Recombinant Saccharomyces cerevisiae engineered strains for high squalene production by improving ethanol tolerance and their applications

Abstract

The present invention discloses a recombinant brewer's yeast engineered strain and its application for high-yield squalene by improving ethanol tolerance, and belongs to the field of genetic engineering and bioengineering technology. The present invention expands the metabolic flow of the MVA pathway, removes the metabolic obstacles of the pathway, makes the entire metabolic pathway unobstructed, and ensures that sufficient acetyl-CoA is used for product accumulation to the maximum extent. Through the regulation of trehalose synthesis and heat shock proteins, the strain tolerance under stress environment is enhanced, so that the engineered strain still has excellent metabolic and growth production capacity under high concentration of ethanol. The activity of the modified brewer's yeast strain increased by 80.21%, the ethanol tolerance was increased to 30g / L, and it still had excellent activity under 50g / L ethanol stress. By combining metabolic engineering transformation with the transformation of stress environment tolerance, the squalene production of brewer's yeast fermentation reached 27.33g / L, and the cell production dry weight was 650.13mg / gDCW.

Description

Technical Field

[0001] The present invention relates to a recombinant saccharomyces cerevisiae engineering strain capable of producing high squalene by improving ethanol tolerance and its application, and belongs to the technical field of genetic engineering and bioengineering. Background Art

[0002] Squalene is a linear triterpenoid widely distributed in plants, animals, fungi, and humans. It is a key precursor in the biosynthesis of various triterpenes and steroids. Squalene exhibits diverse antioxidant properties and demonstrates advantages in anticancer, antitumor, skin disease treatment, and drug delivery. Squalene can stimulate and enhance immune responses to antigens and is used as a vaccine additive to improve the efficacy of vaccines, including those for pandemic influenza, malaria, and COVID-19. Squalene is primarily extracted from animal and plant oils such as shark liver oil, olive oil, and amaranth oil. However, isolating squalene from animals or plants may lead to overfishing and other environmental issues. Microbial synthesis of squalene offers advantages such as short production cycles, simple operation, high economic benefits, and freedom from raw material and environmental constraints. Advances in synthetic biology techniques offer opportunities for metabolically engineering microorganisms to efficiently synthesize squalene.

[0003] In recent years, research on metabolic engineering of microorganisms to produce squalene and terpenoids has expanded beyond the inherent MVA pathway in the cytoplasm. Various cellular organelles have also been extensively studied and applied to the production of terpenoids. Mitochondria, peroxisomes, and lipid droplets have all been used as reservoirs to enhance the accumulation of terpenoids in microorganisms. However, excessive organelle engineering can lead to the retention of excess intermediates within these organelles, increasing metabolic pressure and hindering their normal metabolic function, thus causing significant cellular metabolic stress. Compared to compartmentalized engineering, environmental stress in the fermentation process is also a significant factor limiting microbial production of terpenes and other substances. Therefore, while modifying the biosynthesis pathways of terpenoid compounds, improving strain activity and tolerance to stressful environments cannot be neglected. Research should integrate the coordinated regulation of growth and production, metabolic pathways, and other aspects to fully leverage the advantages of microbial synthesis to produce the desired product. Summary of the Invention

[0004] The present invention provides a genetically engineered bacterium with a high squalene production capacity, which is obtained by genetically modifying a starting strain, Saccharomyces cerevisiae; the genetically engineered bacterium is modified to knock out transcription factors YPL062W, ROX1, YJL064W, DOS2, and DPP1 on the genome, integrate and express genes tHMG1, IDI1, ERG19, ERG20, ERG10, ERG13, ERG12, ERG8, ERG9, ADH2, ALD6, ACS, HSP104, and TPS1, and complement the gene URA.

[0005] In one embodiment, multiple copies of genes tHMG1 and IDI1 are integrated at the Ty1 and Ty4 sites, and after the YPL062W site is knocked out, genes ERG19 and ERG20 are integrated at the YPL062W site; after the ROX1 site is knocked out, genes ERG10, ERG13, ERG12, ERG8, and ERG9 are integrated at the ROX1 site; after the YPL064W site is knocked out, genes ADH2, ALD6, and ACS are integrated at the YPL064W site; after the DPP1 site is knocked out, genes HSP104 and TPS1 are integrated at the DPP1 site.

[0006] In one embodiment, Saccharomyces cerevisiae C800 is used as the starting strain, and the Saccharomyces cerevisiae C800 is disclosed in "Promoter-library-based pathway optimization for efficient (2S)-naringenin production from p-coumaric acid in Saccharomyces cerevisiae" published by Gao, S.; Zhou, H.; Zhou, J. et al. in 2020.

[0007] In one embodiment, the nucleotide sequence of the gene tHMG1 is shown as SEQ ID NO.1, and the nucleotide sequence of the gene IDI1 is shown as SEQ ID NO.2.

[0008] In one embodiment, the nucleotide sequence of the gene YPL062W is shown as SEQ ID NO.4, the nucleotide sequence of the gene ROX1 is shown as SEQ ID NO.5, and the nucleotide sequence of the gene YJL064W is shown as SEQ ID NO.18.

[0009] In one embodiment, the nucleotide sequence of the gene DOS2 is shown as SEQ ID NO.23, and the nucleotide sequence of the gene DPP1 is shown as SEQ ID NO.24.

[0010] In one embodiment, the nucleotide sequence of ERG20 is shown as SEQ ID NO.7, the nucleotide sequence of ERG19 is shown as SEQ ID NO.9, the nucleotide sequence of ERG9 is shown as SEQ ID NO.10, the nucleotide sequence of ERG10 is shown as SEQ ID NO.12, the nucleotide sequence of ERG13 is shown as SEQ ID NO.13, the nucleotide sequence of ERG12 is shown as SEQ ID NO.14, and the nucleotide sequence of ERG8 is shown as SEQ ID NO.16.

[0011] In one embodiment, the nucleotide sequence of the gene ADH2 is shown as SEQ ID NO.20, the nucleotide sequence of the gene ALD6 is shown as SEQ ID NO.21, and the nucleotide sequence of the gene ACS is shown as SEQ ID NO.22.

