Use of mlph gene in preparation of drug for treating pneumoconiosis

By targeting and silencing the MLPH gene in macrophages and reducing TGF-β expression, the molecular mechanism of fibrosis in pneumoconiosis has been resolved, providing a new therapeutic target and strategy, and slowing the progression of pulmonary fibrosis.

CN115747214BActive Publication Date: 2025-11-18ANHUI UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210813811.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-12
Publication Date
2025-11-18
Estimated Expiration
2042-07-12

AI Technical Summary

Technical Problem

The fibrotic mechanism of pneumoconiosis is unclear and there is a lack of effective treatments. Macrophages play an important role in the progression of pneumoconiosis. Abnormal TGF-β signaling leads to tissue fibrosis. There are currently no reports of melanavirin being associated with pneumoconiosis.

Method used

Targeting and silencing the MLPH gene in macrophages, through small interfering RNA or recombinant vectors, interferes with MLPH gene expression, reduces TGF-β expression, slows down EMT progression in alveolar epithelial cells, and provides a new therapeutic target.

Benefits of technology

By targeting the MLPH gene, the expression of macrophage profibrotic factor TGF-β was reduced, slowing down the progression of pulmonary fibrosis and providing a new immune target and treatment strategy for the prevention and treatment of pneumoconiosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115747214B_ABST
    Figure CN115747214B_ABST
Patent Text Reader

Abstract

The application discloses application of an MLPH gene in preparation of a drug for treating pneumoconiosis, and belongs to the field of biological medicines. The application targets and silences the MLPH gene in a macrophage by using small interfering RNA, and stimulates the macrophage by using dust particulate matter. It is found that MLPH is an upstream gene of TGF-beta, and the dust particulate matter can induce the macrophage to produce TGF-beta by regulating MLPH, thereby participating in the EMT process of the fibrosis of pneumoconiosis. The application finds an important molecular mechanism in the fibrosis process of pneumoconiosis, and provides a new immune target for prevention and treatment of pneumoconiosis.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, in particular to the application of MLPH gene in the preparation of drugs for treating pneumoconiosis. BACKGROUND

[0002] Pneumoconiosis is a kind of pulmonary fibrosis disease caused by dust, which is the most serious and highest incidence occupational lung disease at present, but its fibrosis mechanism is not clear and there is lack of effective treatment. It is of great significance to explore the molecular mechanism of fibrosis caused by pneumoconiosis for early intervention and prevention and treatment target of the disease. Long-term exposure of miners to high levels of silica and coal dust causes long-term inflammation in the lungs, and under the long-term action of various inflammatory factors and cells, it eventually progresses to irreversible pneumoconiosis.

[0003] Macrophages play a very important role in the progression of pneumoconiosis, which completes the role of "cleaner" in lung tissue by phagocytizing various particles, however, various inflammatory factors produced in the process of particle phagocytosis cause epithelial-to-mesenchymal transition (EMT) of lung epithelial cells and fibroblasts, which accelerates the process of pulmonary fibrosis.

[0004] Transforming growth factor-β (TGF-β) belongs to a group of TGF-β superfamily that regulates cell growth and differentiation, and plays an important role in early embryonic development and tissue and organ formation, immune surveillance, tissue repair and adult homeostasis balance. Abnormal TGF-β signal transduction may lead to the occurrence of diseases such as tissue fibrosis. Melanophilin (MLPH) plays a crucial role in regulating skin pigmentation through melanosome transport. Melanosome transport involves the distribution of melanosome in cells and its movement from the perinuclear to the tip of the melanocyte dendrite. Mlph complex is closely related to melanosome transport through actin filaments. There is no report on the relationship between melanophilin and pneumoconiosis. SUMMARY

[0005] The purpose of the present application is to provide the application of MLPH gene in the preparation of drugs for treating pneumoconiosis, in order to solve the problems existing in the prior art. By targeting the MLPH gene of macrophages, it is verified that MLPH is an upstream gene of TGF-β, and dust particles can induce macrophages to produce TGF-β by regulating MLPH, thereby participating in the EMT process of fibrosis of pneumoconiosis, which provides a new immune target for the prevention and treatment of pneumoconiosis.

