrument: Ultra-high performance liquid chromatography-ultra-high resolution mass spectrometry system

[0111] Chromatographic column: Kinetex Biphenyl analytical column (2.6 μm, 150 mm × 4.6 mm, Phenomenex, Torrance, CA).

[0112] Column temperature: 30°C; flow rate: 0.5 mL / min; injection volume: 20 μL, detection wavelength: 214 nm.

[0113] Phase A: ultrapure water, phase B: methanol (containing 0.1% acetic acid).

[0114] The gradient elution program was as follows: 0-30 min, 80%-100% phase B; 30-35 min, 100% phase B; 35-36 min, 100%-80% phase B; 36-45 min, 80% phase B.

[0115] Scanning molecular weight: 100-1000.

[0116] By comparing the HPLC, MS spectra and peak corresponding ions of the fermentation products with those of the control bacteria ( Figure 5 and Figure 6 ), thereby basically confirming whether new Ganoderma triterpenoid products have been generated. Further isolation, purification and structural identification will then be carried out.

[0117] Example 6

[0118] Isolation, purification and identification of fermentation products, including:

[0119] 6.1) Isolation and purification of fermentation products

[0120] 6.1.1) Activate the yeast strain YL-T3-CYP5150L8-iGLCPR-GL21117 or YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 stored at -80°C, streak onto SC-HLU solid plates, and incubate at 30°C until colonies form.

[0121] 6.1.2) Pick a single colony, transfer it to SC-HLU liquid medium, and culture at 30°C, 220 rpm, until the bacteria reach the logarithmic phase.

[0122] 6.1.3) After the bacterial culture has grown, transfer it to SC-HLU liquid medium at a ratio of 3% and then culture at 30°C and 220 rpm until the logarithmic phase. At this point, the fermentation seed preparation is complete.

[0123] 6.1.4) Inoculation and fermentation: Inoculate the cultured seed liquid into YPD24 medium at a ratio of 3%. 2 L large shake bottle, each bottle contains 400mL, total 2 5 bottles. Place all shake bottles in 3 0℃ 22 Fermentation was carried out at 0 rpm for 5 days.

[0124] 6.1.5) After fermentation, add ethyl acetate to the fermentation broth at a ratio of 1:1. 3Extract the mixture by shaking at 250 rpm at 0°C. Collect the supernatant ethyl acetate layer. Repeat the extraction with ethyl acetate. Combine the ethyl acetate from both extractions and evaporate to near dryness using a rotary evaporator. Remove the residue by aspiration and dissolve it in methanol. Combine the extracts and proceed to the next step of purification.

[0125] 6.1.6) Purify by normal phase silica gel column. The method is as follows:

[0126] Use a chromatography column with a diameter of 34 mm (column inner diameter) and a length of 500 mm (effective column length);

[0127] The elution procedure was as follows: petroleum ether, 200 mL; petroleum ether: ethyl acetate = 8:1, 200 mL; petroleum ether: ethyl acetate = 2:1, 200 mL; petroleum ether: ethyl acetate = 1:1, 600 mL; petroleum ether: ethyl acetate = 1:2, 600 mL; petroleum ether: ethyl acetate = 1:4, 400 mL; methanol, 600 mL.

[0128] During the elution process, the fractions were collected, filtered through a 0.22 μm organic syringe filter, and then analyzed by HPLC. The HPLC detection method was the same as that in 4.1 of Example 4.

[0129] After detection, all the collected liquids containing the new product were combined, and then evaporated to dryness using a rotary evaporator, and then dissolved with a small amount of methanol, centrifuged at 12000 rpm for 10 minutes, and the supernatant was taken for subsequent treatment.

[0130] 6.1.7) Use preparative liquid phase for preparative purification.

[0131] The concentrated crude product was further purified by preparative liquid phase as follows:

[0132] Instrument: Agilent 1260 series preparative liquid chromatograph. DAD detector, detection wavelength 214 nm;

[0133] Chromatographic column: YMC-Pack ODS-A, 20x250 mm, 5 μm, 12 nm;

[0134] Flow rate: 10 mL / min; injection volume: 800 μL;

[0135] Mobile phase: Phase A: ultrapure water, Phase B: methanol;

[0136] The gradient elution program was as follows: 0-50 min, 80%-100% phase B; 50-60 min, 100% phase B; 60-60.5 min, 100%-80% phase B; 60.5-70 min, 80% phase B.