[0012] In one embodiment, the nucleotide sequence of the gene HSP104 is shown as SEQ ID NO.25, and the nucleotide sequence of the gene TPS1 is shown as SEQ ID NO.26.

[0013] In one embodiment, the nucleotide sequence of the gene URA is shown as SEQ ID NO.27.

[0014] In one embodiment, the promoter P GAL10 / 1 、P TDH1 、P MET6 or P TEF Start gene expression.

[0015] In one embodiment, a bidirectional promoter P is used. GAL10 / 1 Promote the expression of genes tHMG1 and IDI1.

[0016] In one embodiment, a bidirectional promoter P is used. GAL10 / 1 Promotes the expression of genes ERG19 and ERG9.

[0017] In one embodiment, a bidirectional promoter P is used. GAL10 / 1 Promotes the expression of genes ERG13 and ERG12.

[0018] In one embodiment, a bidirectional promoter P is used. GAL10 / 1 Promote the expression of genes ALD6 and ACS.

[0019] In one embodiment, the promoter P TDH1 They respectively activate the expression of genes ERG20, ERG10 and HSP104.

[0020] In one embodiment, the promoter P MET6 They respectively activate the expression of genes ERG8 and TPS1.

[0021] In one embodiment, the promoter P TEF They respectively activate the expression of genes ADH2 and URA.

[0022] In one embodiment, the bidirectional promoter P GAL10 / 1 The nucleotide sequence of the promoter is shown in SEQ ID NO.3. TDH1The nucleotide sequence of the promoter is shown in SEQ ID NO.6. MET6 The nucleotide sequence of the promoter is shown in SEQ ID NO. 17. TEF The nucleotide sequence is shown in SEQ ID NO.19,

[0023] In one embodiment, the bidirectional terminator T ter22 The nucleotide sequence is shown in SEQ ID NO.8, and the terminator T TAT1 The nucleotide sequence is shown in SEQ ID NO.11, and the bidirectional terminator T TET The nucleotide sequence is shown as SEQ ID NO.15.

[0024] The present invention also provides a method for producing squalene, which comprises inoculating the genetically engineered bacteria into a culture medium for fermentation.

[0025] In one embodiment, the culture medium is YPD medium.

[0026] In one embodiment, the method is to produce squalene by shake flask fermentation, wherein the seed liquid of the genetically engineered bacteria is inoculated into YPD medium and fermented for 80 to 100 hours.

[0027] In one embodiment, the method is to produce squalene by fermentation in a fermenter, wherein the seed liquid of the above-mentioned genetically engineered bacteria is inoculated into a fermentation medium containing 30-50 g / L of glucose for fermentation production. After the glucose is exhausted, ethanol is added to the medium to maintain the final ethanol concentration in the medium below 20 g / L.

[0028] In one embodiment, the fermentation medium contains 15-25 g / L of peptone, 5-15 g / L of yeast powder, and 30-50 g / L of glucose.

[0029] In one embodiment, the seed solution is prepared by picking a single colony of the genetically engineered bacteria and culturing it in 5 mL of YPD medium for 20 to 24 hours at 28 to 32° C. and 200 to 220 rpm as a first-level seed solution; the first-level seed solution is inoculated at an inoculum size of 2% (v / v) in 50 mL of YPD medium and cultured for 20 to 24 hours at 28 to 32° C. and 200 to 220 rpm as a seed solution.

[0030] The present invention also provides the use of the genetically engineered bacteria in producing products containing squalene.

[0031] Beneficial effects:

[0032] The present invention uses the engineered yeast Saccharomyces cerevisiae C800 (CEN.PK2-1D: Δgal80::G418) as a host to address the issues of high-concentration ethanol stress in Saccharomyces cerevisiae and the accumulation of intermediates that inhibit strain activity during fermentation. First, the present invention overexpresses the key rate-limiting enzyme genes tHMG1 and IDI1 in the MVA pathway, as well as all non-rate-limiting enzyme genes ERG10, ERG13, ERG12, ERG8, ERG9, ERG19, and ERG20, while knocking out the transcription factors YPL062W, ROX1, YJL064W, and DOS2. This increases the flux of the MVA pathway. Furthermore, by overexpressing the key trehalose synthesis gene TSP1 and the heat shock protein gene HSP104, the present invention enhances trehalose production in Saccharomyces cerevisiae to resist ethanol stress and restores the URA gene. The activity of the modified Saccharomyces cerevisiae engineered strain SQ7 was increased by 80.21% compared with the initial strain SQ1, and its ethanol tolerance was increased to 30g / L. Moreover, the strain still had excellent activity under 50g / L ethanol stress.

[0033] The present invention further optimizes the fermentation conditions of the fermentation tank, optimizes the carbon source and the feeding time of the carbon source, and achieves a squalene production of 27.33g / L in a 5L fermentation tank, with a cell production dry weight of 650mg / g DCW, which is the highest yield and highest production capacity of squalene produced by microorganisms reported so far. The present invention makes it possible to synthesize squalene from acetyl-CoA by thoroughly strengthening the MVA pathway. Figure 1 Based on the characteristic of ethanol accumulation by Saccharomyces cerevisiae fermentation, the strain's ethanol resistance is improved by strengthening the yeast's own trehalose synthesis pathway and assisting in the regulation of heat shock proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Schematic diagram of the metabolism of squalene in Saccharomyces cerevisiae.

[0035] Figure 2 Diagram showing the overall enhancement of squalene synthesis via the MVA pathway; A: SQ1 strain, B: SQ2 strain, C: SQ2, SQ3, and SQ4 strains.

[0036] Figure 3 A regulatory map of the overall enhancement of the ethanol metabolism pathway.

[0037] Figure 4 Figure 2 is a diagram showing the regulation of ethanol tolerance of the engineered strain; A: Squalene production of the SQ5 strain under different ethanol concentrations, B: Squalene production of the SQ6 strain under different ethanol concentrations, C: Trehalose content of the SQ5 and SQ6 strains.

