Reagent for detecting monkeypox virus and application thereof

Abstract

The application provides a reagent for detecting monkeypox virus and application thereof. The reagent for detecting monkeypox virus provided by the application comprises: a LAMP detection primer set for the A27L gene of monkeypox virus; and / or a LAMP detection primer set for the F3L gene of monkeypox virus. The reagent for detecting monkeypox virus provided by the application can realize specific detection of monkeypox virus, the LAMP kit provided by the application has simple detection operation, high specificity and high sensitivity, can rapidly and efficiently detect monkeypox virus, and can be used for screening and detecting monkeypox virus by primary medical and health units and disease prevention and control centers.

Description

Technical Field

[0001] The present invention relates to a molecular biology detection method for viruses in the field of biotechnology, and in particular to a reagent for detecting monkeypox virus and application thereof. Background Art

[0002] Monkeypox virus (MPV) is a linear, double-stranded DNA virus of the genus Orthopoxvirus in the family Poxviridae. It is a close descendant of the now-extinct smallpox virus. In recent years, MPV has emerged in multiple countries, with increasing incidence. Developing rapid MPV detection methods is crucial.

[0003] The most common method for detecting monkeypox virus nucleic acid is fluorescent quantitative PCR. Although it has the characteristics of strong specificity and high sensitivity, the required experimental instruments are expensive, the experimental operation is relatively complicated, and it requires a high level of professionalism from the experimental personnel. It is not suitable for grassroots laboratories where there is a shortage of professional personnel and relatively poor experimental conditions. Summary of the Invention

[0004] To solve the above problems, the present invention provides a reagent for detecting monkeypox virus and its application.

[0005] One object of the present invention is to provide a reagent for detecting monkeypox virus.

[0006] Another object of the present invention is to provide a kit for detecting monkeypox virus.

[0007] Another object of the present invention is to provide related applications of the reagent and kit for detecting monkeypox virus.

[0008] In one aspect, the present invention provides a reagent for detecting monkeypox virus, the reagent comprising:

[0009] A LAMP primer set for the monkeypox virus A27L gene; and / or

[0010] LAMP primer set for monkeypox virus F3L gene.

[0011] According to a specific embodiment of the present invention, wherein the A27L gene comprises the sequence shown in SEQ ID NO: 1;

[0012] The F3L gene includes the sequence shown in SEQ ID NO:7.

[0013] According to a specific embodiment of the present invention, the LAMP detection primer set for the monkeypox virus A27L gene includes primers with sequences shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6;

[0014] Wherein, the primer with the sequence shown in SEQ ID NO: 2 is the external primer F3 primer;

[0015] The primer with the sequence shown in SEQ ID NO: 3 is the external primer B3 primer;

[0016] The primer with the sequence shown in SEQ ID NO: 4 is an internal primer FIP primer;

[0017] The primer with the sequence shown in SEQ ID NO: 5 is the internal primer BIP primer;

[0018] The primer with the sequence shown in SEQ ID NO: 6 is a loop guide LB primer.

[0019] Preferably, the primer set further comprises an F3L gene primer set, wherein the F3L gene primer set comprises primers having sequences shown as SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12;

[0020] Wherein, the primer with the sequence shown in SEQ ID NO: 8 is the external primer F3 primer;

[0021] The primer with the sequence shown in SEQ ID NO: 9 is the external primer B3 primer;

[0022] The primer with the sequence shown in SEQ ID NO: 10 is an internal primer FIP primer;

[0023] The primer with the sequence shown in SEQ ID NO: 11 is the internal primer BIP primer;

[0024] The primer with the sequence shown in SEQ ID NO: 12 is a loop guide primer LF primer.

[0025] On the other hand, the present invention also provides a kit for detecting monkeypox virus, which comprises the reagent of the present invention.

[0026] The primer set for detecting monkeypox virus provided by the present invention is a LAMP-specific primer, which can realize efficient, rapid and highly specific detection of monkeypox virus, and has simple operation, high sensitivity and simple result identification.

[0027] According to a specific embodiment of the present invention, the kit for detecting monkeypox virus of the present invention further comprises basic reaction reagents, which include: 10×Thermopol reaction buffer, MgSO4, betaine, dNTP, and Bst DNA polymerase.

[0028] According to a specific embodiment of the present invention, the kit for detecting monkeypox virus of the present invention further comprises a positive control and / or a negative control;

[0029] Preferably, the positive control comprises monkeypox virus genomic DNA, preferably plasmid DNA of monkeypox virus gene A27L, and plasmid DNA of monkeypox virus gene F3L; the negative control is a reaction system without monkeypox virus genomic DNA.

[0030] On the other hand, the present invention also provides the use of the reagent or the kit for non-diagnostic purposes in detecting whether monkeypox virus exists in a sample.

[0031] According to a specific embodiment of the present invention, in the application of the non-diagnostic reagent or kit of the present invention to detecting whether monkeypox virus exists in a sample, the primer set is used for LAMP reaction.

[0032] Preferably, the primer set is used at a concentration of 2-8 pmol for each 25 μl reaction system. The final concentration of the primers with sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3 is independently 2-8 pmol, the final concentration of the primers with sequences shown in SEQ ID NO: 4 and SEQ ID NO: 5 is independently 24-36 pmol, and the final concentration of the primer with sequence shown in SEQ ID NO: 6 is independently 12-18 pmol.

