Anti-mouse IgG1 goat antibody and its application

The goat antibody library was screened and optimized by phage display technology, and the traditional method of preparing secondary antibodies was solved. Goat antibodies that specifically recognize mouse IgG1 in high affinity and do not cross-react with human IgG were obtained, achieving the application of efficient preparation of mouse IgG1 secondary antibodies.

CN115772223BActive Publication Date: 2025-08-15BIOINTRON BIOLOGICAL INC
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210810059.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-11
Publication Date
2025-08-15
Estimated Expiration
2042-07-11

AI Technical Summary

Technical Problem

Traditional methods for preparing secondary antibodies are cumbersome and have a long cycle, making it difficult to obtain goat antibodies that efficiently specifically recognize mouse IgG1 and do not cross-react with human IgG.

Method used

Goat antibodies that specifically recognize mouse IgG1 and do not cross-react with human IgG were screened out from the goat antibody library by phage display technology. The antibody library was screened and verified by phage display technology. The antibody sequence was optimized by combining directed evolution and point mutation technology, and expression vectors were constructed and antibodies were expressed in host cells, labeled as horseradish peroxidase.

Benefits of technology

Goat antibodies that specifically recognize mouse IgG1 were obtained, which can be used to prepare mouse IgG1 secondary antibodies, with significant application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115772223B_ABST
    Figure CN115772223B_ABST
Patent Text Reader

Abstract

The present invention relates to a goat antibody against mouse IgG1 and its application. The antibody comprises at least one of a heavy chain CDR1, a heavy chain CDR2, a heavy chain CDR3, a light chain CDR1, a light chain CDR2, and a light chain CDR3. The antibody can be used to prepare a secondary antibody against mouse IgG1. The present invention obtains a goat antibody targeting mouse IgG1 using phage display technology. The antibody can specifically recognize mouse IgG1 with high affinity, weakly binds to mouse IgG2a and IgG3, and has no cross-reactivity with human IgG, thus having important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to an anti-mouse IgG1 goat antibody and application thereof, belonging to the field of biotechnology. Technical Background

[0002] The antibody that comes from mice as the first source is called the primary antibody, and the secondary antibody is the antibody that can bind to the first antibody, that is, the antibody of the antibody. Its main function is to detect the presence of the antibody and amplify the signal of the primary antibody. The secondary antibody plays a huge role in indirect enzyme-linked immunosorbent assay, immunochromatography and other experiments. The preparation of traditional secondary antibodies uses the antigenic nature of antibodies as large molecular proteins to immunize xenogeneic animals. The immunoglobulins produced by the immune system of xenogeneic animals against this antibody have the disadvantages of long preparation cycle and cumbersome operation. Antibody library technology is a technology that clones all the variable region genes of antibodies of a certain animal in plasmids or phages for expression, and uses different antigens or antibodies to screen out clones carrying specific antibody genes to obtain corresponding specific antibodies. Antibody library technology can not only simulate the process of antibody production by the animal immune system, but also has many unique advantages. Antibody library technology does not require immunization. Theoretically, 10 ~10 The library capacity can accommodate all antibodies. Specific antibodies can be directly screened from the non-immune animal antibody library using antigens or antibodies, and antibodies against the species' own antigens can be screened. Summary of the Invention

[0003] The main purpose of the present invention is to provide a goat antibody that is anti-mouse IgG1 and has no cross-reactivity with human IgG, and also to provide applications of the antibody.

[0004] The technical solution of the present invention to solve the technical problem is as follows:

[0005] An anti-mouse IgG1 goat antibody, the antibody being selected from any one of the following:

[0006] i) the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the heavy chain variable region of the anti-mouse IgG1 goat antibody are as shown in the amino acid sequences at positions 31-35, 50-64, and 98-112 of SEQ ID NO: 2, respectively; and the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the light chain variable region are as shown in the amino acid sequences at positions 24-39, 55-61, and 94-102 of SEQ ID NO: 4, respectively;

[0007] or ii) the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the heavy chain variable region of the anti-mouse IgG1 goat antibody are shown in the amino acid sequences at positions 31-35, 50-64, and 98-108 of SEQ ID NO: 6, respectively, and the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the light chain variable region are shown in the amino acid sequences at positions 24-39, 55-61, and 94-102 of SEQ ID NO: 8, respectively.