[0038] Figure 5Figure 3. Bacterial growth and squalene production in a 5L bioreactor. A: Optimization of molasses feeding time. B: Optimization of molasses feeding time. C: Optimization of glucose and ethanol feeding time. D: Optimization of glucose and ethanol feeding time. E: Optimization of glucose and ethanol feeding time. F: Optimization of ethanol feeding time. DETAILED DESCRIPTION

[0039] (1) Culture medium

[0040] LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride. Add 20 g / L agar powder to prepare LB solid medium.

[0041] YNB medium: Yeast Nutrition Base 67.4 g / L, glucose 20 g / L, amino acids (5 g / L uracil, 10 g / L tryptophan, 10 g / L leucine, 10 g / L histidine, with appropriate amino acid deletions as needed).

[0042] YPD medium: peptone 20 g / L, yeast powder 10 g / L, glucose 20 g / L.

[0043] Fermentation medium: peptone 20 g / L, yeast powder 10 g / L, glucose 40 g / L.

[0044] (II) Preparation and transformation of competent Saccharomyces cerevisiae

[0045] (1) A single colony of Saccharomyces cerevisiae was inoculated into 5 mL of YPD medium and cultured in a 50 mL shake flask at 30°C and 220 rpm for about 17 h to obtain the Saccharomyces cerevisiae seed solution.

[0046] (2) Measure the OD value. Pipette an appropriate amount of the above seed solution into 50 mL of fresh YPD medium to make the OD 600 Approximately equal to 0.3.

[0047] (3) Cultivate at 30°C and 220 rpm until OD 600 Between 1.2-1.5.

[0048] (4) Transfer to a 50 mL centrifuge tube and place on ice for 5 min.

[0049] (5) Centrifuge at 3500 rpm and 4°C for 5 min and discard the supernatant.

[0050] (6) Wash with 25 mL of pre-cooled sterile water, centrifuge at 3500 rpm and 4°C for 5 min, and discard the supernatant.

[0051] (7) Add 1 mL of 0.1 M lithium acetate and resuspend the cells in a 1.5 mL EP tube.

[0052] (8) Centrifuge at 4°C and 3500 rpm for 2.5 min and discard the supernatant.

[0053] (9) Resuspend the cells in 100-400 μL of pre-chilled 0.1 M lithium acetate.

[0054] (10) Centrifuge at 3500 rpm for 2 min, discard the supernatant, and add 24 μL of 50% PEG3350 (m / v), 36 μL of 1 M lithium acetate, 25 μL of ssDNA (concentration of 2 mg / mL), and 50 μL of DNA fragments in sequence.

[0055] (11) Violently shake for 10 seconds.

[0056] (12) Incubate at 30°C for 50 min.

[0057] (13) Incubate in a 42°C water bath for 20 min.

[0058] (14) Centrifuge at 3500 rpm for 2.5 min and discard the supernatant.

[0059] (15) Resuspend the cells in 500-600 μL of ddH2O.

[0060] (16) 50-80 μL of bacterial solution was spread on the corresponding YNB medium and cultured at 30°C for 3-5 days.

[0061] (3) Shake flask fermentation of squalene

[0062] Shake flask fermentation conditions: A single colony was removed and cultured in 5 mL of YPD medium in a 50 mL shake flask for 22 h at 30°C and 220 rpm as a seed solution. For fermentation experiments, a 1% seed solution was cultured in 25 mL of YPD medium in a 250 mL shake flask for 96 h.

[0063] In Example 3, the ethanol tolerance of the strain was investigated. After the seed solution was inoculated and fermented for 24 h, 10 g / L, 20 g / L, 30 g / L, 40 g / L, and 50 g / L of anhydrous ethanol were added to the fermentation broth (filtered with a sterile filter membrane before use);

[0064] When investigating the attenuation effect of 10 mg / L terbinafine on ERG1 expression, 10 mg / L terbinafine was added to the fermentation broth 24 h after the seed solution was inoculated and fermented.

[0065] (IV) Extraction and detection of squalene

[0066] Pipette 500 μL of fermentation broth into a 2 mL disruption tube (MP), centrifuge, and discard the supernatant. Retain the precipitated cells, add an equal volume of disruption beads (0.5 mm) to the disruption tube, and then add 1.5 mL of acetone. Use the FastPrep instrument's Saccharomyces cerevisiae program for 4-6 cycles of disruption. Centrifuge to separate the cells and the acetone organic layer, and extract squalene into the upper organic phase for detection. The liquid chromatography detection instrument used is a Waters UPLC with a UV detector. A Thermo Fisher (250×4.6 mm, 5 μm) C18 column was used. The chromatographic conditions were: isocratic elution, phase B was acetonitrile (0.1% trifluoroacetic acid); detection wavelength was 195 nm; column temperature was 40°C; and 15 min.

[0067] (V) Strain information is shown in Table 1.

[0068] Table 1 Strains involved in the present invention

[0069]

[0070] Example 1 Overall enhancement of the MVA pathway in Saccharomyces cerevisiae

[0071] (1) Construction of SQ1 strain

[0072] Multiple copies of tHMG1 (nucleotide sequence shown in SEQ ID NO. 1) and IDI1 (nucleotide sequence shown in SEQ ID NO. 2) were integrated into the Ty1 site of the chassis strain C800. Using the Saccharomyces cerevisiae genome as a template, the tHMG1 gene was amplified using primers Ty1-tHMG1-F1 and Ty1-tHMG1-R1, and the bidirectional promoter P was amplified using primers Gal10-F1 and Gal10-R1. GAL10 / 1 (nucleotide sequence as shown in SEQ ID NO.3), the gene IDI1 was amplified using primers Ty1-IDI1-F1 and Ty1-IDI1-R1; using Pct125 (disclosed in patent publication number CN113403334A) as a template, the Pct125 vector integration fragment was amplified using primers Ty1-TMTD1-R1 and Ty1-TLEU2-F1, and the bidirectional promoter P GAL10 / 1 , gene tHMG1, gene IDI1 and Pct125 vector integration fragment were assembled by Gibson to construct plasmid TY1-11.