[0033] More preferably, the primer set is used at a concentration of 8 pmol for each 25 μl reaction system, 32 pmol for each primer having a sequence shown in SEQ ID NO: 4 or SEQ ID NO: 5, and 16 pmol for each primer having a sequence shown in SEQ ID NO: 6.

[0034] Preferably, the concentration of the F3L primer set used in each 25 μl reaction system is: the final concentration of the primers with sequences shown in SEQ ID NO: 8 and SEQ ID NO: 9 is independently 2-8 pmol, the final concentration of the primers with sequences shown in SEQ ID NO: 10 and SEQ ID NO: 11 is independently 24-36 pmol, and the final concentration of the primer with sequence shown in SEQ ID NO: 12 is independently 12-18 pmol.

[0035] More preferably, the primer set is used at a concentration of 8 pmol for each 25 μl reaction volume. The final concentration of the primers with sequences shown in SEQ ID NO: 8 and SEQ ID NO: 9 is independently 8 pmol, the final concentration of the primers with sequences shown in SEQ ID NO: 10 and SEQ ID NO: 11 is independently 32 pmol, and the final concentration of the primer with sequence shown in SEQ ID NO: 12 is independently 16 pmol.

[0036] According to a specific embodiment of the present invention, in the application of the non-diagnostic reagent or kit of the present invention for detecting the presence of monkeypox virus in a sample, the LAMP reaction system further comprises a basic reaction reagent, comprising: 2.5 μl of 10×Thermopol reaction buffer, 1.5 μl of 100 mM MgSO₄, 4 μl of 5 mM betaine, 3.5 μl of 10 mM dNTPs, 1 μl of Bst DNA polymerase, and ddH₂O to a volume of 25 μl. Preferably, the amount of the basic reaction reagent used in a 25 μl reaction system is 12.5 μl.

[0037] According to a specific embodiment of the present invention, in the application of the non-diagnostic reagent or kit of the present invention to detecting whether monkeypox virus is present in a sample, the detection comprises the following steps:

[0038] S1: Extract DNA from the sample to be tested;

[0039] S2: Reaction system preparation: 25 μl reaction system contains 2 μl test sample DNA, 2.5 μl 10× Thermopol reaction buffer, 1.5 μl 100 mM MgSO4, 4 μl 5 mM betaine, 3.5 μl 10 mM dNTP, 1 μl Bst DNA polymerase, and ddH2O to 25 μl. Primer addition amounts are as follows: 0.8 μl each of 100 μM FIP / BIP primers (final concentration 32 pmol), 0.1 μl each of 100 μM F3 / B3 primers (final concentration 4 pmol), 0.4 μl of 100 μM LF / LB primers (final concentration 16 pmol), and ddH2O to 25 μl.

[0040] S3: The reaction system is placed in a constant temperature amplification reaction at 62°C-63°C for 45-60 minutes to obtain a reaction solution;

[0041] S4: Result analysis: Use calcein color indicator or turbidity meter to detect and analyze the reaction solution.

[0042] According to specific embodiments of the present invention, the non-diagnostic reagents or kits of the present invention are primarily used for in vitro detection of the presence of monkeypox virus in a sample. The sample may be an in vitro sample from a human or animal, or an environmental sample such as air, food, or water from the natural environment, or samples from surfaces of daily necessities or other contact objects of humans or animals, or human or animal excrement.

[0043] According to a specific embodiment of the present invention, in the application of the non-diagnostic reagent or kit of the present invention for in vitro detection of the presence of monkeypox virus in a sample, in step S3, the reaction system is subjected to a constant temperature amplification reaction at 63° C. for 60 minutes.

[0044] According to a specific embodiment of the present invention, when the non-diagnostic reagent or kit of the present invention is used to detect whether monkeypox virus is present in a sample in vitro, the specific method for analyzing the results in step S4 is:

[0045] When using calcein color indicator for detection, 1 μl of calcein color indicator is added to the reaction solution. Green color indicates the presence of monkeypox virus in the sample to be tested (positive), and orange color indicates the absence of monkeypox virus in the sample to be tested (negative);

[0046] When using a turbidity meter for testing, an increase in turbidity (>0.1) indicates the presence of monkeypox virus in the sample to be tested (positive), and no change in turbidity indicates the absence of monkeypox virus in the sample to be tested (negative).

[0047] Specifically, the reagent for detecting monkeypox virus of the present invention and its application have the following characteristics:

[0048] 1) The reagent of the present invention can specifically recognize specific regions of the monkeypox virus target sequence, ensuring the high specificity of LAMP amplification;

[0049] 2) The present invention has the characteristics of high sensitivity, and the detection sensitivity is 100-1000 times higher than that of ordinary PCR;

[0050] 3) The present invention is simple, rapid, and efficient to operate. The test sample (target nucleic acid) and the test reagents need only be placed in a 63°C constant-temperature water bath for 60 minutes before the result can be determined. Therefore, no large-scale equipment or specialized personnel are required, making it more suitable for grassroots testing.

[0051] 4) The results of the present invention are easy to identify and can be observed by naked eye (calcein color development) or directly determined using a turbidimeter;

[0052] In summary, the present invention can detect monkeypox virus quickly, conveniently, efficiently, highly specifically, and highly sensitively under isothermal conditions without the need for complex instruments, providing a new technical platform for the detection of monkeypox virus. It can be used for screening and detecting monkeypox virus in primary medical and health units and various disease prevention and control centers, has broad market prospects and great economic and social benefits, and is suitable for large-scale promotion and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 These are partial results of the A27L primer screening for detecting monkeypox virus in Example 1.