[0137] During the time period when the new product peaks, fractions are collected in 50 ml glass tubes at different time periods, and then the fractions are subjected to HPLC analysis. The HPLC analysis method is the same as that in 4.1 of Example 4. The purity of the new product is estimated based on the peak area in the HPLC spectrum. The collected liquids in the collection tubes with higher purity are combined, evaporated to dryness, and dissolved in a centrifuge tube with less than 5 ml of HPLC-grade methanol (the weight of the centrifuge tube must be weighed before addition). After vacuum evaporation to a powder, it is weighed again to confirm the weight of the pure product.

[0138] 6.2) Mass Spectrometry Identification: The pure substance was subjected to UPLC-APCI-MS analysis using the same method as in Example 5 to determine whether the isolated and purified compound was the substance of interest and its purity.

[0139] 6.3) Structural identification of new compounds.

[0140] If the compound obtained after separation and purification is confirmed to be the substance of interest, further NMR (nuclear magnetic resonance spectroscopy) testing can be performed to confirm the structure of the new product. Careful analysis of the one-dimensional C-1D spectrum, one-dimensional H-1D spectrum, HSQC, and HMBC spectra can ultimately determine the structure of the isolated compound, thereby confirming whether the new compound is a new Ganoderma lucidum triterpenoid.

[0141] 6.3.1) Structural identification of the novel product produced by the Saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117 overexpressing GL21117.

[0142] Four new compounds were obtained from the fermentation products of YL-T3-CYP5150L8-iGLCPR-GL21117.

[0143] 6.3.1.1) After identification, the first new compound was 15-hydroxy-ganoderic acid HLDOA. Molecular formula C 30 H 48 O4 has a molecular weight of 472.354711, and the main MS ions are 455.35272 and 437.34038. The one-dimensional carbon and hydrogen spectrum data are shown in Table 7. 1 H-NMR, 13 C-NMR, HSQC, and HMBC spectra are shown in Figures 7 to 10 .

[0144] Table 7 15-hydroxy-ganoderic acid HLDOA 1 H-NMR, 13 C-NMR data sheet

[0145]

[0146]

[0147] 6.3.1.2) The second new compound was identified as Ganoderic acid Y. Molecular formula: C 30 H 46 O3 has a molecular weight of 454.344147, and the main MS ions are 437.34570 and 455.35543. The one-dimensional carbon and hydrogen spectrum data are shown in Table 8.

[0148] 1 H-NMR, 13 C-NMR, HSQC, and HMBC spectra are shown in Figures 11 to 14 .

[0149] Table 8 Ganoderic acid Y 1 H-NMR, 13 C-NMR data sheet

[0150] C position 13C NMR (ppm) 1H NMR (δppm, J, N) 1 27.92 (1.32m, 1.99m, 2H) 2 27.8 (1.67m, 1.72m, 2H) 3 78.98 3.25 (dd, J = 11.6, 4.3 Hz, 1H) 4 38.71 - 5 49.11 1.09 (dd, J = 11.4, 4.3 Hz, 1H) 6 23.01 (2.07m, 2.10m, 2H) 7 120.34 5.48 (d, J = 5.1 Hz, 1H) 8 142.57 - 9 145.95 - 10 37.38 - 11 116.2 5.32 (d, J = 6.3 Hz, 1H) 12 37.81 (2.08m, 2.21d, J = 18.0Hz, 2H) 13 43.81 - 14 50.32 - 15 31.49 (1.39m, 1.61m, 2H) 16 35.72 (1.43m, 1.99m, 2H) 17 50.86 1.58 (m, 1H) 18 15.67 0.57(s,3H) 19 22.76 0.98(s,3H) 20 36.16 1.42 (m, 1H) 21 18.31 0.93 (d, J = 6.5 Hz, 3H) 22 34.75 (1.19m, 1.56m, 2H) 23 25.92 (2.13m, 2.27m, 2H) 24 145.67 6.90 (t, J = 7.5 Hz, 1H) 25 126.48 - 26 172.01 - 27 12.04 1.84(s,3H) 28 28.15 1.01(s,3H) 29 15.8 0.88(s,3H) 30 25.56 0.88(s,3H)

[0151] 6.3.1.3) The third new compound was identified as 15,30-dihydroxy-ganoderic acidHLDOA. Molecular formula: C 30 H 48 O5 has a molecular weight of 488.349626, and the main MS ions are 453.33671 and 435.32491. The one-dimensional carbon and hydrogen spectrum data are shown in Table 9. 1 H-NMR, 13 C-NMR, HSQC, and HMBC spectra are shown in Figures 15 to 18 .