[0008] As a preferred embodiment of the present invention, the heavy chain amino acid sequence of the anti-mouse IgG1 goat antibody is shown in SEQ ID NO: 2, and the light chain amino acid sequence is shown in SEQ ID NO: 4; or the heavy chain amino acid sequence is shown in SEQ ID NO: 6, and the light chain amino acid sequence is shown in SEQ ID NO: 8.

[0009] A nucleic acid encoding the anti-mouse IgG1 goat antibody of the present invention.

[0010] As a preferred embodiment of the present invention, the heavy chain DNA sequence of the anti-mouse IgG1 goat antibody is shown as SEQ ID NO: 1, and the light chain DNA sequence is shown as SEQ ID NO: 3; or the heavy chain DNA sequence is shown as SEQ ID NO: 5, and the light chain DNA sequence is shown as SEQ ID NO: 7.

[0011] Those skilled in the art can readily mutate the nucleotide sequence of the antibody of the present invention using known methods, such as directed evolution and point mutagenesis. Artificially modified nucleotides that share 75% or greater identity with the nucleotide sequence of the antibody of the present invention are derived from and are equivalent to the nucleotide sequence of the present invention.

[0012] As used herein, the term "identity" refers to sequence similarity to a naturally occurring nucleic acid sequence. "Identity" includes nucleotide sequences that are 75% or higher identical to the nucleotide sequence encoding the protein set forth in SEQ ID No. 1 of the present invention. Identity can be assessed visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess the identity between related sequences. The aforementioned 75% or higher identity can also be 75%, 80%, 85%, 90%, or 95% or higher identity.

[0013] An expression vector containing the nucleic acid. Various vectors known in the art can be used. For example, a commercially available vector can be selected and the nucleotide sequence encoding the antibody of the present invention can be operably linked to an expression control sequence to form an expression vector.

[0014] As a preferred embodiment of the present invention, the expression vector is pcDNA3.4.

[0015] A host cell containing the expression vector of the present invention. Host cells useful in the present invention include prokaryotic cells and eukaryotic cells. Examples of commonly used prokaryotic host cells include Escherichia coli and Bacillus subtilis. Host cells used for antibody expression include Escherichia coli, yeast cells, insect cells, COS cells, CHO cells, etc.

[0016] As a preferred embodiment of the present invention, the host cell is a eukaryotic cell, and the host cell is a HEK-293 cell or a CHO cell.

[0017] A labeled anti-mouse IgG1 goat antibody, wherein the antibody is the anti-mouse IgG1 goat antibody of the present invention, and the label is horseradish peroxidase.

[0018] The invention provides an application of the labeled anti-mouse IgG1 goat antibody in preparing a specific Mouse IgG1 secondary antibody or a Mouse IgG1 detection reagent.

[0019] Beneficial effects:

[0020] The present invention uses phage display technology to obtain a goat antibody targeting mouse IgG1. This antibody can specifically recognize mouse IgG1 with high affinity and has no cross-reactivity with human IgG. This antibody can be used to prepare a secondary antibody against mouse IgG1 and has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 and Figure 2 These are diagrams showing the binding of phages enriched in each round of panning to mouse IgG1 and human IgG as detected by ELISA in Example 1.

[0022] Figure 3 This is a diagram showing the binding of monoclonal phage to antigen protein detected by ELISA in Example 1.

[0023] Figure 4 This is a diagram showing the binding of positive clone phage to antigen protein detected by ELISA in Example 1.

[0024] Figure 5 This is a monoclonal enrichment rate analysis diagram of Example 1.

[0025] Figure 6 Schematic diagram of the mammalian expression plasmid in Example 2.

[0026] Among them, plasmids Unique3-H and Unique3-L are the heavy chain and light chain plasmids required for expressing goat antibody Unique3 in the mammalian system, and plasmids Unique5-H and Unique5-L are the heavy chain and light chain plasmids required for expressing goat antibody Unique5 in the mammalian system.

[0027] Figure 7 This is a polyacrylamide gel electrophoresis detection diagram of the goat antibody expressed in the mammalian system in Example 2.

[0028] 1: Unique3 mammalian system expressed antibody

[0029] 2: Unique5 mammalian system expressed antibody

[0030] Figure 8 This is a graph showing the binding ELISA results of the mammalian-expressed goat antibody Unique3 in Example 3. The ELISA curves for Human IgG and PBS overlap.