[0006] To achieve the above purpose, the present application provides the following scheme:

[0007] The application provides application of an MLPH gene in preparation of a drug for treating pneumoconiosis; a nucleotide sequence of the MLPH gene is shown in SEQ ID NO:1.

[0008] atggggaaaaggttggaccttt ccacgctcac agacgaggag gctgagcacg tgtgggcagtggttcagcgg gactttgacc tcaggaggcg agaggaagaa agactccagg ggctgaaggg caaaatacaaaaggagagct ccaagaggga gctgctgtcg gacacagccc atctgaatga gactcactgt gcccgctgcctgcagcccta ccggctgctc ctgaacagca gacgacagtg cctagagtgc agcctcttcg tctgcaaaagctgcagccac gcccacccag aagagcaggg ctggctctgc gacccctgcc acctggccag ggtcgtgaagatcggttctc tggagtggta ctaccagcac gtgagggctc gcttcaagcg tttcgggagt gccaaagtgatccggtctct ctgtgggcgg ctgcagggtg gaggtggatc tgagccaagc ttggaagaag gaaatggagacagtgagcag actgatgagg atggagacct ggacacagag gccagagacc agcccctcaa cagcaaaaagaaaaagcgcc tgctctcctt ccgagatgtg gactttgagg aagactcaga ccacttggtg cagccttgcagccaaacctt gggcctgtcc tcagtccctg agtctgcaca cagcctgcag tccctctcag gtgagccctactctgaggac accacctctc tggagcccga gggcctagag gagactggtg caagggcttt gggatgtcatcccagtcctg aagtgcagcc atgtagccct ttaccctctg gggaggatgc tcacgctgaa ctggactcgcctgcagcatc ctgcaagagt gcctttggga ccacagctat gcctggaaca gacgatgtca ggggcaaacatctgccctca cagtacctggctgatgtaga cacctctgat gaagacagta tccagggtcc cagggcagcctcccagcata gcaagaggag ggcccggact gtgcctgaga ctcagatctt ggagttgaac aagcgaatgtcagctgtgga gcacctgcta gtccacctgg agaatacggt tctgccaccc tcagcccagg aaccaactgtggagacacac cccagtgctg acacagagga ggagacactc aggaggaggc tggaggagct gaccagcaacatcagtggtt ccagcacctc atcagaagat gagaccaagc cagatggcac cttccttgga gggtccccaaaggtgtgcac agacacaggg cacatggaga cacaggaaag gaaccctcgg agccctggga accctgctcggcctacaaaa agcacagatg aggagctctc tgagatggag gatagagtgg ccatgacagc ctctgaagttcagcaggctg agagtgagat ctcagacatc cagtccagga tcgcagctct gagagccgca ggactcacagtgaagccctc gggaaaacct cggagaaagt caggcatccc gatctttctt ccccgcgtta ctgagaaacttgacaggatc ccaaagactc cacctgcaga ccctgatgac caagccaaga tgcccaaggc aacaacagctgtgccctctc tcctgaggag gaagtattct cccagcagcc aaggcgtaga cagtggttct tttgatcggaaatcagtgta ccgtggctcg ctgacacaaa ggaaccctaa cgggaggaga gggacagcca gacacatcttcgcgaaaccc gtgatggccc agcagcccta a.

[0009] Preferably, the inhibition of the expression of said MLPH gene achieves the treatment of said pneumoconiosis.

[0010] The present invention also provides a small interfering RNA targeting the MLPH gene, wherein the nucleotide sequence of the small interfering RNA is the sense strand shown in SEQ ID NO:3 and the antisense strand shown in SEQ ID NO:4.

[0011] SEQ ID NO: 3 is as follows:

[0012] 5'-GATCCGTTCAAGCGGGACTTTGACCTCCTTCCTGTCAGA GAGGTCAAAG TCCCGCTGAACTTTTTG-3';

[0013] SEQ ID NO: 4 is as follows:

[0014] 5'-GATCCGGGCAAAATACAAAAGGAGCTTCCTGTCAGA CTCCTTTTGTATT TTGCCC TTTTTG-3'.