[0152] Table 9 15,30-dihydroxy-ganoderic acid HLDOA 1 H-NMR, 13 C-NMR data sheet

[0153] C position 13C NMR (ppm) 1H NMR (ppm, J, N) 1 35.4 (1.26m, 1.75m, 2H) 2 27.71 (1.60m, 1.68m, 2H) 3 78.76 3.25 (dd, J = 11.7, 4.5 Hz, 1H) 4 38.87 - 5 50.3 1.15 (dd, J = 12.7, 2.2 Hz, 1H) 6 18.41 (1.53m, 1.75m, 2H) 7 29.58 - 8 130.58 - 9 137.98 - 10 37.57 - 11 20.97 (2.08m, 2.12m, 2H) 12 31.54 (1.64m, 1.81m, 2H) 13 46.33 - 14 56.02 - 15 74.91 4.50 (dd, J = 9.7, 5.8 Hz, 1H) 16 40.16 (1.98m, 2.03m, 2H) 17 50.08 1.76 (m, 1H) 18 17.55 0.71(s,3H) 19 27.93 1.01(s,3H) 20 36 1.39 (m, 1H) 21 18.19 0.90 (d, J = 6.4 Hz, 3H) 22 34.62 (1.20m, 1.51m, 2H) 23 25.69 (2.10m, 2.24m, 2H) 24 145.16 6.85 (td, J=7.7, 1.5 Hz, 1H) 25 126.21 - 26 169.6 - 27 12.18 1.85(s,3H) 28 18.82 1.01(s,3H) 29 15.52 0.83(s,3H) 30 66.63 (3.66d, J=11.0Hz, 4.02d, J=11.1Hz, 2H)

[0154] 6.3.1.4) The fourth new compound was identified as 7-oxo-15-hydroxy-ganoderic acidHLDOA. Molecular formula: C 30 H 46 O5 has a molecular weight of 486.333976 and a primary MS ion of 487.35245. The one-dimensional carbon and hydrogen spectrum data are shown in Table 10. 1 H-NMR, 13 C-NMR, HSQC, and HMBC spectra are shown in Figures 19 to 22 .

[0155] Table 10 7-oxo-15-hydroxy-ganoderic acid HLDOA 1 H-NMR, 13 C-NMR data sheet

[0156]

[0157]

[0158] 6.3.2) Structural identification of the novel product produced by the Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 that simultaneously overexpresses GL21117 and GL20421.

[0159] A new Ganoderma triterpenoid, 24,25-dialkyl-30-hydroxy-ganoderic acid HLDOA, was isolated from the fermentation product of the Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117, which overexpresses both GL21117 and GL20421. The one-dimensional C- and H-spectral data are shown in Table 11. 1 H-NMR, 13 C-NMR, HSQC, and HMBC spectra are shown in Figures 23 to 26 .

[0160] Table 11 24,25-dialkyl-30-hydroxy-ganoderic acid HLDOA 1 H-NMR, 13 C-NMR data sheet

[0161]

[0162]

[0163] Compared to existing technologies, this invention further modifies Saccharomyces cerevisiae to create a new screening chassis for exploring the biosynthetic pathway of ganoderic acid and studying enzyme functions. This ultimately yielded several new Ganoderma triterpenoids, further revealing a partial biosynthetic pathway of ganoderic acid and enabling heterologous biosynthesis of these triterpenes in Saccharomyces cerevisiae.