[0073] Using plasmid TY1-11 as a template, primers Ty1-11-up and Ty1-11-down were used to amplify the Ty1armup-tHMG1-PGAL10 / 1-IDI1-HISdeg-Ty1armdown integration fragment. 10 μg of the integration fragment Ty1armup-tHMG1-PGAL10 / 1-IDI1-HISdeg-Ty1armdown was transformed into the Saccharomyces cerevisiae engineered strain C800 using the Saccharomyces cerevisiae efficient transformation method. The fragment was then plated onto screening YNB solid medium and cultured at 30°C for 3-5 days until colonies appeared. The correct clone was named SQ1.

[0074] A series of single colonies were selected and fermented in YPD shake flasks for 96 h, and finally the SQ1-1 strain with a squalene production of 593.3 mg / L was obtained ( Figure 2 A).

[0075] (2) Construction of SQ2 strain

[0076] Multiple copies of tHMG1 and IDI1 were integrated into the Ty4 site of SQ1-1. Using plasmid TY1-11 as a template, primers TY4-tHMG1-F1 and Ty4-IDI1-R1 were used to amplify tHMG1-P GAL10 / 1 -IDI1 expression cassette; using Pct44 (disclosed in patent publication number CN113403334A) as a template, primers Ty4-TCYC1-F1 and Ty4-TADH1-R1 were used to amplify the Pct44 vector integration fragment, and tHMG1-P GAL10 / 1 -IDI1 expression cassette and Pct44 vector integration fragment were assembled by Gibson assembly to construct plasmid TY22-1.

[0077] Using plasmid TY22-1 as a template, primers Ty44-11-up and Ty44-11-down were used to amplify Ty44armup-tHMG1-PGAL10 / 1-IDI1-TRPdeg-Ty44armdown. 10 μg of the integration fragment Ty44armup-tHMG1-PGAL10 / 1-IDI1-TRPdeg-Ty44armdown was transformed into the Saccharomyces cerevisiae engineering strain SQ1-1 in step (1) using the Saccharomyces cerevisiae efficient transformation method, and the strain was spread on the screening YNB solid medium and cultured at 30°C for 3-5 days until colonies appeared. The correct clone was verified and named SQ2.

[0078] A series of single colonies were selected for YPD shake flask fermentation for 96 h. After 96 h of shake flask fermentation, a high-yield strain SQ2-7 was obtained, whose yield was 919.1 mg / L, which was 54.9% higher than that of the Ty1 site copy strain SQ1-1 ( Figure 2 B).

[0079] (3) Construction of SQ3 strain

[0080] Multi-gene editing technology was used to knock out YPL062W (nucleotide sequence shown in SEQ ID NO.4) and ROX1 (nucleotide sequence shown in SEQ ID NO.5) in the genome of the SQ2-7 strain. Primers 3-1-ROX1-PAM-1-F, 3-1-ROX1-PAM-1-R, 3-2-ROX1-PAM-2-F, 3-2-ROX1-PAM-2-R, 3-3-YP-PAM-1-F, 3-3-YP-PAM-1-R, 3-4-YP-PAM-2-F, and 1-4-R were used to construct the gene knockout plasmid RY-1 with reference to the method of "CRISPR-Cas9 system: one-step multi-target gene editing technology applied to Saccharomyces cerevisiae". The 20 nt used to knock out ROX1 were CACGACCCTTCAACGAGACA and CGGTGTCAAGCTCGAACAGC; the 20 nt used to knock out YPL062W were AAGCAACCAGCACGTCGCCG and CACGGGAATAAGGCAGCCGA.

[0081] Using the Saccharomyces cerevisiae genome as a template, primers YPL-UP-F, YPL-UP-R, YPL-down-F, and YPL-down-R were used to amplify homology arms approximately 500 bp upstream and downstream of the YPL062W locus. Primers ROX1-UP-F, ROX1-UP-R, ROX1-down-F, and ROX1-down-R were used to amplify homology arms approximately 500 bp upstream and downstream of the ROX1 locus. The upstream and downstream homology arms were fused separately by fusion PCR, and the fused fragments were named ROX1-up / down and YPL062W-up / down. About 500-700 ng of ROX1 and YPL062W knockout plasmid RY-1 and 10 μg of ROX1-up / down and YPL062W-up / down fragments were transformed into the Saccharomyces cerevisiae engineering strain SQ2-7 using the Saccharomyces cerevisiae efficient transformation method, spread on the screening YNB solid medium, and cultured at 30°C for 3-5 days until colonies appeared. The verified correct clone was named SQ3-1.

[0082] The SQ3-1 strain was generated by knocking out YPL062W and ROX1 in the genome of the SQ2-7 strain. The squalene production was reduced compared to the control strain SQ2-7. After the expression of ERG1 was weakened by 10mg / L terbinafine, the squalene production of the SQ3-1 strain was 1080.3mg / L. The knockout of ROX1 not only increased the expression of ERGs genes before squalene, but also increased the expression of ERGs genes downstream of squalene ( Figure 2C).

