A respiratory syncytial virus antigen protein encoding gene, antigen protein, recombinant vector, vaccine and application

Abstract

The present invention provides a nucleotide sequence encoding prefusion glycoprotein (preF), nucleoprotein (N) and transcription elongation / transcription termination inhibitor (M2-1) of respiratory syncytial virus, a recombinant vector, a vaccine and an application thereof, belonging to the technical field of vaccine preparation. The present invention utilizes the co-expression of RSV main neutralizing antigen preF and RSV virus internal conserved proteins N and M2-1 that can broaden antigen T cell epitopes to construct an RSV adenovirus vector expressing the antigen combination; the recombinant vector can be used to prepare a respiratory syncytial virus vaccine, and after intranasal immunization and challenge infection of mice, the RSV adenovirus vector vaccine can simultaneously induce efficient and lasting local humoral immunity, memory cellular immunity and memory innate immune response of the respiratory mucosa to preF, N and M2-1 after immunization of animals.

Description

Technical Field

[0001] The present invention belongs to the technical field of vaccine preparation, and specifically relates to a respiratory syncytial virus antigen protein encoding gene, antigen protein, recombinant vector, vaccine and application. Background Art

[0002] Human respiratory syncytial virus (RSV) is the most important viral pathogen causing lower respiratory tract infections in infants and young children. Almost 100% of infants and young children have been infected more than once within 2 years of age. Among the causes of death in children aged 1 month to 1 year, the number of deaths caused by RSV infection accounts for about 6.7% of the total, ranking second after malaria. Among the causes of death caused by lower respiratory tract infections in children under 5 years old, the number of deaths caused by RSV infection accounts for about 6.29% of the total, ranking second after pneumococcus. RSV is the main pathogen causing childhood epidemic asthma pneumonia (abbreviated as epidemic asthma pneumonia) and childhood allergic asthma. The elderly and patients with immunodeficiency are also susceptible to severe infections caused by RSV, and those with a history of infection are prone to lung diseases such as abnormal lung function and bronchial asthma.

[0003] Although the importance of RSV has been widely recognized, after years of efforts, there is still a lack of effective and reliable methods for the diagnosis, prevention and treatment of RSV. Therefore, the development of vaccines that can be used to prevent RSV infection will definitely help improve the health of infants and the elderly and achieve good social and economic benefits.

[0004] RSV belongs to the Pneumoviridae family and the Orthopneumovirus genus. Its genome is a single-stranded negative-strand RNA that encodes 11 proteins, of which fusion glycoprotein (F) and attachment glycoprotein (G) are the main neutralizing antigens. According to the difference in the antigenicity of the G protein, RSV is divided into two subtypes, A and B. Neutralizing antibodies targeting the conserved region of the G protein can inhibit RSV infection of subtypes A and B and reduce the severity of the disease. The F protein has multiple neutralizing antigen epitopes and its antigenicity is relatively stable. Neutralizing antibodies targeting the F protein have cross-protective effects on RSV infection of subtypes A and B, making it the main target antigen for the development of RSV vaccines. In its natural state, the F protein has two main conformational states: metastable prefusion F (prefusion, preF) and stable postfusion F (postfusion, postF). Among the identified neutralizing epitopes of RSV F protein, site I is mainly located on post-F, site II and IV exist on both pre-F and post-F, site III is mainly located on pre-F, and site V and Only exists in pre-F. Further studies have shown that the main neutralizing antibodies with protective effects in the serum of infected people are against siteIII, V and Compared with post-F, pre-F can induce the body to produce higher neutralizing activity and better protection. Therefore, in recent years, pre-F has become the focus of RSV vaccine development. Studies have found that monoclonal neutralizing antibodies against the F protein can reduce the severity of RSV infection-related diseases in high-risk populations. During the RSV epidemic season, this monoclonal antibody (Palivizumab) has been used for prevention in high-risk populations. Therefore, the primary goal of the current RSV vaccine design is to produce sufficiently high neutralizing antibodies.