[0031] Figure 9 This is a graph showing the binding ELISA results of the mammalian-expressed goat antibody Unique5 in Example 3. The ELISA curves for Human IgG and PBS overlap.

[0032] Figure 10 This is a graph showing the results of ELISA in Example 4 detecting HRP-labeled mammalian system-expressed mouse IgG1 secondary antibody (Unique3).

[0033] Among them, the ELISA curves of Mouse IgG2a, Mouse IgG3 and Human IgG overlapped.

[0034] Figure 11 This is a graph showing the results of ELISA in Example 4 detecting HRP-labeled mammalian system-expressed mouse IgG1 secondary antibody (Unique5).

[0035] Among them, the ELISA curves of Mouse IgG2a, Mouse IgG3 and Human IgG overlapped. DETAILED DESCRIPTION

[0036] The present invention is further described in detail below with reference to the examples. However, the present invention is not limited to the examples given. The methods used are conventional methods unless otherwise specified, and the reagents and materials used are commercially available unless otherwise specified.

[0037] Example 1: Screening of goat antibodies against mouse IgG1

[0038] Using mouse IgG1 as positive screening antigen and human IgG as negative screening antigen, phage display technology was used to select goat antibody phage library (library size 1.3x10 10 ) were screened for goat antibodies that were anti-mouse IgG1 and had no cross-reactivity with human IgG.

[0039] Human IgG was coated onto ELISA plates using solid phase panning, 100 μL per well, overnight at 4°C. Washed three times with PBST, 200 μL of casein was added to each well, and blocked at 37°C for 2 hours. After washing three times with PBST, phage display library (approximately 1×10 12 CFU), incubate at 37°C for 1 hour, collect unbound phages, and repeat negative screening three times to remove phages bound to Human IgG. Add the phages after negative screening to the blocked ELISA strips coated with Mouse IgG1 and incubate at 37°C for 1 hour. Aspirate the unbound phages and wash 10 times with PBST. Add 100uL of glycine-hydrochloric acid solution to each well, react at 37°C for 7 minutes, gently blow the plate wells to elute the adsorbed phages, and then add Tris-HCl solution to neutralize to neutrality. The eluted phages are infecting TG1 cells in the logarithmic growth phase, and the recovered phages are amplified for the next round of panning.

[0040] After three rounds of panning, specific enrichment was verified using Phage-ELISA. Mouse IgG1 was coated onto ELISA plates at 4°C overnight. After washing three times with PBST, the plates were blocked with 3% casein at 37°C for 2 hours. After washing five times with PBST, the phage display library from the three rounds of panning was added, with approximately 1x10 12 CFU, 4-fold serial dilutions, with the last well blanked, were allowed to bind at 37°C for 1 hour. After washing five times with PBST, HRP-conjugated mouse anti-M13 secondary antibody was added and incubated at 37°C for 1 hour. After washing five times with PBST, TMB colorimetric solution was added and color was developed at room temperature in the dark for 5-10 minutes. Finally, color development was terminated with 2M sulfuric acid. The absorbance at 450 nm was read using a microplate reader and a Phage-ELISA binding curve was generated.

[0041] ELISA test results Figure 1 As shown, with the helper phage as a negative control, after three rounds of enrichment, the affinity of the phage population to mouse IgG1 increased round by round, and the ELISA test results were as follows Figure 2 As shown, with helper phage as a negative control, after three rounds of enrichment, the affinity of the phage population to Human IgG decreased gradually.

[0042] Antigen binding analysis was performed on the phage monoclonal clones enriched in the third round. The specific process was as follows:

[0043] The phage library enriched in the third round was used to infect TG1 cells, and 792 single clones were randomly selected, amplified, and recovered. Mouse IgG1 and human IgG were coated onto ELISA plates overnight at 4°C. After washing three times with PBST, the cells were blocked with 3% casein at 37°C for 2 hours. The 792 amplified monoclonal phages were incubated at a 1:1 ratio with 3% casein in PBST at room temperature for 1 hour. The incubated phages were added to the blocked ELISA plate and incubated at 37°C for 1 hour. After washing five times with PBST, an HRP-conjugated mouse anti-M13 secondary antibody was added and incubated at 37°C for 1 hour. After washing five times with PBST, TMB was added and color was developed at room temperature in the dark for 5-10 minutes. Development was terminated with 2M sulfuric acid, and the absorbance at 450nm was read using a microplate reader. Positive clones were identified as having an absorbance at least twice that of the negative control (helper phage). Analyze the binding ability of 792 monoclonal phages to Mouse IgG1 and Human IgG. The test results are as follows Figure 3 As shown in Figure 2. 18 of the 792 monoclonal phages bind to Mouse IgG1 but not to Human IgG. Figure 4 shown.