[0083] (4) Construction of SQ4 strain

[0084] Using multi-gene editing technology, YPL062W and ROX1 were knocked out in the genome of Saccharomyces cerevisiae SQ2-7 strain, and ERG19 and ERG20 were overexpressed at the YPL062W locus, and ERG10, ERG13, ERG12, ERG8, and ERG9 were overexpressed at the ROX1 locus. Using the Saccharomyces cerevisiae genome as a template, primers YPL-UP-F, YPL-UP-R, YPL-down-F, and YPL-down-R were used to amplify the homology arms of about 500 bp upstream and downstream of YPL062W, and primers YPL-PTDH1-F1 and YPL-PTDH1-R1 were used to amplify P TDH1 The promoter (nucleotide sequence is shown in SEQ ID NO.6) was amplified using primers YPL-ERG20-F1 and YPL-ERG20-R1 to amplify the ERG20 fragment (nucleotide sequence is shown in SEQ ID NO.7), and the bidirectional terminator T was amplified using primers YPL-ter22T-F1 and YPL-ter22T-R1. ter22 (nucleotide sequence as shown in SEQ ID NO.8), ERG19 fragment was amplified using primers YPL-ERG19-F1 and YPL-ERG19-R1 (nucleotide sequence as shown in SEQ ID NO.9), and bidirectional promoter P was amplified using primers YPL-GAL10-F1 and YPL-GAL10-R1. GAL10 / 1 The ERG9 fragment (nucleotide sequence shown in SEQ ID NO. 10) was amplified using primers YPL-ERG9-F1 and YPL-ERG9-R1, and the terminator T was amplified using primers YPL-TAT1t-F1 and YPL-TAT1t-R1. TAT1 (The nucleotide sequence is shown in SEQ ID NO.11). Using the pY26 expression vector as a template, primers YPL-MVA-F1 and YPL-MVA-R1 were used to amplify the pY26 vector fragment. TDH1 Promoter, ERG20 fragment, bidirectional terminator T ter22 , ERG19 fragment, bidirectional promoter P GAL10 / 1 , ERG9 fragment, terminator T TAT1 The pY26 vector fragment was assembled by Gibson assembly to obtain plasmid 5. Using plasmid 5 as a template, the expression cassette fragment YPL-1 was amplified using primers YPL-UP-F and YPL-down-R.

[0085] Using the Saccharomyces cerevisiae genome as a template, primers ROX1-UP-F, ROX1-UP-R, ROX1-down-F, and ROX1-down-R were used to amplify the homology arms of about 500 bp upstream and downstream of ROX1, and primers ROX1-PTDH1-F1 and ROX1-PTDH1-R1 were used to amplify the P TDH1 The promoter was amplified using primers ROX1-ERG10-F1 and ROX1-ERG10-R1 to amplify the ERG10 fragment (nucleotide sequence shown in SEQ ID NO.12), and the bidirectional terminator T was amplified using primers ROX1-ter22T-F1 and ROX1-ter22T-R1. ter22 The ERG13 fragment (nucleotide sequence shown in SEQ ID NO. 13) was amplified using primers ROX1-ERG13-F1 and ROX1-ERG13-R1, and the bidirectional promoter P was amplified using primers ROX1-GAL10-F1 and ROX1-GAL10-R1. GAL10 / 1 The ERG12 fragment (nucleotide sequence shown in SEQ ID NO. 14) was amplified using primers ROX1-ERG12-F1 and ROX1-ERG12-R1, and the T TET The bidirectional terminator (nucleotide sequence is shown in SEQ ID NO.15) was amplified using primers ROX1-ERG8-F1 and ROX1-ERG8-R1 to amplify the ERG8 fragment (nucleotide sequence is shown in SEQ ID NO.16), and the promoter P was amplified using primers ROX1-PMET6-F1 and ROX1-PMET6-R1. MET6 (The nucleotide sequence is shown in SEQ ID NO.17); Using the pY26 expression vector as a template, primers ROX1-MVA-F1 and ROX1-MVA-R1 were used to amplify the pY26 vector fragment. The homology arms of about 500 bp upstream and downstream of ROX1, P TDH1 Promoter, ERG10 fragment, bidirectional terminator T ter22 , ERG13 fragment, bidirectional promoter P GAL10 / 1 , ERG12 fragment, T TET Bidirectional terminator, ERG8 fragment, promoter P MET6 The pY26 vector fragment was assembled by Gibson assembly to obtain plasmid 6. Using plasmid 6 as a template, the expression cassette fragment ROX1-1 was amplified using primers ROX1UP-F and ROX1-down-R.

[0086] About 500-700 ng of the plasmid RY-1 with ROX1 and YPL062W knockout in step (3) and 10 μg of the expression cassette fragments ROX1-1 and YPL-1 were transformed into the Saccharomyces cerevisiae engineering strain SQ2-7 using the Saccharomyces cerevisiae efficient transformation method, spread on the screening YNB solid medium, and cultured at 30°C for 3-5 days until colonies appeared. The verified correct clone was named SQ4-2.

[0087] The squalene production of SQ4-2 strain in shake flask fermentation reached 1405.3 mg / L ( Figure 2 C) After the expression of ERG1 was attenuated by 10 mg / L terbinafine, the squalene production of the SQ4-2 strain reached 1856.4 mg / L.

[0088] Table 2 Primer sequences

[0089]

[0090]

[0091]

[0092] Example 2: Transformation of the ethanol metabolic pathway

[0093] Because the ADH2 promoter is inhibited when ethanol concentrations exceed 2.3 g / L, this experiment utilized the constitutively strong promoter PTEF to regulate ADH2 expression, relieving the metabolic inhibition under high ethanol concentrations and promoting the accumulation of acetyl-CoA. Using multi-gene editing technology, YJL064W and DOS2 were knocked out in the genome of the Saccharomyces cerevisiae strain SQ4-2, and ADH2, ALD6, and ACS were overexpressed at the YPL064W locus.

[0094] Using the Saccharomyces cerevisiae genome as a template, primers YD01-YJLup-F1, YD01-YJLup-R1, YD01-YJLdown-F1, and YD01-YJLdown-R1 were used to amplify the upstream and downstream 500 bp homology arm fragments of YJL064W (nucleotide sequence shown in SEQ ID NO.18), and primers YD01-TEF-F1 and YD01-TEF-R1 were used to amplify P TEF The promoter (nucleotide sequence is shown in SEQ ID NO.19) was amplified using primers YD01-ADH2-F1 and YD01-ADH2-R1 to amplify the ADH2 fragment (nucleotide sequence is shown in SEQ ID NO.20), and the bidirectional terminator T was amplified using primers YD01-TER-F1 and YD01-TER-R1. ter22The ALD6 fragment (nucleotide sequence shown in SEQ ID NO. 21) was amplified using primers YD01-ALD-F1 and YD01-ALD-R1, and the bidirectional promoter P was amplified using primers YD01-GAL-F1 and YD01-GAL-R1. GAL10 / 1 The ACS fragment (nucleotide sequence shown in SEQ ID NO. 22) was amplified using primers YD01-ACS-F1 and YD01-ACS-R1, and the terminator T was amplified using primers YD01-TAT-F1 and YD01-TAT-R1. TAT1 ; Using pY26 expression vector as template, primers YD01-KJ-F1 and YD01-KJ-R1 were used to amplify the pY26 vector fragment. TEF Promoter, ADH2 fragment, bidirectional terminator T ter22 , ALD6 fragment, bidirectional promoter P GAL10 / 1 , ACS fragment, terminator T TAT1 The pY26 vector fragment was assembled with Gibson assembly to obtain plasmid 7.