[0054] Figure 2 These are partial screening results of the reaction temperature of the A27L primer used to detect monkeypox virus in Example 2.

[0055] Figure 3 The results of the real-time turbidimeter using the A27L primer specificity assay for monkeypox virus detection in Example 3 are shown.

[0056] Figure 4 The results of the real-time turbidimeter for the sensitivity of the A27L primer used for monkeypox virus detection in Example 3 are shown.

[0057] Figure 5 This is the calcein staining result of the sensitivity of the A27L primer used for monkeypox virus detection in Example 3.

[0058] Figure 6 The sensitivity results of monkeypox virus detection using conventional PCR with A27L primer in Example 3 are shown.

[0059] Figure 7 These are partial results of the F3L primer screening for detecting monkeypox virus in Example 1.

[0060] Figure 8 These are partial screening results of the reaction temperature of the F3L primer used to detect monkeypox virus in Example 4.

[0061] Figure 9 The results of the F3L primer-specific real-time turbidimeter used for monkeypox virus detection in Example 5 are shown.

[0062] Figure 10 The sensitivity of the F3L primer used for monkeypox virus detection in Example 5 is measured by real-time turbidimetry.

[0063] Figure 11 This is the sensitivity calcein staining result of F3L primer 3 used for monkeypox virus detection in Example 5.

[0064] Figure 12 The sensitivity results of monkeypox virus detection using conventional PCR and F3L primers in Example 5 are shown. DETAILED DESCRIPTION

[0065] The present invention designs twelve special primers suitable for monkeypox virus detection, and based on the developed primers, prepares a kit and a detection method suitable for rapid, convenient, efficient, highly specific, and highly sensitive detection of monkeypox virus. The kit and method can carry out the detection reaction under isothermal conditions of 60°C to 65°C, without the need for special or expensive equipment and professionals, and because there is no time loss due to thermal changes, the amplification efficiency of the technology is very high, and the target sequence can be amplified efficiently, rapidly, and highly specifically under isothermal conditions, which is very suitable for on-site rapid detection in primary medical and health units and various disease prevention and control centers.

[0066] The present invention is further described below with reference to specific embodiments.

[0067] The following disclosure provides many different embodiments or examples for implementing different aspects of the present invention. The present invention provides examples of various specific processes and materials, but a person skilled in the art will recognize the application of other processes and / or the use of other materials.

[0068] The following describes preferred embodiments of the present invention in conjunction with the accompanying drawings. It should be understood that the preferred embodiments described herein are intended only to illustrate and explain the present invention and are not intended to limit the present invention. Any operating methods not specifically noted in the examples are to be performed in accordance with conventional procedures in the art or the conditions recommended in the manufacturer's instructions.

[0069] Unless otherwise specified, the biological materials used in each example were from the Bacteria Research Laboratory of Capital Institute of Pediatrics.

[0070] Example 1: Primer design for LAMP detection of monkeypox virus

[0071] The present invention obtained 168 monkeypox virus genomic sequences from databases such as GenBank. Based on the sequence shown in SEQ ID NO: 1 (belonging to the A27L gene of the monkeypox virus) and the sequence shown in SEQ ID NO: 7 (belonging to the F3L gene of the monkeypox virus), ten sets of primers for LAMP detection of monkeypox virus were designed using the software Primer design V5 (http: / / primerexplorer.jp / lampv5e / index.html). The nucleotide sequences of each primer set are shown in Table 1 below.

[0072] Partial sequence of the A27L gene of monkeypox virus SEQ ID NO: 1:

[0073] AATCAGCGATTCCTATAACCGTTCTTGTATTTGTGGGAACATAATTAGGATCTTCTAATGGATTGTATGGCTTGATAGCATCATCTTTATCATTATTAGGTGGGGGATGGACAACCTTAATTGGTTGGTCCTCCTTATCTCCTCCAGTAGCATGTGGTTCTTCAATACCAGTATTAGTAATAGGCTTAGACAAATGCTTGTCGTACGCGGGCACTTCCTCATCCATCAAGTATTTATAATCGGGTTCTGTTTCAGAATATTCTTTTCTAAGAGACGCGACTTCAGGAGTTAGTAGAAGAACTCTGTTTCTGTATCTATCAACGCTGGAATCGATACTCAAGTTAAGGATAGCGAATACCTCATCGTCATCATCCGTATCTTCTGAAACGCCATCATATGACATTTCATGAAGTCTAACGTATTGATAAACAGAATCAGATTTAGTATTAAACAGATCCTTGACCTTTTTAGTAAATGCATATGTATATTTTAGATCTCCA。

[0074] F3L gene sequence of monkeypox virus SEQ ID NO:7:

[0075] TCAGAATTCTAATGATGACATAACTAAGAAGTTTATCTACAGCCAATTTAGCTGCATTATTTTTAGCATCTCGTTTAGATTTTCCATCTGCCTTATCGAATACTCTTCCGTCCAATGTCTACACAGGCATAAAATGTAGGAGAGTTACTAGGCCCCACTGATTCAATACGAAAAGACCAATCTCTCCTAGTTATTTGGCAGTACTCATTAATAACGGTGACAGGGTTAACACC TTTCCAATAAATAATTTTTTTAACCGGAATAACATCATCAAAAGACTTATTATCCTCTCATTGATTTTTCGCGGGATACATCATCTATTATAGCATCAGCATCAGAATCTGTAGGCCGTGTATCAGCATCCATTGTCGTAGACCAACGAGGAGGAGTATCGTCGGAACTGTACACCATAGTACTACGTTGAAGATCATACAGAGCTTTATTAACTTCTCGCTTCTCCAT.