[0015] This invention also provides a short hairpin RNA targeting the MLPH gene, wherein the sequence of the short hairpin RNA is any one of the sequences described in SEQ ID NO: 2-4:

[0016] shRNA-1 (SEQ ID NO: 2):

[0017] 5'-GATCCGCTGTGATTCTTTAACCCGATCTTCCTGTCAGA ATCGGGTTAAAGAATCACAGCTTTTTG-3';

[0018] shRNA-2 (SEQ ID NO: 3):

[0019] 5'-GATCCGTTCAAGCGGGACTTTGACCTCCTTCCTGTCAGA GAGGTCAAAG TCCCGCTGAACTTTTTG-3';

[0020] shRNA-3 (SEQ ID NO: 4):

[0021] 5'-GATCCGGGCAAAATACAAAAGGAGCTTCCTGTCAGA CTCCTTTTGTATT TTGCCC TTTTTG-3'.

[0022] The present invention also provides a recombinant vector comprising the aforementioned small interfering RNA.

[0023] Preferably, the recombinant vector further includes a lentivirus or adenovirus vector.

[0024] The present invention also provides the application of the small interfering RNA, or the short hairpin RNA, or the recombinant vector described herein in silencing the MLPH gene.

[0025] The present invention also provides the application of the small interfering RNA, or the short hairpin RNA, or the recombinant vector in the preparation of drugs for treating pneumoconiosis, thereby achieving the treatment of pneumoconiosis by silencing MLPH through the small interfering RNA or the recombinant vector.

[0026] Preferably, the small interfering RNA targets and interferes with the MLPH gene to slow down the EMT progression of alveolar epithelial cells, thereby preventing and treating pulmonary fibrosis.

[0027] The present invention also provides a medicament for treating pneumoconiosis, comprising the small interfering RNA and a pharmaceutically acceptable carrier or adjuvant.

[0028] The present invention discloses the following technical effects:

[0029] 1) This invention provides a small interfering RNA that targets the MLPH gene, thereby providing a new strategy for developing targeted pneumoconiosis fibrosis by knocking out the MLPH gene in macrophages.

[0030] 2) This invention infects macrophages with a small interfering RNA lentiviral vector of the MLPH gene, thereby reducing the expression of the profibrotic factor TGF-β after macrophages are stimulated by coal dust and silica.

[0031] 3) This invention also discovers an important molecular mechanism in the fibrotic process of pneumoconiosis by targeting and interfering with macrophages with RNAi to slow down the EMT progression of alveolar epithelial cells, providing a new therapeutic target for the development of targeted pneumoconiosis fibrosis. Attached Figure Description

[0032] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0033] Figure 1 Stable transfected cells were obtained by infecting macrophages with lentiviruses and screening for drugs.

[0034] Figure 2 The expression of MLPH in lentivirally infected macrophages; A: qPCR verification results; B: Western blot verification results;

[0035] Figure 3The effects of different stimuli on the secretion of TGF-β by macrophages that target and knock out MLPH: A: TGF-β secretion level at the transcriptional level stimulated by coal dust; B: TGF-β secretion level at the transcriptional level stimulated by silica; C: TGF-β secretion level at the protein level stimulated by coal dust; D: TGF-β secretion level at the protein level stimulated by silica.

[0036] Figure 4 To verify the effect of coal dust and silica stimulation on alveolar epithelial cell EMT in macrophages that target and knock out MLPH. Detailed Implementation

[0037] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0038] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0039] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0040] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0041] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0042] Example 1: Construction of macrophages stably expressing the targeted silencing of the MLPH gene

[0043] 1. Construct the recombinant plasmid pGreenPuro-MLPHshRNA-GFP

[0044] Based on the mouse MLPH gene sequence (SEQ ID NO: 1), and following the principles of siRNA target sequence design, an MLPH-specific shRNA sequence (SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4) was designed: The blank vector (pGreenPuro) was digested with EcoRI and BamHI. TM The lentiviral vector contains a GFP gene expression regulated by a CMV promoter. The expression of green fluorescent protein (GFP) is controlled by the CMV promoter. As an indicator of transduction efficiency, the complete shRNA sequence was synthesized by Shanghai Gemma Biotechnology Co., Ltd. The routine steps, including shRNA template annealing, preparation of linearized expression vectors, ligation of interfering fragments into the expression vector, transformation of competent cells for ligation products, verification, and sequencing, are not detailed here.