[0005] In the adult RSV infectivity experiment, it was found that the mucosal neutralizing antibodies secreted by the upper respiratory tract were more closely associated with protection than serum neutralizing antibodies. Subsequent studies have shown that persistent RSV-specific mucosal IgA and mucosal IgG have better protection than serum neutralizing antibodies, and have better effects in inhibiting viral infection and reducing lung inflammation. The study also found that RSV-specific mucosal IgA memory B cells produced by natural RSV infection are defective and difficult to produce high levels of persistent SIgA. At the same time, compared with the serum dominant neutralizing antibodies after RSV infection, which are mainly directed against RSVF, the mucosal dominant neutralizing antibodies are mainly directed against RSSVG, N and M2-1.

[0006] For a long time, preventive vaccines have only focused on neutralizing antibodies. Although RSV neutralizing antibodies can reduce the severity of the disease, it is still difficult to effectively prevent RSV infection. Summary of the invention

[0007] In view of this, the object of the present invention is to provide a gene encoding a respiratory syncytial virus antigen protein, an antigen protein, a recombinant vector, a vaccine and applications.

[0008] The present invention provides a gene encoding a respiratory syncytial virus antigen protein, which includes a gene encoding a pre-fusion glycoprotein, a gene encoding a nucleoprotein and a gene encoding a transcription elongation / transcription termination inhibitor, which are sequentially connected from the 5' end to the 3' end;

[0009] The nucleotide sequence of the gene encoding the fusion glycoprotein before fusion is shown in SEQ ID NO.1;

[0010] The nucleotide sequence of the gene encoding the nucleoprotein is shown in SEQ ID NO.2;

[0011] The nucleotide sequence of the gene encoding the transcription elongation / transcription termination inhibitor is shown in SEQ ID NO.3.

[0012] Preferably, the coding gene of the fusion glycoprotein and the coding gene of the nucleoprotein are connected by T2A; the coding gene of the nucleoprotein and the coding gene of the transcription elongation / transcription termination inhibitor are connected by AAY; the nucleotide sequence of T2A is shown in SEQ ID NO.4; the nucleotide sequence of AAY is: gccgcctac.

[0013] Preferably, the nucleotide sequence of the gene encoding the respiratory syncytial virus antigen protein is shown as SEQ ID NO.5.

[0014] The present invention also provides an antigen protein encoded by the gene encoding the respiratory syncytial virus antigen protein described in the above scheme.

[0015] The present invention also provides a recombinant vector into which the gene encoding the respiratory syncytial virus antigen protein described in the above scheme is inserted.

[0016] Preferably, the original vector of the recombinant vector comprises an adenovirus vector.

[0017] The present invention also provides a vaccine for preventing respiratory syncytial virus, comprising the recombinant vector described in the above scheme.

[0018] Preferably, the concentration of the recombinant vector in each dose of vaccine is 1×10 10 VP.

[0019] Preferably, the dosage form of the vaccine includes injection or nasal drops.

[0020] The present invention also provides the use of the gene encoding the respiratory syncytial virus antigen protein or the recombinant vector described in the above scheme in preparing a vaccine for preventing respiratory syncytial virus.

[0021] The present invention provides a gene encoding a respiratory syncytial virus (RSV) antigen protein, which includes a gene encoding a pre-fusion glycoprotein (preF), a gene encoding a nucleoprotein (N), and a gene encoding a transcription elongation / transcription termination inhibitor (M2-1) connected sequentially from the 5' end to the 3' end. After immunizing an animal with a recombinant adenovirus vaccine carrying the gene encoding the respiratory syncytial virus antigen protein, humoral immunity and cellular immunity against preF, N and M2-1 can be induced simultaneously.

[0022] The present invention also provides a recombinant vector comprising the coding gene of the above-mentioned respiratory syncytial virus antigen protein. The present invention utilizes the co-expression of RSV main neutralizing antigen preF and RSV virus internal conserved proteins N and M2-1 that can broaden the antigen T cell epitopes to construct an RSV adenovirus vector expressing the antigen combination; the recombinant vector can be used to prepare a respiratory syncytial virus vaccine. After intranasal immunization and challenge infection of mice, the RSV adenovirus vector vaccine can induce efficient and lasting local humoral immunity, memory cellular immunity and memory innate immune response of the respiratory mucosa. The recombinant vector of the present invention can be prepared rapidly on a large scale, and has the characteristics of inducing a strong immune response, and can be used for preventive immunization of the population. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative work.