[0076] Table 1: Nucleotide sequence information of monkeypox virus LAMP detection primers

[0077]

[0078]

[0079]

[0080] LAMP amplification reactions were performed using the aforementioned primer sets 1-5 for monkeypox A27L pseudovirus and primer sets 6-10 for monkeypox F3L pseudovirus (the pseudovirus preparation steps were completed by Sangon Biotech Co., Ltd.). After the reaction, the turbidity of the reaction solution before and after the reaction was directly measured using a turbidimeter.

[0081] Test results such as Figure 1 and Figure 7As shown, it can be seen that compared with the Set-2, Set-4, Set-3 and Set-5 primer groups, the Set-1 primer group has the best amplification effect, and compared with the Set-7, Set-8, Set-9 and Set-10 primer groups, the Set-6 primer group has the best amplification effect, the turbidity change before and after the reaction is the most obvious, and the time consumed for the turbidity change is also the shortest. Therefore, the present invention determines to use the Set-1 primer group and the Set-6 primer group as the optimal primer groups for detecting the monkeypox virus A27L gene and the F3L gene in the following examples, respectively.

[0082] Example 2: Establishment of a LAMP Detection Method for Monkeypox Virus A27L Gene

[0083] This example used the same reaction system and the Set-1 primer set of Example 1 to perform LAMP detection on monkeypox A27L pseudovirus at 60-65°C. Specifically, the following steps were included:

[0084] 1) Using monkeypox A27L pseudovirus (final concentration = 1 ng / μl) as the template, a 25 μl LAMP reaction system included: 2 μl of the positive plasmid template, 2.5 μl of 10× ThermoPol reaction buffer (New England Biolabs Inc., Massachusetts, USA; 1× ThermoPol reaction buffer contains 20.0 mM Tris-HCl (pH 8.8), 10.0 mM KCl, 2.0 mM MgSO₄, 10.0 mM (NH₄)₂SO₄, 0.1% Triton X-100), 4 μl of 5 mM betaine (Sigma-Aldrich Inc., St Louis, USA), 1.5 μl of 100 mM MgSO₄ (New England Biolabs Inc., Massachusetts, USA), and 10 mM dNTPs (TaKaRa Bio Inc., Clontech). The volume was filled with 3.5 μl of DNA polymerase (Genentech Laboratories, Inc., Dalian, China) and 1 μl of Bst DNA polymerase (New England Biolabs Inc., Massachusetts, USA). The primers added were: 0.8 μl each of 100 μM FIP / BIP primers (final concentration 32 pmol), 0.1 μl each of 100 μM F3 / B3 primers (final concentration 4 pmol), and 0.4 μl of 100 μM LB primers (final concentration 16 pmol). The volume was filled with ddH2O to 25 μl.

[0085] 2) Amplification conditions: Keep the cells at a constant temperature of 60-65°C for 60 minutes.

[0086] 3) After the reaction is completed, the results are determined: the turbidity change of the reaction solution before and after the reaction is directly detected by a turbidity meter to determine the results. Figure 2 shown.

[0087] according to Figure 2 From the test results, it can be seen that when the reaction temperature is 62°C-63°C, the turbidity change of the reaction solution before and after the reaction is more obvious than that under other temperature conditions, and the time taken for the turbidity change to occur is also relatively short. Among them, the turbidity change before and after the reaction at a reaction temperature of 63°C is the most obvious, and the time taken for the turbidity change to occur is also the shortest. Therefore, the present invention determines that a reaction temperature of 63°C is used as the optimal reaction temperature for the monkeypox virus LAMP detection method.

[0088] Example 3: Specificity and sensitivity of the LAMP detection method for the monkeypox virus A27L gene

[0089] This example uses the Set-1 primer set obtained in Example 1 and the monkeypox virus LAMP detection method at the optimal reaction temperature of Example 2 to detect monkeypox virus to verify the specificity and sensitivity of the method.

[0090] 3.1 Specific detection of the A27L gene

[0091] In this step, monkeypox A27L pseudovirus, monkeypox virus-positive plasmid pUC-A27L, variola virus plasmid containing A27L segment, cowpox virus plasmid containing A27L segment, vaccinia virus plasmid containing F3L segment, common respiratory virus coronavirus HCoV, influenza B virus, respiratory syncytial virus, parainfluenza virus, human metapneumovirus, human enterovirus 71, coxsackievirus A, coxsackievirus B, herpes simplex virus type 1, herpes simplex virus type 2, varicella-zoster virus, adenovirus, human bocavirus, rhinovirus, Klebsiella pneumoniae ATCC2146, Mycoplasma pneumoniae standard strain, Streptococcus pneumoniae, Haemophilus influenzae, Stenotrophomonas maltophilia, and Staphylococcus aureus were used as templates, and nuclease-free water was used as a negative control to test the specificity of the optimal monkeypox virus LAMP detection method determined in Example 2 (reaction temperature: 63° C., reaction system: see Example 2).