[0045] 2. Virus packaging, purification, and titer determination

[0046] 1) Resuscitate 293T cells, passage them 2-3 times until the cells are stable and growing well, then begin preparing to produce the virus.

[0047] 2) Add the plasmid and PEI transfection reagent to DMEM according to the ratio of (pdR8.1:pcmv-vsvg:target plasmid):PEI=(4.5:4.5:9)ug:54ul and let stand for 5 minutes.

[0048] 3) Add the plasmid to PEI and quickly mix it by pipetting. After the mixed transfection reagent has been left at room temperature for 15 minutes, add it evenly to the cells to be transfected.

[0049] 4) After two more days of culture, collect the cell culture medium and filter the virus-containing DEME medium through a 0.45µm filter membrane;

[0050] 5) Centrifuge at 1000 rpm for 10 minutes to collect the dissolved virus.

[0051] 3. Lentiviral infection of cells followed by drug screening to obtain stable transfected strains.

[0052] 1) When the Raw264.7 cells to be infected with the virus reach a density of 80-90%, passage them. After passage, add an appropriate amount of purified lentivirus and Polybrene at a final concentration of 1 μg / ml to increase the infection efficiency.

[0053] 2) After about 24 hours, the culture medium containing lentivirus was aspirated and replaced with fresh DEME medium. 48 hours after infection, Puromycin was added to a final concentration of 2 μg / ml to begin screening.

[0054] 3) Replace the culture medium with fresh one every two days and add puromycin. Continue screening until there is no obvious cell death. After screening twice with the same medium, if all blank cells die, then a stable transgenic strain can be considered obtained (see results). Figure 1 );

[0055] 4) After screening, stable transgenic cells were subjected to qPCR and WB for MLPH verification;

[0056] The primer sequences used for qPCR are as follows:

[0057] Table 1 Primers

[0058] Gene Sequence (5'-3') GAPDH-F AGGTCGGTGTGAACGGATTTG GAPDH-R TGTAGACCATGTAGTTGAGGTCA MLPH-F GTTCAGCGGGACTTTGACCTC MLPH-R GGCACAGTGAGTCTCATTCAGA

[0059] The specific steps for qPCR testing are as follows:

[0060] (a) a. RNA template denaturation

[0061] Prepare the following mixture in an RNase-free PCR tube:

[0062] Table 2 RNA template denaturation mixture

[0063] Reagent Volume DEPC-H2O 13 μl Oligo dT (50 uM) 1 μl Random hexamers (50 ng / ul) 1 μl Total RNA 1 μg

[0064] Heat at 65℃ for 5 minutes, then quickly place on ice and let stand on ice for 2 minutes.

[0065] (b) Preparation of the first-strand cDNA synthesis reaction solution

[0066] Table 3 First-strand cDNA Synthesis Reaction Solution

[0067]

[0068] Add the reaction solutions according to Table 3, and gently mix them by pipetting.

[0069] (c) Perform the first-strand cDNA synthesis reaction under the following conditions.

[0070] Table 4. Reaction conditions for first-strand cDNA synthesis

[0071] Temperature Time 25℃ 5 min 50℃ 45 min 85℃ 5 min

[0072] The reverse transcription product can be used immediately for QRT-PCR reactions or stored at -20°C.

[0073] (d) Prepare the following real-time quantitative PCR reaction system in the qPCR tube.