[0024] Figure 1 A recombinant adenovirus provided in an embodiment of the present invention induces RSV-specific serum IgG in BALB / c mice;

[0025] Figure 2 A recombinant adenovirus provided in an embodiment of the present invention induces serum neutralizing antibodies produced in BALB / c mice;

[0026] Figure 3 The present invention provides a recombinant adenovirus that induces cellular immunity in BALB / c mice. DETAILED DESCRIPTION

[0027] The invention provides a gene encoding a respiratory syncytial virus antigen protein, which includes a gene encoding a pre-fusion glycoprotein (preF), a gene encoding a nucleoprotein (N) and a gene encoding a transcription elongation / transcription termination inhibitor (M2-1) connected sequentially from the 5' end to the 3' end.

[0028] In the present invention, the coding gene of the pre-fusion glycoprotein (preF), the coding gene of the nucleoprotein (N) and the coding gene of the transcription elongation / transcription termination inhibitor (M2-1) are preferably codon-optimized.

[0029] In the present invention, the nucleotide sequence of the gene encoding the fusion glycoprotein before fusion is shown in SEQ ID NO.1, specifically:

[0030] gccaccATGGAACTGCTGATCCTGAAGGCCAACGCCATCACCACCATCCTGACCGCTGTGACCTTCTGCTTCGCCAGCGGCCAGAACATCACCGAGGAATTCTACCAGAGCACCTGTAGCGCCGTGTCCAAGGGCTACCTGAGCGCCCTGCGGACCGGCTGGTACACCAGCGTGATCACCATCGAGCTGAGCAACATCAAGAAAATCAAGTGCAACGGCACCGACGCCAAGATCAAGCTGATCAAGCAGGAACTGGACAAGTACAAGAACGCCGTGACCGAGCTGCAGCTGCTGATGCAGAGCACCCCCGCCACCAACAACCAGGCTAGA GGC AGC GGA AGC GGA CGG TCC

[0031]

[0032] In the present invention, the nucleotide sequence of the gene encoding the transcription elongation / transcription termination inhibitor is shown in SEQ ID NO.3, specifically:

[0033] In the present invention, the gene encoding the fusion glycoprotein and the gene encoding the nucleoprotein are preferably connected by T2A; the nucleotide sequence of the T2A is as shown in SEQ ID NO.4, specifically: GGC AGC GGC GAG GGC CGC GGC AGCCTG CTG ACC TGC GGC GAC GTG GAG GAG AAC CCC GGC CCC.

[0034] In the present invention, the nuclear protein encoding gene and the transcription elongation / transcription termination inhibitor encoding gene are preferably connected by AAY; the nucleotide sequence of AAY is: gccgcctac.

[0035] In the present invention, the nucleotide sequence of the gene encoding the respiratory syncytial virus antigen protein preF-T2A-N(AAY)M2 is shown in SEQ ID NO.5, specifically:

[0036] ATGGAACTGCTGATCCTGAAGGCCAACGCCATCACCACCATCCTGACCGCTGTGACCTTCTGCTTCGCCAGCGGCCAGAACATCACCGAGGAATTCTACCAGAGCACCTGTAGCGCCGTGTCCAAGGGCTACCTGAGCGCCCTGCGGACCGGCTGGTACACC AGCGTGATCACCATCGAGCTGAGCAACATCAAGAAAATCAAGTGCAACGGCACCGACGCCAAGATCAAGCTGATCAAGCAGGAACTGGACAAGTACAAGAACGCCGTGACCGAGCTGCAGCTGCTGATGCAGAGCACCCCCGCCACCAACAACCAGGCTAGA GGC AGC GGA AGC GGA CGG TCC

[0037] In the present invention, the nucleotide sequence encoding preF is located at the 5' end of the preF-T2A-N(AAY)M2 sequence, and the nucleotide sequence encoding M2-1 is located at the 3' end of the preF-T2A-N(AAY)M2 sequence.

[0038] In the present invention, the gene encoding the respiratory syncytial virus antigen protein preferably also includes a nucleotide sequence encoding other RSV antigens.