[0092] After the reaction is completed, the result is determined by adding 1 μl of calcein color indicator containing 0.5 mM calcein and 10 mM manganese chloride to the reaction solution (the final reaction system is 26 μl). The result is determined by the color change of the reaction solution (the principle is that calcein is a metal ion indicator, and calcein reacts with Mn in the reagent). 2+ The binding is in the quenched state. When the amplification reaction occurs, the released pyrophosphate and Mn 2+The calcein is released by binding, the quenching state is released, and yellow-green fluorescence is emitted). Green indicates that the monkeypox virus is present in the sample to be tested (positive), and orange indicates that the monkeypox virus is not present in the sample to be tested (negative). Figure 5 As shown; or without adding calcein indicator, use turbidity meter to detect the change of turbidity of reaction solution before and after reaction to judge the result (the principle is: during LAMP reaction, pyrophosphate is released, and pyrophosphate reacts with Mg in the system 2+ The combination is magnesium pyrophosphate, which is a white precipitate. The turbidity meter can judge the LAMP reaction based on the change in turbidity). An increase in turbidity (>0.1) indicates the presence of monkeypox virus in the sample to be tested (positive), and no change in turbidity indicates the absence of monkeypox virus in the sample to be tested (negative).

[0093] like Figure 3 As shown, the meaning of each curve is:

[0094] PC-1: positive control (plasmid pUC-A27L);

[0095] PC-2: positive control (Monkeypox A27L pseudovirus);

[0096] NC: negative control (sterile water);

[0097] 1:variola virus plasmid containing A27L fragment;

[0098] 2:cowpox virus containing A27L fragment;

[0099] 3:vaccinia virus plasmid containing A27L fragment;

[0100] 4:human coronavirus (HCoV);

[0101] 5:influenza B;

[0102] 6:respiratory syncytial virus(RSV)A;

[0103] 7:respiratory syncytial virus(RSV)B;

[0104] 8: parainfluenza (PIV);

[0105] 9: human metapneumovirus (HMPV);

[0106] 10: human enterovirus 71 (EV71);

[0107] 11: coxsackievirus A (CVA);

[0108] 12: coxsackievirus B (CVB);

[0109] 13: herpes simplex virus type 1 (HSV1);

[0110] 14: herpes simplex virus type 2 (HSV2);

[0111] 15: varicella - zoster virus (VZV);

[0112] 16: adenovirus (ADV);

[0113] 17: human bocavirus (BoV);

[0114] 18: rhinovirus (Rh);

[0115] 19: Klebsiella pneumoniae;

[0116] 20: Mycoplasma pneumoniae (MP);

[0117] 21: Streptococcus pneumoniae;

[0118] 22: Haemophilus influenzae;

[0119] 23: Stenotrophomonas maltophilia;

[0120] 24: Staphylococcus aureus.

[0121] In the figure: “+” indicates positive and “-” indicates negative. According to Figure 3The results showed that only samples PC-1 (monkeypox virus positive plasmid pUC-Monkeypox-A27L) and PC-2 (monkeypox A27L pseudovirus) underwent LAMP reaction, while the others did not, indicating that the LAMP detection method for monkeypox virus of the present invention has high specificity.

[0122] 3.2 Sensitivity detection of A27L gene

[0123] This step compares the sensitivity of the LAMP detection method provided in Example 2 above with that of the conventional PCR method for detecting monkeypox virus. The method is as follows:

[0124] The monkeypox A27L pseudovirus obtained in Example 1 was diluted in a 10-fold gradient, and then the pseudovirus diluted in a gradient (concentrations of 10 7 copies / μl, 10 6 copies / μl, 10 5 copies / μl, 10 4 copies / μl, 10 3 copies / μl, 10 2 copies / μl, 10 1 copies / μl, 10 0 copies / μl) as template, and respectively used the LAMP detection method of Example 2 and the common PCR method (PCR detection primer sequences are:

[0125] A27L-F3: 5'-TTCTTGTATTTGTGGGAACAT-3' (SEQ ID NO: 2);

[0126] A27L-B3: 5'-GATGGATGAGGAAGTGCC-3' (SEQ ID NO: 3)) was used to detect the aforementioned gradient diluted monkeypox pseudovirus-A27L to compare the detection sensitivity of the two.

[0127] The results were determined as described in step 3.1 above, using two methods: adding calcein color indicator to the reaction solution and using a turbidimeter. Figure 4-Figure 6 As shown, Figure 4 This is the turbidity meter test result of the LAMP detection method. Figure 5 This is the result of the color reaction of the calcein indicator in the LAMP detection method. Figure 6 This is the sensitivity test result of the common PCR method. Figure 4 、 Figure 5 and Figure 6 Medium: 1-8 are 10 respectively 7 copies / μl, 106 copies / μl, 10 5 copies / μl, 10 4 copies / μl, 10 3 copies / μl, 10 2 copies / μl, 10 1 copies / μl, 10 0 copies / μl; "+" means positive, "-" means negative. It can be seen that the minimum detection concentration of the LAMP detection method provided in Example 2 is 10 copies / μl, while the minimum detection concentration of the common PCR method is 10 3 The results of the calcein indicator staining method and the turbidimeter detection method were consistent, indicating that the sensitivity of the LAMP method for detecting monkeypox virus in the present invention is 100 times higher than that of the common PCR detection method.