[0095] Using the Saccharomyces cerevisiae genome as a template, primers d-DOSup-F, d-DOSup-R1, d-DOSdown-F1, and d-DOSdown-R were used to amplify the upstream and downstream 500 bp homology arm fragments of DOS2 (nucleotide sequence shown in SEQ ID NO. 23). The upstream and downstream homology arms were fused separately by fusion PCR to obtain a fragment named DOS2-1.

[0096] Primers 6-1-DOS2-PAM-1-F, 6-1-DOS2-PAM-1-R, 6-2-DOS2-PAM-2-F, 6-2-DOS2-PAM-2-R, 6-3-YJL064W-PAM-1-F, 6-3-YJL064W-PAM-1-R, 6-4-YJL064W-PAM-2-F, and 6-4-YJL064W-PAM-2-R were used to construct the gene knockout plasmid DY-1 using the golden gate method. The 20 nt used to knock out DOS2 were TGACGTGGATGAAAAAACTG and AGACGAGAATATTCACAGCG, and the 20 nt used to knock out YJL064W were GAATTCTGTAGCAAACGCTG and GTGAGTTCATCTGGGAGCGG. Using plasmid 7 as a template, the expression cassette fragment YJL064W-1 was amplified using primers d-YJLup-F and d-YJLdown-R.

[0097] About 500-700 ng of plasmid DY-1 with DOS2 and YJL064W knockout and 10 μg of fragments DOS2-1 and YJL064W-1 were transformed into the Saccharomyces cerevisiae engineering strain SQ4-2 using the Saccharomyces cerevisiae efficient transformation method, spread on the screening YNB solid medium, and cultured at 30°C for 3-5 days until colonies appeared. The verified correct clone was named SQ5.

[0098] Based on the SQ4-2 strain, the transcription factors YJL064W and DOS2 were knocked out to promote the flow of acetyl-CoA to the MVA pathway, thereby enhancing the synthesis of squalene. On this basis, the squalene production of the strain SQ5, which integrates the overexpression of ADH2, ALD6, and ACS2, increased from 1405.3 mg / L to 1469.3 mg / L ( Figure 3 ).

[0099] Table 3 Primer sequences

[0100]

[0101]

[0102] Example 3: Regulation of ethanol tolerance in Saccharomyces cerevisiae

[0103] The strain SQ5 obtained by strengthening the ethanol pathway gene in Example 2 was fermented under different concentrations of ethanol (10 g / L, 20 g / L, 30 g / L, 40 g / L, 50 g / L). It was found that when 20 g / L of ethanol was added, the strain showed the best squalene production and growth activity, with a squalene production of 1701.1 mg / L and an OD of 0. 600 When the ethanol concentration was higher than 30 g / L, the activity of the strain began to decline, and the yield also decreased.

[0104] Multi-gene editing technology was used to knock out DPP1 in the genome of Saccharomyces cerevisiae SQ5 strain, and HSP104 (nucleotide sequence shown in SEQ ID NO.25) and TPS1 (nucleotide sequence shown in SEQ ID NO.26) were overexpressed at the DPP1 (nucleotide sequence shown in SEQ ID NO.24) site.

[0105] Using the Saccharomyces cerevisiae genome as a template, primers TT-DPPUP-F1, TT-DPPUP-R1, TT-DPPIDN-F1, and TT-DPP1DN-R1 were used to amplify the upstream and downstream homology arms of DPP1, and primers TT-PTDH1-F1 and TT-PTDH1-R1 were used to amplify the promoter P TDH1, primers TT-hsp-F1 and TT-hsp-R1 were used to amplify the HSP104 fragment, and primers TT-ter-F1 and TT-ter-R1 were used to amplify the T ter22 Bidirectional terminator, primers TT-tsp1-F1 and TT-tsp1-R1 were used to amplify the TPS1 fragment, and primers TT-PMET6-F1 and TT-PMET6-R1 were used to amplify the promoter P MET6 ; Using the pY26 expression vector as a template, primers TT-KJ-F1 and TT-KJ-R1 were used to amplify the pY26 vector fragment. TDH1 , HSP104 fragment, T ter22 Bidirectional terminator, TPS1 fragment, promoter P MET6 The plasmid TT-1 was constructed by Gibson assembly with the pY26 vector fragment. The expression cassette fragment TT-01 was amplified using primers TT-UP-F and TT-DN-R using plasmid TT-1 as a template.

[0106] The gene knockout plasmid DTT-1 was constructed using primers DD-PAM-F3, DD-PAM-R3, DD-PAM-F4, and DD-PAM-R4 using the golden gate method. The 20 nt sequence for DPP1 knockout is ATTAGTGCAGCTCCTAACAG, ACCAAGCGAGTGATAAACCA. Approximately 500-700 ng of the DPP1 knockout plasmid DTT-1 and 10 μg of the expression cassette fragment TT-01 were transformed into the Saccharomyces cerevisiae engineered strain SQ5 using the Saccharomyces cerevisiae efficient transformation method. The cells were plated on screening YNB solid medium and cultured at 30°C for 3-5 days until colonies appeared. The correct clone was designated SQ6.