[0039] The present invention also provides a recombinant vector into which the gene encoding the respiratory syncytial virus antigen protein described in the above scheme is inserted.

[0040] In the present invention, the original vector of the recombinant vector preferably includes an adenovirus vector, other viruses or bacterial vectors; the adenovirus vector is preferably a replication-deficient adenovirus vector; the present invention has no special restrictions on the serotype of the replication-deficient recombinant adenovirus vector.

[0041] The recombinant vector of the present invention can express the gene encoding the respiratory syncytial virus antigen protein described in the above scheme.

[0042] The present invention also provides a fusion protein encoded by the gene encoding the respiratory syncytial virus antigen protein described in the above scheme.

[0043] The present invention also provides a vaccine for preventing respiratory syncytial virus, comprising the recombinant vector described in the above scheme.

[0044] In the present invention, the dosage form of the vaccine preferably includes injection or nasal drops.

[0045] In the present invention, the vaccine preferably includes nucleic acid vaccine, protein vaccine, virus-like particle vaccine or recombinant vector vaccine.

[0046] In the present invention, when the vaccine is a recombinant vector vaccine, the concentration of the recombinant vector in each dose of the vaccine is preferably 1×10 10 VP.

[0047] The present invention also provides the use of the gene encoding the respiratory syncytial virus fusion protein or the recombinant vector described in the above scheme in the preparation of a vaccine for preventing respiratory syncytial virus.

[0048] In the present invention, the administration of the vaccine preferably includes injection and nasal drops, more preferably nasal drops; the injection is preferably intramuscular injection, intradermal injection or subcutaneous injection.

[0049] In the present invention, the dose of the vaccine for nasal administration is preferably 1×10 10 VP.

[0050] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.

[0051] Example 1

[0052] 1. Animal immunization

[0053] Female BALB / c mice aged 6 to 8 weeks were divided into 2 groups. On day 0, basal serum was collected and on day 1, intranasal immunization was performed. On day 21 after immunization, a challenge experiment was performed via intranasal drops with a challenge dose of 1×10 6 pfu / 50 μl of wt RSV.

[0054] The grouping and processing are as follows:

[0055] Group 1 (G1): 1 immunization, the immunization agent was a recombinant adenovirus containing nucleic acid encoding RSV antigen protein (the virus amount was 1×10 10 vp);

[0056] Group 2 (G2): The first immunization was with a control recombinant adenovirus that did not contain nucleic acid encoding RSV antigen protein (the virus amount was 1×10 10 vp).

[0057] 2. Detection of serum IgG in mice after immunization

[0058] The solution to be tested is: venous blood of mice was collected on the 49th day after immunization in step 1, and serum was obtained by separation.

[0059] The serum antibody titer of mice was detected by ELISA. The purified RSV was coated on the ELISA plate at 2500 pfu / well, and the serum antibody IgG of mice was detected by ELISA.

[0060] 3. Neutralizing antibodies in mouse serum after immunization

[0061] 1) According to 2.0×10 4 HEp-2 cells were seeded into 96-well plates at a density of cells / well and cultured for 24 h.

[0062] 2) The immunized mouse serum was inactivated at 56°C for 30 minutes and diluted 2-fold with DMEM culture medium containing 2% fetal bovine serum. RSV-mGFP was added to the serum of different dilutions to a final concentration of 1000 PFU / 100 μl, and the mixture was incubated at 37°C for 1 hour.

[0063] 3) Discard the 96-well plate culture medium, wash with PBS 1-2 times, add 100 μl of the mixture (containing 1000 PFU of RSV-mGFP) to the 96-well plate with a monolayer of HEp-2 cells, and culture at 37°C for 48 hours. At the same time, set up a blank control (no virus, no serum or antibody), a negative control group (with RSV-mGFP, no serum) and a positive control group (RSV polyclonal antibody instead of serum) and culture for 2 days.

[0064] 4) After completing step 3), the fluorescence intensity of green fluorescent protein in each well was detected using the multifunctional microplate reader SpectraMax M5e (excitation wavelength 479 nm, emission wavelength 517 nm, detection 10 s).