[0128] Example 4: Establishment of a LAMP Detection Method for Monkeypox Virus F3L Gene

[0129] This example used the same reaction system and the Set-6 primer set of Example 1 to perform LAMP detection on monkeypox F3L pseudovirus at 60-65°C. Specifically, the following steps were included:

[0130] 1) Using monkeypox F3L pseudovirus (final concentration = 1 ng / μl) as a template, a 25 μl LAMP reaction system included: 2 μl of the positive plasmid template, 2.5 μl of 10× ThermoPol reaction buffer (New England Biolabs Inc., Massachusetts, USA, 1× ThermoPol reaction buffer contains 20.0 mM Tris-HCl (pH 8.8), 10.0 mM KCl, 2.0 mM MgSO₄, 10.0 mM (NH₄)₂SO₄, 0.1% Triton X-100), 4 μl of 5 mM betaine (Sigma-Aldrich Inc., St Louis, USA), 1.5 μl of 100 mM MgSO₄ (New England Biolabs Inc., Massachusetts, USA), and 10 mM dNTPs (TaKaRa Bio Inc., Clontech). The volume was filled with 3.5 μl of DNA polymerase (Genentech Laboratories, Inc., Dalian, China) and 1 μl of Bst DNA polymerase (New England Biolabs Inc., Massachusetts, USA). The primers added were: 0.8 μl each of 100 μM FIP / BIP primers (final concentration 32 pmol), 0.1 μl each of 100 μM F3 / B3 primers (final concentration 4 pmol), and 0.4 μl of 100 μM LF primer (final concentration 16 pmol). The volume was filled with ddH2O to 25 μl.

[0131] 2) Amplification conditions: Keep the cells at a constant temperature of 60-65°C for 60 minutes.

[0132] 3) After the reaction is completed, the results are determined: the turbidity change of the reaction solution before and after the reaction is directly detected by a turbidity meter to determine the results. Figure 8 shown.

[0133] according to Figure 8 From the test results, it can be seen that when the reaction temperature is 62°C-63°C, the turbidity change of the reaction solution before and after the reaction is more obvious than that under other temperature conditions, and the time taken for the turbidity change to occur is also relatively short. Among them, the turbidity change before and after the reaction at a reaction temperature of 63°C is the most obvious, and the time taken for the turbidity change to occur is also the shortest. Therefore, the present invention determines that a reaction temperature of 63°C is used as the optimal reaction temperature for the monkeypox virus LAMP detection method.

[0134] Example 5: Specificity and sensitivity of the LAMP assay for the monkeypox virus F3L gene

[0135] This example uses the Set-6 primer set obtained in Example 1 and the monkeypox virus LAMP detection method at the optimal reaction temperature of Example 4 to detect monkeypox virus to verify the specificity and sensitivity of the method.

[0136] 5.1. Specific detection of the F3L gene

[0137] This step uses monkeypox F3L pseudovirus, monkeypox virus positive plasmid pUC-F3L, smallpox virus plasmid containing F3L fragment, cowpox virus plasmid containing F3L fragment, vaccinia virus plasmid containing F3L fragment, common respiratory virus coronavirus HCoV, influenza B virus, respiratory syncytial virus, parainfluenza virus, human metapneumovirus, human enterovirus 71, coxsackievirus A, coxsackievirus B, herpes simplex virus type 1, herpes simplex virus type 2, varicella-zoster virus, adenovirus, human bocavirus, rhinovirus, Klebsiella pneumoniae ATCC2146, Mycoplasma pneumoniae standard strain, Streptococcus pneumoniae, Haemophilus influenzae, Stenotrophomonas maltophilia, and Staphylococcus aureus as templates, and nuclease-free water as a negative control to detect the specificity of the optimal monkeypox virus LAMP detection method determined in Example 2 above (reaction temperature: 63° C., reaction system see Example 2).

[0138] After the reaction is completed, the result is determined by adding 1 μl of calcein color indicator containing 0.5 mM calcein and 10 mM manganese chloride to the reaction solution (the final reaction system is 26 μl). The result is determined by the color change of the reaction solution (the principle is that calcein is a metal ion indicator, and calcein reacts with Mn in the reagent). 2+ The binding is in the quenched state. When the amplification reaction occurs, the released pyrophosphate and Mn 2+ The calcein is released by binding, the quenching state is released, and yellow-green fluorescence is emitted). Green indicates that the monkeypox virus is present in the sample to be tested (positive), and orange indicates that the monkeypox virus is not present in the sample to be tested (negative). The results are as follows Figure 11 As shown; or without adding calcein indicator, use turbidity meter to detect the change of turbidity of reaction solution before and after reaction to judge the result (the principle is: during LAMP reaction, pyrophosphate is released, and pyrophosphate reacts with Mg in the system 2+ The combination is magnesium pyrophosphate, which is a white precipitate. The turbidity meter can judge the LAMP reaction based on the change in turbidity). An increase in turbidity (>0.1) indicates the presence of monkeypox virus in the sample to be tested (positive), and no change in turbidity indicates the absence of monkeypox virus in the sample to be tested (negative).