[0164] The above-mentioned specific implementation can be partially adjusted in different ways by those skilled in the art without departing from the principles and purpose of the present invention. The scope of protection of the present invention shall be based on the claims and shall not be limited by the above-mentioned specific implementation. All implementation schemes within its scope shall be subject to the constraints of the present invention. Sequence Listing <110> Shanghai Jiao Tong University Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences <120> Functional Study of Cytochrome P450 and Its Application in the Synthesis of Ganoderma Lucidum Triterpenes <130> fnc590e <141> 2021-08-25 <160> twenty four <170> SIPOSequenceListing 1.0 <210> 1 <211> 1626 <212> DNA <213> P450 gene GL20421 (Artificial Sequence) <400> 1 atgatcatcc cagtagacat tgtatcgccc ctatctgtct ggcaggtcgc cgccgtcctc 60 accgcggtct acttcgccca cagcttcgtc cgcgcccgcc gcaaggccgc ccgcgagacg 120 cctcttgcgt gtcctccaag gcagagctgg ctcttcggca tccgcaacct tatcgcaggc 180 aaccccgagg ccggctccat ctacgaggcc tggatcgagg aatacgggtc cgtctaccgc 240 gtccccgcac cactggggtc cacccgggtc atcctcaccg atcccaaggc gatcgcgcac 300 ttctactcgg tcgagacgtg gacgtatgtg cagacgaagc tcgcgagggt cgcgattgag 360 ggcctgttgg gccgtgggtt gctttgggcg gaaggggagt ctcataaacg gcaacgcaag 420 gcgatatccc ccgccttcag caacattgcc attcgaaggc ttacctccgt gttctacgac 480 tccgtctaca agctcaagac caattgggac aaccaattgg cttcagtgga tttcgccacg 540 atagatgtac agaaatggat gaaccacgtc tcccttgaca gtatcggcat cgcgggattc 600 tctcatgact ttggctccct cgaaggcaag cactccgctg tcgccgaagt attcgatgcc 660 atgggtcatg tcaagccggg catctttacc gctgcggccc tcttcttcgg caatgtcttc 720 cccgtcctct ggcgtctccc cacagaaacg cgccgtctcc aactgaagct gaataagtgt 780 atggaggaga tcgctgtacc cctgctggag aacacgcgca atgagatgag gggtctaggc 840 gagaagggta aggaggagaa gagtatcatt ggcctgttga ttaaggcgga ggatgccaat 900 tcaagcctgc aaatgtctca ggaagagatc atggcccaga tgaaggtgct aatcttggca 960 ggatacgaaa ctacgtcaat cagtctcacg tgggccctca tcgagttatc acgcaagcca 1020 gagacccagg aacgccttcg tgaggagctg aaagaggagt tcccgaacgc ggatccaacc 1080 tgggaacagc tcacgaacgg ctccggtcta cattacctcg acgccgtcgt gcacgagatc 1140 ctcagactcc acgcgccgct caacgtcacc actcgtgttg ccgcaaagga tgacgtcatt 1200 ccactctcca cacccttgcg cctcccaact ggcgagctca ccgaccacgt cgccatcacc 1260 gagggccaag aggtcaccgt gcccatcagc tgcatgaaca ccgccgtcgc attctggggc 1320 cccgacgcac gcgagttccg cccggaacgc tggctcaacg aagacgggct cccgaagaag 1380 gcgcaggaga ttcaggggca ccgccacctg ctcaccttcg tcgacgggca ccgcatctgt 1440 ctcgggcgcg gctttgcgct agcagagttc aaggccgtgc tcggggtgtt gatcaagaac 1500 taccagttcg agctgccgga cgggccagag accaagatcg agttctgtcg tggggtcctt 1560 ccgcgcccgc gcgtcgtcgg cgagaagggc gcgaacctcc cgatgcgggt gcgtcgtgca 1620 gactga 1626 <210> 2 <211> 541 <212> PRT <213> P450 gene GL20421 (Artificial Sequence) <400> 2 Met Ile Ile Pro Val Asp Ile Val Ser Pro Leu Ser Val Trp Gln Val 1 5 10 15 Ala Ala Val Leu Thr Ala Val Tyr Phe Ala His Ser Phe Val Arg Ala 20 25 30 Arg Arg Lys Ala Ala Arg Glu Thr Pro Leu Ala