[0044] Sequencing analysis was performed on these 18 positive clones, and 7 unique sequences were obtained, of which Unique3 and Unique5 were dominant enriched clones (e.g. Figure 5 shown).

[0045] The DNA sequence of the antibody heavy chain of Unique3 is SEQ ID NO: 1, and the amino acid sequence is SEQ ID NO: 2. In the amino acid sequence, amino acid residues 31-35 (i.e., TYGVT) constitute the heavy chain CDR1, amino acid residues 50-64 (i.e., RINSGGNTGYNPALK) constitute the heavy chain CDR2, and amino acid residues 98-112 (i.e., DRNDKSDPRVGGLDY) constitute the heavy chain CDR3.

[0046] The DNA sequence of the Unique3 antibody light chain is SEQ ID NO: 3, and the amino acid sequence is SEQ ID NO: 4. In the amino acid sequence, amino acid residues 24-39 (i.e., KSSQSLVRSDGKTYLN) constitute the light chain CDR1, amino acid residues 55-61 (i.e., QVSNRYS) constitute the light chain CDR2, and amino acid residues 94-102 (i.e., FQGIEAPNS) constitute the light chain CDR3.

[0047] The DNA sequence of the antibody heavy chain of Unique5 is SEQ ID NO: 5, and the amino acid sequence is SEQ ID NO: 6. In the amino acid sequence, amino acid residues 31-35 (i.e., RNAVG) are the heavy chain CDR1, amino acid residues 50-64 (i.e., GIGSGGSTYYNPALK) are the heavy chain CDR2, and amino acid residues 98-108 (i.e., SVGGSRYAFDY) are the heavy chain CDR3.

[0048] The light chain DNA sequence of Unique5's antibody is SEQ ID NO: 7, and the amino acid sequence is SEQ ID NO: 8. In the amino acid sequence, amino acid residues 24-39 (i.e., KSSQSLVHSDGKTYLA) are the light chain CDR1, amino acid residues 55-61 (i.e., QVSNRYS) are the light chain CDR2, and amino acid residues 94-102 (i.e., YQGTETPYA) are the light chain CDR3.

[0049] Example 2: Expression and purification of anti-mouse IgG1 goat antibody in mammalian system

[0050] Using the positive clones Unique3 and Unique5 obtained in Example 1 as templates, the heavy chain variable region DNA fragment and the light chain variable region DNA fragment were amplified in large quantities using polymerase chain reaction (PCR) technology. The upstream and downstream primer sequences for amplifying the Unique3 heavy chain variable region DNA fragment were Unique3-HF: GTCCTCCTGACTGGGGTGAGGGCCCAGGTGCGGCTGCAGGAGTCGGGA and Unique3-HR: GACCGATGGGCCCTTGGTGCTAGCTGAGGAGACGGTGACCAGGAGTCC, and the upstream and downstream primer sequences for amplifying the Unique3 light chain variable region DNA fragment were Unique3-LF: GTCCTCCTGACTGGGGTGAGGGCCGATGTTGTGCTGACCCAGACTCCT and Unique3-LR: GACAGATGGTGC AGCCACCGTACGTTTGATCTCTAGCTTGGTTCCTTG. The upstream and downstream primer sequences for amplifying the DNA fragment of the heavy chain variable region of Unique5 are Unique5-HF: GTCCTCCTGACTGGGGTGAGGGCCCAGGTGAGACTGCAGGAAAGCGGC and Unique5-HR: GACCGATGGGCCCTTGGTGCTAGCGGAGGACACGGTCACCAGCAGGCC. The upstream and downstream primer sequences for amplifying the DNA fragment of the light chain variable region of Unique5 are Unique5-LF: GTCCTCCCTGACTGGGTGAGGGCCGAGGCTGTGCTGTATCAGACACCA and Unique5-LR: GACAGATGGTGCAGCCACCGTACGCTTGATCTCCACCTTGGTGCCGCC. The heavy chain variable region DNA fragment and the light chain variable region DNA fragment amplified from the positive clone Unique3 were recombined into PCDNA3.4 using DNA recombination technology, with the restriction enzyme cutting sites of HindIII / BamHI, to construct Figure 6 The heavy chain variable region DNA fragment and light chain variable region DNA fragment amplified from the positive clone Unique5 were recombined into pCDNA3.4 using DNA recombination technology, with the restriction enzyme sites HindIII / BamHI to construct Figure 6 The plasmids Unique5-H and Unique5-L were constructed and transfected into HEK-293 cells using lipofectamine transfection. HEK-293 cells in logarithmic growth phase were seeded into 6-well plates at a cell density of 1.5×10 6cell / mL, culture on a microplate shaker at 37°C in a CO2 incubator, and transfect after 1-3 hours. Add the liposome-vector mixture to the cell wells, culture for 2, 4, and 6 days, supplement the feed and fluid, and collect samples for purification on the 7th day. Use 20mL 1xPBS, a flow rate of 1mL / min to balance the chromatography column, load the sample at a flow rate of 1mL / min, wash the impurities with 20mL 1xPBS, a flow rate of 1mL / min, elute with citric acid buffer (PH3.4), a flow rate of 1mL / min, and collect in separate tubes, each tube is about 500uL. A total of 10 tubes were collected, and the absorbance value at 280nm was read using a NanoDrop instrument. The high-concentration protein was aspirated into a dialysis bag and dialyzed in a beaker containing 1XPBS. The purified antibodies were collected and the SDS-PAGE results under reducing conditions are as follows Figure 7 .