[0074] Table 5. Real-time PCR reaction system

[0075] 2 x AceQ Universal SYBR qPCR Master Mix 10.0 μl Upstream primer F (10 μm) 0.4 μl Downstream primer R (10 μm) 0.4 μl cDNA template 1.2 μl ddH2O Supplemented to 20.0 μl

[0076] (e) Perform qPCR reaction under the following conditions

[0077] Table 6 qPCR reaction procedure

[0078]

[0079] The specific method for WB detection is as follows:

[0080] Cells were lysed using RIP with cell lysis buffer, and the supernatant was collected and centrifuged. Protein concentration was determined using the BCA method. Then, 30 μg of protein samples were subjected to SDS-PAGE gel electrophoresis. Subsequently, the samples were transferred to PVDF membranes, blocked with antibodies, and incubated overnight with primary antibodies including MLPH (1:500; Cat No. 10338-1-AP, Proteintech), GAPDH (1:10000; Cat No. 10494-1-AP, Proteintech), E-cadherin (1:10000; Cat No. 20874-1-AP, Proteintech), and N-cadherin (1:5000; Cat No. 22018-1-AP, Proteintech). The following day, the samples were washed five times with PBST for 5 minutes each time, and then incubated at room temperature for 1 hour with horseradish peroxidase-labeled goat anti-rabbit secondary antibody (1:10000; SA00001-2, Proteintech) to enhance chemiluminescence visualization. GAPDH was used as a protein loading control, and the gray values ​​of the bands were measured to evaluate protein levels.

[0081] The results are as follows Figure 2 As shown, MLPH is stably expressed in the selected stable mutant strains.

[0082] Example 2: The effect of macrophages targeting and silencing the MLPH-shRNA gene on the expression of the profibrotic factor TGF-β and its influence on alveolar epithelial cell EMT after stimulation with coal dust and SiO2.

[0083] 1) Macrophages that stably transcribe the MLPH-shRNA gene were stimulated with 200 μg / mL coal dust and SiO2, respectively. After 24 hours, the intracellular TGF-β RNA transcription level and the TGF-β content in the cell supernatant were detected.

[0084] The synthesis and qPCR methods for TGF-β cDNA were the same as those used in Example 1 to verify the expression of the MLPH gene in the stable transgenic strain.

[0085] The results are as follows Figure 3 As shown: By infecting macrophages with a small interfering RNA lentiviral vector of the MLPH gene, the expression of the profibrotic factor TGF-β was reduced after macrophages were stimulated by coal dust and silica.

[0086] 2) Macrophages that stably transcribed the MLPH-shRNA gene were stimulated with 200 μg / mL coal dust and SiO2, respectively. Using Transwell chambers, MLE-12 alveolar epithelial cells were seeded in the upper chamber, and macrophages that transcribed the MLPH-shRNA gene were seeded in the lower chamber. The effects of substances secreted by macrophages that transcribed the MLPH-shRNA gene stimulated by coal dust and SiO2 on the expression of E-Cadherin and N-Cadherin in MLE-12 cells were studied.

[0087] 3) Western blotting was used to detect the expression of E-cadherin and N-cadherin in MLE-12 cells. The results are as follows: Figure 4 As shown, transwell assays revealed that RAW264.7 macrophages stimulated with coal dust and SiO2 downregulated E-Cadherin and upregulated N-Cadherin in MLE-12 cells, promoting EMT transformation of alveolar epithelial cells. However, macrophages with MLPH knockout maintained the original expression of E-Cadherin and N-Cadherin in MLE-12 cells after stimulation with coal dust and SiO2, without promoting EMT transformation of alveolar epithelial cells.

[0088] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of small interfering RNA that targets and knocks out the MLPH gene in the preparation of drugs for treating pneumoconiosis, characterized in that, The nucleotide sequence of the small interfering RNA is any one of those shown in SEQ ID NO: 3-4; The pneumoconiosis is treated by silencing MLPH with the small interfering RNA.

2. The application of short hairpin RNA targeting and knocking out the MLPH gene in the preparation of drugs for treating pneumoconiosis, characterized in that, The sequence of the short hairpin RNA is any one of the sequences shown in SEQ ID NO: 2-4.

3. The use of a recombinant vector comprising the small interfering RNA of claim 1 or the short hairpin RNA of claim 2 in the preparation of a drug for treating pneumoconiosis; The pneumoconiosis is treated by silencing MLPH with the small interfering RNA.

4. The application as described in claim 3, characterized in that, The recombinant vector also includes lentivirus or adenovirus vectors.

5. A drug for treating pneumoconiosis, characterized in that, It includes the small interfering RNA as described in claim 1 and pharmaceutically acceptable adjuvants.