Cys Pro Pro Arg Gln 35 40 45 Ser Trp Leu Phe Gly Ile Arg Asn Leu Ile Ala Gly Asn Pro Glu Ala 50 55 60 Gly Ser Ile Tyr Glu Ala Trp Ile Glu Glu Tyr Gly Ser Val Tyr Arg 65 70 75 80 Val Pro Ala Pro Leu Gly Ser Thr Arg Val Ile Leu Thr Asp Pro Lys 85 90 95 Ala Ile Ala His Phe Tyr Ser Val Glu Thr Trp Thr Tyr Val Gln Thr 100 105 110 Lys Leu Ala Arg Val Ala Ile Glu Gly Leu Leu Gly Arg Gly Leu Leu 115 120 125 Trp Ala Glu Gly Glu Ser His Lys Arg Gln Arg Lys Ala Ile Ser Pro 130 135 140 Ala Phe Ser Asn Ile Ala Ile Arg Arg Leu Thr Ser Val Phe Tyr Asp 145 150 155 160 Ser Val Tyr Lys Leu Lys Thr Asn Trp Asp Asn Gln Leu Ala Ser Val 165 170 175 Asp Phe Ala Thr Ile Asp Val Gln Lys Trp Met Asn His Val Ser Leu 180 185 190 Asp Ser Ile Gly Ile Ala Gly Phe Ser His Asp Phe Gly Ser Leu Glu 195 200 205 Gly Lys His Ser Ala Val Ala Glu Val Phe Asp Ala Met Gly His Val 210 215 220 Lys Pro Gly Ile Phe Thr Ala Ala Ala Leu Phe Phe Gly Asn Val Phe 225 230 235 240 Pro Val Leu Trp Arg Leu Pro Thr Glu Thr Arg Arg Leu Gln Leu Lys 245 250 255 Leu Asn Lys Cys Met Glu Glu Ile Ala Val Pro Leu Leu Glu Asn Thr 260 265 270 Arg Asn Glu Met Arg Gly Leu Gly Glu Lys Gly Lys Glu Glu Lys Ser 275 280 285 Ile Ile Gly Leu Leu Ile Lys Ala Glu Asp Ala Asn Ser Ser Leu Gln 290 295 300 Met Ser Gln Glu Glu Ile Met Ala Gln Met Lys Val Leu Ile Leu Ala 305 310 315 320 Gly Tyr Glu Thr Thr Ser Ile Ser Leu Thr Trp Ala Leu Ile Glu Leu 325 330 335 Ser Arg Lys Pro Glu Thr Gln Glu Arg Leu Arg Glu Glu Leu Lys Glu 340 345 350 Glu Phe Pro Asn Ala Asp Pro Thr Trp Glu Gln Leu Thr Asn Gly Ser 355 360 365 Gly Leu His Tyr Leu Asp Ala Val Val His Glu Ile Leu Arg Leu His 370 375 380 Ala Pro Leu Asn Val Thr Thr Arg Val Ala Ala Lys Asp Asp Val Ile 385 390 395 400 Pro Leu Ser Thr Pro Leu Arg Leu Pro Thr Gly Glu Leu Thr Asp His 405 410 415 Val Ala Ile Thr Glu Gly Gln Glu Val Thr Val Pro Ile Ser Cys Met 420 425 430 Asn Thr Ala Val Ala Phe Trp Gly Pro Asp Ala Arg Glu Phe Arg Pro 435 440 445 Glu Arg Trp Leu Asn Glu Asp Gly Leu Pro Lys Lys Ala Gln Glu Ile 450 455 460 Gln Gly His Arg His Leu Leu Thr Phe Val Asp Gly His Arg Ile Cys 465 470 475 480 Leu Gly Arg Gly Phe Ala Leu Ala Glu Phe Lys Ala Val Leu Gly Val 485 490 495 Leu Ile Lys Asn Tyr Gln Phe Glu Leu Pro Asp Gly Pro Glu Thr Lys 500 505 510 Ile Glu Phe Cys Arg Gly Val Leu Pro Arg Pro Arg Val Val Gly Glu 515 520 525 Lys Gly Ala Asn Leu Pro Met Arg Val Arg Arg Ala Asp 530 535 540 <210> 3 <211> 1515 <212> DNA <213> P450 gene GL21117 (Artificial Sequence) <400> 3 atggcgacgt tggaggaccc tcaggcgctc atcctcgctg gtgtcgcgac cctagtcgca 60 atatggatag tacgatggaa gaccaaccca ctaagttcga ttcccaccgt cggtggatcg 120 gatgcgccag ggctgtcgat attggcatgg ctcaacttct tgcgccgcgg gaaggacttg 180 ctccaggagg gttaccaaaa gtatcatggc tcgacgttca agatcgctct tttcgaccaa 240 tggcttgttg tgttttccgg gtccaatatg gtcgacgagc ttatgaggcg gcccgatagt 300 gagttatcgt tcttggaggg cattgaagaa gtagtccaca tgaagtacac tgtcgggcac 360 gaagccttgg gcgacccgta ccacgtcggg attatcaaag agaagcttac gcgcatgctt 420 cctaccgttc tcccggactt gaccgaagag ttggcgatat ccgtgcaaga atacatcccc 480 