[0051] Example 3 Binding ELSIA of goat antibodies expressed in the mammalian system

[0052] Validate mammalian-expressed goat antibodies using ELISA. Dilute the mammalian-expressed anti-mouse IgG1 goat antibody from Example 2 and coat each well on an ELISA plate. Incubate overnight at 4°C. Block with 3% casein at 37°C for 1 hour. Dilute biotinylated Mouse IgG1, Mouse IgG2a, and Mouse IgG3 to form the initial concentration in the first well, then perform a 4-fold serial dilution. Use a blank well at the end of the plate and incubate at 37°C for 1 hour. Wash the plate five times with PBST and pat dry. Use SA-HRP as the secondary antibody and incubate at 37°C for 1 hour. Wash the plate five times with PBST and pat dry. Add 100 μL of TMB to each well and incubate in the dark at room temperature for 5-10 minutes. Stop color development with 2M sulfuric acid and read the absorbance at 450 nm using a microplate reader.

[0053] The results are as follows Figure 8 and Figure 9 As shown, the mammalian-expressed goat antibodies Unique3 and Unique5 both bind with high affinity to Mouse IgG1, weakly bind to Mouse IgG2a and Mouse IgG3, and do not bind to Human IgG.

[0054] Example 4 Preparation of HRP-labeled mouse IgG1 secondary antibody using anti-mouse IgG1 goat antibody expressed in the mammalian system

[0055] Label the mammalian-expressed anti-mouse IgG1 goat antibody according to the instructions for the Antibody-HRP Labeling Kit (manufacturer: Guangzhou Huayin Pharmaceutical Technology Co., Ltd.). Specifically, remove the kit from the refrigerator 30 minutes before the experiment and equilibrate to room temperature (18-25°C). Prepare 1500 mL each of CB (50 mM carbonate buffer, pH 9.6, 25°C) and PBS (10 mM phosphate, 0.9% NaCl buffer, pH 7.2, 25°C). Dialyze a 5 mg / mL solution of mammalian-expressed anti-mouse IgG1 goat antibody against 50 mM CB (pH 9.6) overnight at 4°C, changing the buffer 2-3 times. In the dark, add 0.4 mL of ultrapure water to the HRP tube and mix thoroughly. Add 1 mL of ultrapure water to the sodium periodate (NaIO3) tube and mix thoroughly. Add 45 μL of the dissolved NaIO3 solution to the HRP solution, mixing thoroughly. Incubate in the dark at room temperature for 20 minutes. Add 40 μL of ethylene glycol to the above solution, mix thoroughly, and incubate at room temperature in the dark for 30 minutes. Add the oxidized HRP solution to a solution of mammalian-expressed anti-mouse IgG1 goat antibody, mix thoroughly, and dialyze for crosslinking at room temperature for 2.5 hours. The crosslinking dialysate is 50 mM CB (pH 9.6) buffer. Add 0.5 mL of ultrapure water to the sodium borohydride (NaBH4) tube and invert several times to mix thoroughly. Remove the crosslinked antibody-HRP solution from the dialysis bag and place it in a brown glass bottle. Add 80 μL of NaBH4 solution and incubate at 4°C in the dark for 2 hours, gently shaking every 30 minutes. Place the reduced antibody-HRP solution into 10 mM PBS (pH 7.2) and dialyze overnight at 4°C (for at least 18 hours). Change the solution 3-4 times, with an interval of 2 hours between each change. Harvest the labeled antibody-HRP solution and set aside (you may add an equal amount of glycerol or other protein protectant).