[0139] Specific test results such as Figure 9 As shown, the meaning of each curve is:

[0140] PC-1:positive control(plasmid pUC-F3L);

[0141] PC-2:positive control(Monkeypox F3L pseudovirus);

[0142] NC:negative control(sterile water);

[0143] 1:variola virus plasmid containing F3L fragment;

[0144] 2:cowpox virus containing F3L fragment;

[0145] 3:vaccinia virus plasmid containing A27L fragment;

[0146] 4:human coronavirus(HCoV);

[0147] 5:influenza B;

[0148] 6:respiratory syncytial virus(RSV)A;

[0149] 7:respiratory syncytial virus(RSV)B;

[0150] 8:parainfluenza(PIV);

[0151] 9:human metapneumovirus(HMPV);

[0152] 10:human enterovirus 71(EV71);

[0153] 11:coxsackievirus A(CVA);

[0154] 12:coxsackievirus B(CVB);

[0155] 13:herpes simplex virus type 1(HSV1);

[0156] 14:herpes simplex virus type 2(HSV2);

[0157] 15: varicella-zoster virus (VZV);

[0158] 16:adenovirus(ADV);

[0159] 17:human bocavirus (BoV);

[0160] 18: rhinovirus (Rh);

[0161] 19:Klebsiella pneumoniae;

[0162] 20:Mycoplasma pneumoniae(MP);

[0163] 21: Streptococcus pneumoniae;

[0164] 22:Haemophilus influenzae;

[0165] 23:Stenotrophomonas maltophilia;

[0166] 24:Staphylococcus aureus.

[0167] In the figure: "+" means positive, "-" means negative. Figure 9 The results showed that only samples PC-1 (monkeypox virus positive plasmid pUC-Monkeypox-F3L) and PC-2 (monkeypox F3L pseudovirus) underwent LAMP reaction, while the others did not, indicating that the LAMP detection method for monkeypox virus of the present invention has high specificity.

[0168] 5.2 Sensitivity Detection of F3L Gene

[0169] This step compares the sensitivity of the LAMP detection method provided in Example 4 above with that of the conventional PCR method for detecting monkeypox virus. The method is as follows:

[0170] The monkeypox F3L pseudovirus obtained in Example 1 was diluted in a 10-fold gradient, and then the pseudovirus (concentrations of 10 7 copies / μl, 10 6 copies / μl, 10 5 copies / μl, 10 4 copies / μl, 10 3 copies / μl, 10 2copies / μl, 10 1 copies / μl, 10 0 copies / μl) as templates, and the LAMP detection method of Example 2 and the common PCR method (PCR detection primer sequence is

[0171] F3L-F3: 5'-TCTCGTTTAGATTTTCCATCTG-3' (SEQ ID NO: 8);

[0172] F3L-B3: 5'-TCTTTTGATGATGTTATTCCGG-3' (SEQ ID NO: 9)) was used to detect the aforementioned serially diluted monkeypox F3L pseudovirus to compare the detection sensitivities of the two.

[0173] The results were determined as described in step 5.1 above, using two methods: adding calcein color indicator to the reaction solution and using a turbidity meter. Figure 10-12 As shown, Figure 10 This is the turbidity meter test result of the LAMP detection method. Figure 11 The color reaction test result of the calcein indicator of the LAMP detection method, Figure 12 This is the sensitivity test result of the common PCR method. Figure 10 、 Figure 11 and Figure 12 Medium: 1-8 are 10 respectively 7 copies / μl, 10 6 copies / μl, 10 5 copies / μl, 10 4 copies / μl, 10 3 copies / μl, 10 2 copies / μl, 10 1 copies / μl, 10 0 copies / μl; "+" means positive, "-" means negative. It can be seen that the minimum detection concentration of the LAMP detection method provided in Example 4 is 10 1 copies / μl, while the minimum detection concentration of the common PCR method is 10 4 The results of the calcein indicator staining method and the turbidity meter detection method were consistent, indicating that the sensitivity of the LAMP method for detecting monkeypox virus in the present invention is 1000 times higher than that of the common PCR detection method.

[0174] Example 6: LAMP Detection Kit for Monkeypox Virus

[0175] This embodiment provides a LAMP detection kit for monkeypox virus detection, specifically comprising:

[0176] A dedicated specific primer set for detecting monkeypox virus (i.e., the A27L-1 and F3L-1 primer sets obtained in Example 1, wherein the A27L-1 primer set includes primers F3 / B3, FIP / BIP, and LB, and the F3L-1 primer set includes primers F3 / B3, FIP / BIP, and LF);

[0177] Specifically, the LAMP detection kit for detecting monkeypox virus includes the following reagents for a 25 μl reaction system: 2.5 μl 10×ThermoPol reaction buffer (1×ThermoPol reaction buffer includes 20.0 mM Tris-HCl (pH 8.8), 10.0 mM KCl, 2.0 mM MgSO4, 10.0 mM (NH4)2SO4, 0.1% Triton X-100), 5 mM betaine 4 μl, 100 mM MgSO4 1.5 μl, 10 mM dNTP 3.5 μl, Bst DNA polymerase 1 μl, and the primer addition amount is: 0.8 μl each of 100 μM FIP / BIP primers (final concentration 32 pmol), 0.1 μl each of 100 μM F3 / B3 primers (final concentration 4 pmol), 100 μM 0.4 μl of LF or LB primer (final concentration 16 pmol); when used, add 2 μl of template (genomic DNA of the sample to be tested, final concentration > 1 ng / μl) to a 25 μl reaction system, and add ddH2O to make up to 25 μl;

[0178] For ease of detection, the kit may also include a positive control and a negative control, wherein the positive control is monkeypox virus A27L gene plasmid DNA (described in Example 1), and the negative control is a reaction system without monkeypox virus genomic DNA, such as H2O (double-distilled water, sterile deionized water, etc.);

[0179] To facilitate detection, the kit may also include instructions or other carriers describing the LAMP detection method obtained in Examples 2 and 4, and the result detection and determination method described in Examples 3 and 5, wherein the detection method includes the reaction conditions: constant temperature at 63°C for 60 minutes.