acccaaggcg acgaatggac cgccgtgaat gtgatgacga cgatgcaaaa gatcgtcgcc 540 agggccagca accgtgtctt cgtcggactt ccactttgtc gcaatgagga gtttttggca 600 ttgccccttc gcttcacgtt ggatgtgatg aaagacatgg tagtcatgag catcactccg 660 gacattttga agaggcccgt tggtcatctg gttagcaacg caaggcggac tatggcgcaa 720 gccatgaagt atatccaacc tgtgatcgcc gagaggaagg cgaacatgaa ggacttgggt 780 gaggactggt ccgacaagcc gaatgacgtg cttcagtggg tcatcgacga agccgtccgc 840 cggaaccact ccgacgtcag cgtcgtcgag cgaatattcc tcgtcaactt tgcagccatc 900 cacacctcct ccaccaacat gacccatgtg ctttacgacc tggcctcaag accggagtgt 960 attcaaccac tccgagagga gatcgaaggt atcgtcgcaa cagacggttg gagcaagtca 1020 gccattgcca agatgtggaa gcttgacagc ctgttcaggg agtcttcgcg gtaccacggg 1080 atctccctca ttggcctgat gcgcaagtcc gtgaaagaca tcaccctcag cgacgggacg 1140 ttcatcccga agggcaccgt gctcgcgact gctgcgcggc cgatgcacca cgacggctcg 1200 aaatacgcca acgcggacgt gctcgacccg ttccgcttcg agaggatgcg gcacggcgag 1260 ggcgagggcc tgaagcacca gttcgtcaac acttccaacg acttcgtctc cttcggccac 1320 ggcaagcacg catgcccggg acggttcttc gcggcgagcg agctgaaggc gctgctcgcg 1380 tacatcctca tcaactacga tatcaagctt gggggggacg gcacccggcc ggcgaacttt 1440 tactatggca cgaacgtcgt cccgtctgtc accggacagg tgctgttcag gaaacggcat 15C0 gcgcaggctt cttga 1515 <210> 4 <211> 504 <212> PRT <213> P450 gene GL21117 (Artificial Sequence) <400> 4 Met Ala Thr Leu Glu Asp Pro Gln Ala Leu Ile Leu Ala Gly Val Ala 1 5 10 15 Thr Leu Val Ala Ile Trp Ile Val Arg Trp Lys Thr Asn Pro Leu Ser 20 25 30 It should be noted that there seems to be a typo in line where "15C0" might be incorrect. It should probably be "1500" as in the original Chinese text. The above translation is based on the provided content with this potential error considered.Ser Ile Pro Thr Val Gly Gly Ser Asp Ala Pro Gly Leu Ser Ile Leu 35 40 45 Ala Trp Leu Asn Phe Leu Arg Arg Gly Lys Asp Leu Leu Gln Glu Gly 50 55 60 Tyr Gln Lys Tyr His Gly Ser Thr Phe Lys Ile Ala Leu Phe Asp Gln 65 70 75 80 Trp Leu Val Val Phe Ser Gly Ser Asn Met Val Asp Glu Leu Met Arg 85 90 95 Arg Pro Asp Ser Glu Leu Ser Phe Leu Glu Gly Ile Glu Glu Val Val 100 105 110 His Met Lys Tyr Thr Val Gly His Glu Ala Leu Gly Asp Pro Tyr His 115 120 125 Val Gly Ile Ile Lys Glu Lys Leu Thr Arg Met Leu Pro Thr Val Leu 130 135 140 Pro Asp Leu Thr Glu Glu Leu Ala Ile Ser Val Gln Glu Tyr Ile Pro 145 150 155 160 Thr Gln Gly Asp Glu Trp Thr Ala Val Asn Val Met Thr Thr Met Gln 165 170 175 Lys Ile Val Ala Arg Ala Ser Asn Arg Val Phe Val Gly Leu Pro Leu 180 185 190 Cys Arg Asn Glu Glu Phe Leu Ala Leu Pro Leu Arg Phe Thr Leu Asp 195 200 205 Val Met Lys Asp Met Val Val Met Ser Ile Thr Pro Asp Ile Leu Lys 210 215 220 Arg Pro Val Gly His Leu Val Ser Asn Ala Arg Arg Thr Met Ala Gln 225 230 235 240 Ala Met Lys Tyr Ile Gln Pro Val Ile Ala Glu Arg Lys Ala Asn Met 245 250 255 Lys Asp Leu Gly Glu Asp Trp Ser Asp Lys Pro Asn Asp Val Leu Gln 260 265 270 Trp Val Ile Asp Glu Ala Val Arg Arg Asn His Ser Asp Val Ser Val 275 280 285 Val Glu Arg Ile Phe Leu Val Asn Phe Ala Ala Ile His Thr Ser Ser 290 295 300 Thr Asn Met Thr His Val Leu Tyr Asp Leu Ala