[0107] SQ5 in Example 2 was used as the control strain and SQ6 was used as the modified strain for shake flask fermentation of squalene, and the ethanol feed concentration was set at 10 g / L, 20 g / L, 20 g / L, 40 g / L, and 50 g / L. The results showed that the OD value of the modified strain SQ6, which overexpressed HSP104 (Saccharomyces cerevisiae heat shock protein) and TPS1 (a key gene for trehalose synthesis) in SQ5, was 0.0447 W / L after 96 h of shake flask culture. 600 The growth activity of the strain SQ5 was significantly improved from 20 to 40, and the optimal ethanol feed addition amount of the strain was increased to 30g / L. Under these conditions, the squalene production was 5649.8mg / L after 96h of shake flask fermentation, and the OD 600It is 40.62. Compared with the control strain SQ5, the trehalose content of the modified strain SQ6 has also been significantly improved. Through the transformation of stress resistance, the efficiency and accumulation of squalene in the SQ6 strain have been significantly improved. When the ethanol feed concentration of the SQ6 modified strain in the shake flask is higher than 30g / L, the activity of the strain begins to decline, indicating that high concentrations of ethanol still have an effect on the SQ6 engineered strain. However, the activity of the SQ6 strain under 50g / L ethanol feed is still higher than that of the control strain SQ5 under 10g / L ethanol feed, indicating that the transformation of stress resistance has greatly enhanced the ethanol tolerance of brewer's yeast ( Figure 4 ).

[0108] Table 4 Primer sequences

[0109]

[0110]

[0111] Example 4: Replenishing the URA gene

[0112] In order to further improve the activity of the strain, the defective type of the engineered strain SQ6 was complemented. Using the Saccharomyces cerevisiae genome as a template, the promoter P was amplified using primers TY2-PTEF-F1 and TY2-PTEF-R1. TEF Primers TY2-URA-F1 and TY2-URA-R1 were used to amplify the URA fragment (nucleotide sequence shown in SEQ ID NO. 27), and primers TY2-TAT1-F1 and TY2-TAT1-R1 were used to amplify the terminator T TAT1 The fragment was amplified using primers TY2-KJ-R1 and TY2-KJ-F1 to integrate the fragment Pct22 (disclosed in the patent publication number CN113403334A) and the promoter P TEF , URA fragment, terminator T TAT1 The Pct22 integration fragment was synthesized into plasmid TY2-U by Gibson assembly. Using plasmid TY2-U as a template, ty2-LU-F1 and ty2-LU-R1 were used to obtain the homologous recombinant fragment Ty2armup-P TEF -URA-LEUdeg-Ty2 armdown (TY2-1). Approximately 10 μg of fragment TY2-1 was transformed into the Saccharomyces cerevisiae engineered strain SQ6 using the Saccharomyces cerevisiae efficient transformation method, spread on screening YNB solid medium, and culture at 30°C for 3-5 days until colonies appeared. The correct clone was named SQ7.

[0113] Table 5 Primer sequences

[0114]

[0115] Example 5 Optimization of fermentation conditions

[0116] (1) Optimization of glucose and molasses feeding time

[0117] A single colony of the SQ7 strain described in Example 4 was selected and cultured in 5 mL of YPD medium in a 50 mL shake flask at 30° C. and 220 rpm for 22 h as a primary seed solution. The primary seed solution was inoculated at a 2% (v / v) inoculum into 50 mL of YPD medium in a 250 mL shake flask and cultured for 22 h at 30° C. and 220 rpm as a secondary seed solution. The secondary seed solution was inoculated at a 2% (v / v) inoculum into a 5 L bioreactor containing 2.5 L of YPD medium (with an initial glucose concentration of 40 g / L) for fermentation. Glucose was fed to a final concentration of 500 g / L (controlling the residual sugar content in the reaction system to zero) starting around 11 h into the fermentation. The glucose feed was stopped at around 24 and 36 h, respectively, and molasses was fed to control the residual sugar content in the reaction system to zero and the concentration of metabolite ethanol to no more than 20 g / L, followed by a 120 h fermentation.

[0118] The results show that Figure 5 A started feeding molasses at 24h, and the squalene production reached 7.72g / L after 120h of fermentation. In order to avoid the disadvantages of premature feeding of molasses, the growth period was avoided. Figure 5 B started feeding molasses at 36 h, and the squalene yield reached 9.06 g / L after 120 h of fermentation. This scheme provides a reference for the production of high-value terpenoids from industrial waste molasses.

[0119] (2) Optimization of glucose and ethanol feeding time

[0120] A single colony of the SQ7 strain described in Example 4 was selected and cultured in 5 mL of YPD medium in a 50 mL shake flask at 30°C and 220 rpm for 22 h as a primary seed solution. A 2% (v / v) inoculum of the primary seed solution was inoculated into 50 mL of YPD medium in a 250 mL shake flask and cultured for 22 h at 30°C and 220 rpm as a secondary seed solution. A 2% (v / v) inoculum of the secondary seed solution was inoculated into a 5 L bioreactor containing 2.5 L of YPD medium (with an initial glucose concentration of 40 g / L). Glucose was fed to a final concentration of 500 g / L starting around 11 h into the fermentation. Glucose feeding was stopped at around 60 h, 48 h, 24 h, and 12 h, respectively, and ethanol was added (controlling the final ethanol concentration in the reaction system to not exceed 20 g / L) for approximately 120-156 h of fermentation.

[0121] The results show that Figure 5C began to add glucose at 11h, stopped glucose feeding at 60h, and added ethanol. The yield of YPD fermentation in a 5L fermenter reached 9.91g / L after 130h. Analysis of the entire fermentation process showed that the growth condition of the strain and the accumulation of products were poor.

[0122] like Figure 5 D began adding glucose at 11 hours, stopped feeding glucose at 48 hours, and added ethanol instead. After 156 hours of fermentation, the yield reached 15.11 g / L. Analysis of the entire fermentation process revealed that the tolerance-modified Saccharomyces cerevisiae strain exhibited superior growth compared to standard Saccharomyces cerevisiae, maintaining activity in the later stages of growth. Product accumulation was maintained from 24 hours onwards until 156 hours. Analysis of the strain's growth and product accumulation during the fermentation process revealed that after 36 hours, growth had reached a certain level, but product accumulation slackened. This was in contrast to the shake flask culture, which had experienced better product accumulation when ethanol was added 24 hours after the initial glucose depletion. Therefore, the fermentation strategy was adjusted to rely more on early addition of ethanol to monitor product accumulation.