[0065] 5) The blank control group was subtracted from the experimental group, negative control group, and positive control group, and a linear regression equation for the experimental group was established using SPSS. The antibody titer (IC50) at which the fluorescence intensity was reduced by 50% was calculated using the linear regression equation.

[0066] 4. Analysis of cellular immune effects in mice after immunization

[0067] The cells to be tested are: spleen cells of mice on the 49th day after immunization in step 1.

[0068] 1) Mice were killed by cervical dislocation 49 days after immunization, and spleen cells were collected aseptically in a clean bench.

[0069] 2) The cellular immune effect was analyzed by ELISPOT method, and the number of spleen lymphocytes secreting IFN-γ after stimulation with RSV F protein H-2Kd restricted CTL epitope was counted.

[0070] 3) In a clean bench, add 200 μl of 1640 culture medium to each well, let it stand at room temperature for 5 to 10 minutes, and then discard the 1640 culture medium.

[0071] 4) Add the cell suspension to each experimental well, 100 μl / well. Add 2×10 cells to the positive control well, negative control well, and experimental well. 5 cells / well, and no cells were added to the background control wells.

[0072] 5) The volume of stimulus added to each well was 10 μl / well. The positive control well was added with positive stimulus working solution, the negative control well and background control well were added with 1640 serum-free medium, and the experimental well was added with F, N and M2-1 protein-specific H-2Kd-restricted peptide stimulation. The cells were incubated at 37°C with 5% CO 2 Incubate in an incubator for 24-48 hours.

[0073] 6) After completing step 5), pour out the cells and culture medium in the wells, add ice-cold deionized water, 200 μl / well, and place in a 4°C refrigerator for 10 minutes to hypotonic lyse the cells.

[0074] 7) Pour out the liquid in the wells, wash 5 to 7 times with 1x Washing buffer, 200 μl / well, each time for 30 to 60 seconds, and dry on absorbent paper.

[0075] 8) Add the diluted biotin-labeled antibody working solution to each experimental well, 100 μl / well, and incubate at 37°C for 1 hour.

[0076] 9) After completing step 8), remove the liquid from the wells with 1x Washing buffer, 200 μl / well, wash 5 to 7 times, each time for 30 to 60 seconds, and dry on absorbent paper.

[0077] 10) Add the diluted enzyme-labeled avidin working solution to each experimental well, 100 μl / well, and incubate at 37°C for 1 hour.

[0078] 11) Pour the liquid in the wells, add 1x Washing buffer, 200 μl / well, wash 5-7 times, stay for 30-60 seconds each time, and dry on absorbent paper;

[0079] 12) Add the prepared AEC color development working solution to each experimental well, 100 μl / well, and let it stand at room temperature for 15 to 45 minutes.

[0080] 13) After the spots grow to a suitable size, pour out the liquid in the wells, uncover the base of the plate, wash with deionized water 3 to 5 times to stop color development, and place the plate in a cool place at room temperature to dry naturally. After it is completely dry, use an ELISPOT reader to image the 96-well plate, and use ImmunoSpot image analyzer software v4.0 to analyze and read the number of spots.

[0081] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention rather than all the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A coding gene for a respiratory syncytial virus antigen protein, the nucleotide sequence of which is as shown in SEQ ID NO.

5.

2. A protein encoded by the coding gene for the respiratory syncytial virus antigen protein according to claim 1.

3. A recombinant vector into which the coding gene for the respiratory syncytial virus antigen protein according to claim 1 is inserted.

4. The recombinant vector according to claim 3, wherein, the original vector of the recombinant vector includes an adenovirus vector.

5. A vaccine for preventing respiratory syncytial virus, comprising the recombinant vector according to claim 3 or 4.

6. The vaccine according to claim 5, wherein, The concentration of the recombinant vector in each dose of vaccine was 1×10 10 VP.

7. The vaccine according to claim 5, wherein, the dosage form of the vaccine includes an injection or a nasal drop.

8. Use of the coding gene for the respiratory syncytial virus fusion protein according to claim 1, or the fusion protein according to claim 2, or the recombinant vector according to claim 3 or 4 in the preparation of a vaccine for preventing respiratory syncytial virus.

Images