Ser Arg Pro Glu Cys 305 310 315 320 Ile Gln Pro Leu Arg Glu Glu Ile Glu Gly Ile Val Ala Thr Asp Gly 325 330 335 Trp Ser Lys Ser Ala Ile Ala Lys Met Trp Lys Leu Asp Ser Leu Phe 340 345 350 Arg Glu Ser Ser Arg Tyr His Gly Ile Ser Leu Ile Gly Leu Met Arg 355 360 365 Lys Ser Val Lys Asp Ile Thr Leu Ser Asp Gly Thr Phe Ile Pro Lys 370 375 380 Gly Thr Val Leu Ala Thr Ala Ala Arg Pro Met His His Asp Gly Ser 385 390 395 400 Lys Tyr Ala Asn Ala Asp Val Leu Asp Pro Phe Arg Phe Glu Arg Met 405 410 415 Arg His Gly Glu Gly Glu Gly Leu Lys His Gln Phe Val Asn Thr Ser 420 425 430 Asn Asp Phe Val Ser Phe Gly His Gly Lys His Ala Cys Pro Gly Arg 435 440 445 Phe Phe Ala Ala Ser Glu Leu Lys Ala Leu Leu Ala Tyr Ile Leu Ile 450 455 460 Asn Tyr Asp Ile Lys Leu Gly Gly Asp Gly Thr Arg Pro Ala Asn Phe 465 470 475 480 Tyr Tyr Gly Thr Asn Val Val Pro Ser Val Thr Gly Gln Val Leu Phe 485 490 495 Arg Lys Arg His Ala Gln Ala Ser 500 <210> 5 <211> 40 <212> DNA <213> HF-CYP5150L8-F(Artificial Sequence) <400> 5 ggcaaaggaa taatctcgag tcatgtaatt agttatgtca 40 <210> 6 <211> 40 <212> DNA <213> HF-CYP5150L8-R(Artificial Sequence) <400> 6 cgagcggtct aaggcggttt acttctcgta ggaacaattt 40 <210> 7 <211> 20 <212> DNA <213> HF-CYP5150L8-CX-F(Artificial Sequence) <400> 7 atttcgatga tgcagcttgg 20 <210> 8 <211> 20 <212> DNA <213> HF-CYP5150L8-CX-R(Artificial Sequence) <400> 8 acatcaaaat ccacattctc 20 <210> 9 <211> 40 <212> DNA <213> GL21117-F(Artificial Sequence) <400> 9 taattttaat caaaaagttt atggcgacgt tggaggaccc 40 <210> 10 <211> 40 <212> DNA <213> GL21117-R(Artificial Sequence) <400> 10 attaatttga attaacgttt tcaagaagcc tgcgcatgcc 40 <210> 11 <211> 20 <212> DNA <213> P450-CX-F(Artificial Sequence) <400> 11 gccaatactt cacaatgttc 20 <210> 12 <211> 20 <212> DNA <213> P450-CX-R(Artificial Sequence) <400> 12 tcattttgtc attgaccttc 20 <210> 13 <211> 26 <212> DNA <213> P1-F(Artificial Sequence) <400> 13 tttgtttgtt tatgtgtgtt tattcg 26 <210> 14 <211> 20 <212> DNA <213> P1-R(Artificial Sequence) <400> 14 cttgaccgca gttaactgtg 20 <210> 15 <211> 20 <212> DNA <213> P2-F(Artificial Sequence) <400> 15 cacagttaac tgcggtcaag 20 <210> 16 <211> 20 <212> DNA <213> P2-R(Artificial Sequence) <400> 16 gttgcgcagc ctgaatggcg 20 <210> 17 <211> 20 <212> DNA <213> P3-F(Artificial Sequence) <400> 17 cgccattcag gctgcgcaac 20 <210> 18 <211> 23 <212> DNA <213> P3-R(Artificial Sequence) <400> 18 ggagattgat aagacttttc tag 23 <210> 19 <211> 38 <212> DNA <213> A9-GL20421-F(Artificial Sequence) <400> 19 gaaaagtctt atcaatctcc tcagtctgca cgacgcac 38 <210> 20 <211> 40 <212> DNA <213> A9-GL20421-R(Artificial Sequence) <400> 20 aacacacata aacaaacaaa atgatcatcc cagtagacat 40 <210> 21 <211> 20 <212> DNA <213> P1-P2-FP(Artificial Sequence) <400> 21 gtaagacgat tgctaaccac 20 <210> 22 <211> 21 <212> DNA <213> P2-P3-FP(Artificial Sequence) <400> 22 gttgagtgtt gttccagttt g 21 <210> 23 <211> 20 <212> DNA <213> P3-P4-FP(Artificial Sequence) <400> 23 atgtgatttc gaccattgac 20 <210> 24 <211> 20 <212> DNA <213> P1-P4-RP(Artificial Sequence) <400> 24 aagacggtag gtattgattg 20