[0056] Coat the ELISA plate with Mouse IgG1, Mouse IgG2a, Mouse IgG3, and Human-IgG, respectively, with 2.5ug / mL in the first well, four-fold serial dilution, and a blank in the last well. Incubate at 4°C overnight. The next day, wash 3-5 times with PBST, pat dry, add 200uL 3% casein to each well, block at 37°C for 1h, wash 3-5 times with PBST, pat dry, add 100uL HRP-labeled goat antibody (1mg / mL, 1:2000 dilution) to each well, incubate at 37°C for 1h, wash 3-5 times with PBST, pat dry, add 100uL TMB to each well, react at 37°C in the dark for 5-10min, and finally add 50uL 2M sulfuric acid to each well to stop color development. Read the absorbance at 450nm.

[0057] The results are as follows Figure 10 and Figure 11As shown, the HRP-labeled mammalian-expressed anti-mouse IgG1 goat antibody binds to Mouse IgG1, but does not bind to Mouse IgG2a, Mouse IgG3, or Human IgG, and can be used as a secondary antibody against Mouse IgG1.

Claims

1. An anti-mouse IgG1 goat antibody, characterized in that The antibody is selected from any one of the following: i) the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the heavy chain variable region of the anti-mouse IgG1 goat antibody are as shown in the amino acid sequences at positions 31-35, 50-64, and 98-112 of SEQ ID NO: 2, respectively; and the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the light chain variable region are as shown in the amino acid sequences at positions 24-39, 55-61, and 94-102 of SEQ ID NO: 4, respectively; or ii) the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the heavy chain variable region of the anti-mouse IgG1 goat antibody are shown in the amino acid sequences at positions 31-35, 50-64, and 98-108 of SEQ ID NO: 6, respectively, and the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the light chain variable region are shown in the amino acid sequences at positions 24-39, 55-61, and 94-102 of SEQ ID NO: 8, respectively.

2. The anti-mouse IgG1 goat antibody according to claim 1, wherein The anti-mouse IgG1 goat antibody has a heavy chain amino acid sequence as shown in SEQ ID NO: 2, and a light chain amino acid sequence as shown in SEQ ID NO: 4; or a heavy chain amino acid sequence as shown in SEQ ID NO: 6, and a light chain amino acid sequence as shown in SEQ ID NO:

8.

3. A nucleic acid encoding the anti-mouse IgG1 goat antibody according to claim 1 or 2.

4. The nucleic acid according to claim 3, characterized in that The heavy chain DNA sequence of the anti-mouse IgG1 goat antibody is shown in SEQ ID NO: 1, and the light chain DNA sequence is shown in SEQ ID NO: 3; or the heavy chain DNA sequence is shown in SEQ ID NO: 5, and the light chain DNA sequence is shown in SEQ ID NO:

7.

5. An expression vector comprising the nucleic acid according to claim 3 or 4.

6. The carrier according to claim 5, characterized in that The expression vector is pcDNA3.

4.

7. A host cell containing the expression vector according to claim 5 or 6.

8. The host cell according to claim 7, characterized in that The host cell is 293 cell or CHO cell.

9. A labeled anti-mouse IgG1 goat antibody, characterized in that The antibody is the anti-mouse IgG1 goat antibody according to claim 1 or 2, and the label is horseradish peroxidase.

10. Use of the anti-mouse IgG1 goat antibody according to claim 1 or 2 in preparing a specific Mouse IgG1 secondary antibody or a mouse IgG1 detection reagent.

Citation Information

Patent Citations

  • Monoclonal antibody of pig IgG3, antigen epitope peptide specifically recognized by monoclonal antibody and application thereof

    CN113004413A

  • Anti-igg nanobodies

    WO2019072977A1