[0180] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or substitute equivalents for some of the technical features. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. A reagent for detecting monkeypox virus, comprising a LAMP detection primer set for the monkeypox virus A27L gene and a LAMP detection primer set for the monkeypox virus F3L gene; in, The LAMP detection primer set for the monkeypox virus A27L gene consists of primers with sequences shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6; The primer having the sequence shown in SEQ ID NO: 2 is the external primer F3 primer; The primer having the sequence shown in SEQ ID NO: 3 is the external primer B3 primer; The primer with the sequence shown in SEQ ID NO: 4 is the internal primer FIP primer; The primer with the sequence shown in SEQ ID NO: 5 is the internal primer BIP primer; The primer with the sequence shown in SEQ ID NO: 6 is the loop guide LB primer; The LAMP detection primer set for the monkeypox virus F3L gene consists of primers with sequences shown in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12; The primer having the sequence shown in SEQ ID NO: 8 is the external primer F3 primer; The primer having the sequence shown in SEQ ID NO: 9 is the external primer B3 primer; The primer with the sequence shown in SEQ ID NO: 10 is the internal primer FIP primer; The primer with the sequence shown in SEQ ID NO: 11 is the internal primer BIP primer; The primer with the sequence shown in SEQ ID NO: 12 is a loop guide primer LF primer.

2. The reagent according to claim 1, wherein The A27L gene includes the sequence shown in SEQ ID NO: 1; The F3L gene includes the sequence shown in SEQ ID NO:

7.

3. A kit for detecting monkeypox virus, comprising the reagent according to any one of claims 1 to 2.

4. The kit according to claim 3, wherein The kit further comprises basic reaction reagents, which include reaction buffer, MgSO4, betaine, dNTP and Bst DNA polymerase.

5. The kit according to claim 3 or 4, wherein The kit also includes a positive control and a negative control; The positive control comprises plasmid DNA of monkeypox virus gene A27L and plasmid DNA of monkeypox virus gene F3L, and the negative control is a reaction system without monkeypox virus genomic DNA.

6. Use of the reagent according to any one of claims 1 to 2 or the kit according to any one of claims 3 to 5 for detecting the presence of monkeypox virus in a sample, wherein the use is for non-diagnostic purposes.

7. The use according to claim 6, wherein: The primer set is used for LAMP reaction; The primer sets were used in each 25 μl reaction at the following concentrations: 2-8 pmol for the primers with sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3, 24-36 pmol for the primers with sequences shown in SEQ ID NO: 4 and SEQ ID NO: 5, and 12-18 pmol for the primer with sequence shown in SEQ ID NO:

6. The primer sets were used at concentrations per 25 μl reaction volume: the final concentrations of the primers with sequences shown in SEQ ID NO: 8 and SEQ ID NO: 9 were independently 2-8 pmol, the final concentrations of the primers with sequences shown in SEQ ID NO: 10 and SEQ ID NO: 11 were independently 24-36 pmol, and the final concentrations of the primers with sequences shown in SEQ ID NO: 12 were independently 12-18 pmol.

8. The use according to claim 7, wherein: The primer sets were used at the following concentrations per 25 μl reaction: The final concentration of the primers represented by SEQ ID NO:2 and SEQ ID NO:3 is independently 8 pmol, the final concentration of the primers represented by SEQ ID NO:4 and SEQ ID NO:5 is independently 32 pmol, and the final concentration of the primers represented by SEQ ID NO:6 is independently 16 pmol; the final concentration of the primers represented by SEQ ID NO:8 and SEQ ID NO:9 is independently 8 pmol, the final concentration of the primers represented by SEQ ID NO:10 and SEQ ID NO:11 is independently 32 pmol, and the final concentration of the primers represented by SEQ ID NO:12 is independently 16 pmol.

9. The use according to claim 7, wherein: The LAMP reaction system further comprises basic reaction reagents, which include: 2.5 μl of reaction buffer, 1.5 μl of 100 mM MgSO4, 4 μl of 5 mM betaine, 3.5 μl of 10 mM dNTP, 1 μl of Bst DNA polymerase, and ddH2O to 25 μl.

10. The use according to any one of claims 7 to 9, wherein: The detection comprises the following steps: S1: Extract DNA from the sample to be tested; S2: Reaction system preparation: 25 μl reaction system contains 2 μl test sample DNA, 2.5 μl reaction buffer, 1.5 μl 100mM MgSO4, 4 μl 5mM betaine, 3.5 μl 10mM dNTP, 1 μl Bst DNA polymerase, 0.8 μl each of 100 μM FIP / BIP primers, 0.1 μl each of 100 μM F3 / B3 primers, 0.4 μl of 100 μM LF / LB primers, and ddH2O to 25 μl. S3: The reaction system is placed in a constant temperature amplification reaction at 62°C-63°C for 45-60 minutes to obtain a reaction solution; S4: Result analysis: Use calcein color indicator or turbidity meter to detect and analyze the reaction solution.

11. The use according to claim 10, wherein: In step S3, the reaction system is placed at 63° C. for a constant temperature amplification reaction for 60 minutes.

12. The use according to claim 10, wherein: The method for analyzing the results in step S4 is as follows: when using calcein color indicator for detection, 1 μl of calcein color indicator is added to the reaction solution. Green color indicates the presence of monkeypox virus in the test sample, and orange color indicates the absence of monkeypox virus in the test sample.

Images