Claims

1. A method for preparing Ganoderma lucidum triterpenoids, characterized in that: include: The new Ganoderma triterpenes are formed by catalyzing Ganoderic acid HLDOA by the P450 gene GL21117 or by catalyzing Ganoderic acid HLDOA by the P450 gene GL20421 and the P450 gene GL21117, that is, the two P450 genes GL20421 and GL21117 are cloned separately or together into a Saccharomyces cerevisiae overexpression plasmid, and the Saccharomyces cerevisiae overexpression plasmids are transformed into a recombinant microorganism Saccharomyces cerevisiae for heterologous expression, and the transformed strains are fermented to achieve the desired effect; New Ganoderma triterpenes formed by ganoderic acid HLDOA catalyzed by the P450 gene GL21117 include: 3,15-dihydroxy-lanosta-8,24-diene-26-oic acid (15-hydroxy-ganoderic acid HLDOA), ganoderic acid Y (ganoderic acid Y), 3,15,30-trihydroxy-lanosta-8,24-diene-26-oic acid (15,30-dihydroxy-ganoderic acid HLDOA), and 7-oxo-3,15-dihydroxy-lanosta-8,24-diene-26-oic acid (7-oxo-15-hydroxy-ganoderic acid HLDOA). Their structural formulas are as follows: The new Ganoderma lucidum triterpenoids formed by the co-catalysis of Ganoderic acid HLDOA by P450 gene GL20421 and P450 gene GL21117 include: 24,25-dialkyl-30-hydroxy-ganoderic acid HLDOA, whose structural formula is: The nucleotide sequence of the P450 gene GL20421 is shown in Seq ID No. 1, and its amino acid sequence is shown in Seq ID No. 2; the nucleotide sequence of the P450 gene GL21117 is shown in Seq ID No. 3, and its amino acid sequence is shown in Seq ID No. 4.

Images