[0123] like Figure 5 Fermentation yield reached 22.55 g / L after 156 hours. Analysis of the entire fermentation process revealed that direct ethanol feeding after the rapid growth phase (24 hours) of glucose feeding resulted in premature senescence of the bacteria. Growth slowed significantly after 84 hours of fermentation, suggesting that changing the carbon source during the intense 24-hour logarithmic growth phase is not advisable.

[0124] like Figure 5 F fermentation yielded 27.33 g / L after 156 hours. Based on the shake flask fermentation results, when expanding the fermentation in a 5L fermentor, the first stage used a fermentation medium prepared with 40 g / L of glucose for bacterial growth. In the second stage, after the glucose in the culture medium was depleted, the entire fermentation process was regulated after 16 hours to use appropriate ethanol for bacterial growth and production. Through a series of fermentation strategy adjustments, the squalene production of Saccharomyces cerevisiae SQ7 fermentation reached 27.33 g / L, and the cell production dry weight was 650.13 mg / gDCW.

[0125] (3) 5L bioreactor fermentation production of squalene

[0126] A single colony of the SQ7 strain described in Example 4 was selected and cultured in 5 mL of YPD medium in a 50 mL shake flask at 30°C and 220 rpm for 22 hours as a primary seed solution. The primary seed solution was inoculated at a 2% (v / v) inoculum into 50 mL of YPD medium in a 250 mL shake flask and cultured for 22 hours at 30°C and 220 rpm as a secondary seed solution. The secondary seed solution was inoculated at a 2% (v / v) inoculum into a 5 L bioreactor containing 2.5 L of fermentation medium for squalene fermentation. In the first phase (0 h-16 h), YPD medium containing 40 g / L glucose was used for bacterial growth. In the second phase (16 h-156 h), after glucose depletion, ethanol was added (maintaining the final ethanol concentration in the reaction system below 20 g / L) to promote bacterial growth and squalene accumulation. Through a series of fermentation optimizations, the squalene production yield and cell dry weight of Saccharomyces cerevisiae reached 27.33 g / L and 650.13 mg / g DCW, respectively.

[0127] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A genetically engineered bacterium that produces high squalene yield, characterized in that: Using Saccharomyces cerevisiae C800 as the starting strain, the transcription factor YPL062W 、 ROX1 、 YJL064W 、 DOS2 as well as DPP1 , integrated expression gene tHMG1 、 IDI1 、 ERG19 、 ERG20 、 ERG10 、 ERG13 、 ERG12 、 ERG8 、 ERG9 、 ADH2 、 ALD6、ACS 、 HSP104 、 TPS1 , and replenish genes URA ; Among them, Ty1 and Ty4 Multiple copies of integrated genes tHMG1 and IDI1 , knockout YPL062W After the site, YPL062W Site-integrated gene ERG19 and ERG20 ; Knockout ROX1 After the site, ROX1 Site-integrated gene ERG10 、 ERG13 、 ERG12 、 ERG8 、 ERG9 ; knockout YPL062W After the site, YPL064W Site-integrated gene ADH2 、 ALD6, ACS, Knockout DPP1 After the site, DPP1 Site-integrated gene HSP104 and TPS1 The gene tHMG1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. IDI1 The nucleotide sequence of the gene is shown in SEQ ID NO.

2. YPL062W The nucleotide sequence of the gene is shown in SEQ ID NO.

4. ROX1 The nucleotide sequence of the gene is shown in SEQ ID NO.

5. YJL064W The nucleotide sequence of the gene is shown in SEQ ID NO.

18. DOS2 The nucleotide sequence of the gene is shown in SEQ ID NO.

23. DPP1 The nucleotide sequence is shown in SEQ ID NO.24; ERG20 The nucleotide sequence is shown in SEQ ID NO.7, ERG19 The nucleotide sequence is shown in SEQ ID NO.9, ERG9 The nucleotide sequence is shown in SEQ ID NO.10, ERG10 The nucleotide sequence is shown in SEQ ID NO.12, ERG13 The nucleotide sequence is shown in SEQ ID NO.13, ERG12 The nucleotide sequence is shown in SEQ ID NO.14, ERG8 The nucleotide sequence of the gene is shown in SEQ ID NO.

16. ADH2 The nucleotide sequence of the gene is shown in SEQ ID NO.

20. ALD6 The nucleotide sequence of the gene is shown in SEQ ID NO.

21. ACS The nucleotide sequence of the gene is shown in SEQ ID NO.

22. HSP104 The nucleotide sequence of the gene is shown in SEQ ID NO.

25. TPS1 The nucleotide sequence of the gene is shown in SEQ ID NO.

26. URA The nucleotide sequence is shown in SEQ ID NO.

27.

2. The genetically engineered bacterium according to claim 1, characterized in that Using promoter P GAL10 / 1 、P TDH1 、P MET6 or P TEF Start gene expression.

3. The genetically engineered bacterium according to claim 1 or 2, characterized in that The promoter P GAL10 / 1 The nucleotide sequence of the promoter is shown in SEQ ID NO.

3. TDH1 The nucleotide sequence of the promoter is shown in SEQ ID NO.

6. MET6 The nucleotide sequence of the promoter is shown in SEQ ID NO.

17. TEF The nucleotide sequence is shown in SEQ ID NO.19, 4. A method for producing squalene, characterized in that: The method comprises inoculating the genetically engineered bacteria according to any one of claims 1 to 3 into a culture medium for fermentation culture.

5. The method according to claim 4, characterized in that The seed liquid of the genetically engineered bacteria according to any one of claims 1 to 3 is inoculated into a fermentation medium containing 30 to 50 g / L of glucose for fermentation production. After the glucose is exhausted, ethanol is added to the medium to maintain the final ethanol concentration in the medium below 20 g / L.

6. Use of the genetically engineered bacteria according to any one of claims 1 to 3 in the production of products containing squalene.

Images