A method for reducing gene expression of Corynebacterium glutamicum by repressor

Abstract

The present invention discloses a method for reducing gene expression in Corynebacterium glutamicum using repressors, belonging to the field of biotechnology. By selecting two heterologous, orthogonal repressor proteins, BetI and LmrA, designing 5'UTR libraries, and verifying them through green fluorescent protein fluorescence intensity, the present invention obtains two repressor libraries with gradient expression intensities. These libraries can achieve refined downregulation of the expression levels of multiple target genes and balanced metabolic flux distribution in Corynebacterium glutamicum, surpassing the previous method of altering cellular genotypes, which could only be achieved through gene knockout.

Description

Technical Field

[0001] The invention relates to a method for reducing gene expression of Corynebacterium glutamicum by using a repressor, and belongs to the field of biotechnology. Background Art

[0002] Metabolic engineering strategies, such as knocking out competing pathways or overexpressing genes involved in chemical synthesis, have been successfully applied to the production of various chemicals. However, this strategy lacks precise control over metabolic fluxes, hindering its application to regulating metabolism essential for growth, such as energy and cofactor formation and the synthesis of primary metabolites. Recent advances in synthetic biology have made it possible to fine-tune metabolic fluxes. Numerous studies have been conducted to achieve precise control of target metabolic fluxes by mining and utilizing various genetic elements. For example, by pairing and mining genetic regulators with cognate promoters of varying affinity, target gene expression can be dynamically regulated. However, this strategy is limited to regulating the expression of specific genes and is difficult to apply to other genes. To achieve regulation of any gene, determining the appropriate strength and increasing its expression level is a time-consuming process. Furthermore, CRISPRi has been used as an effective gene expression downregulation strategy for the biosynthesis of various chemicals. However, due to PAM sequence requirements and complex guide RNA design, efficient and orthogonal multi-gene regulation is difficult to achieve, and its scope of application is limited. To overcome these issues, a strategy using a library of orthogonal repressors with varying expression levels has been successfully developed. The principle is to insert the homologous promoter of the repressor protein upstream of the target gene. Then, by introducing different expression levels of the repressor protein and selecting the best mutants from them, different levels of expression of the target gene can be achieved. This provides a new and reliable method for synthesizing chemicals in metabolic engineering cell factories. Summary of the Invention

[0003] The technical problem to be solved by the present invention is to provide a method for weakening the gene expression of Corynebacterium glutamicum by using a repressor library.

[0004] The present invention provides a system for regulating target gene expression, the system comprising a response module and a binding module;

[0005] The binding module is: a nucleotide sequence inserted upstream of the target gene, such as the repressor protein BetI binding sequence shown in SEQ ID NO.15; the response module is: a repressor protein gene betI coupled to the 5'UTR sequence of the repressor protein BetI; the nucleotide sequence of the 5'UTR sequence of the repressor protein BetI is shown in any one of SEQ ID NOs.1 to 7, and the nucleotide sequence of the repressor protein gene betI is shown in SEQ ID NO.17.

[0006] The present invention provides a system for regulating target gene expression, the system comprising a response module and a binding module; the binding module comprises: a repressor protein LmrA binding sequence having a nucleotide sequence inserted upstream of the target gene, such as that shown in SEQ ID NO.16; the response module comprises: a repressor protein gene lmrA coupled to a 5'UTR sequence of the repressor protein LmrA; the nucleotide sequence of the 5'UTR sequence of the repressor protein LmrA is shown in any one of SEQ ID NOs.8 to 14, and the nucleotide sequence of the repressor protein gene lmrA is shown in SEQ ID NO.18;

[0007] The present invention also provides an application of the above-mentioned system for regulating target gene expression in reducing gene expression in recombinant bacteria.

[0008] In one embodiment of the present invention, the application is to place the repressor protein BetI binding sequence downstream of the promoter of the target gene whose expression needs to be reduced on the recombinant bacterial genome;

[0009] At the same time, an expression vector was used to episomally express the repressor protein gene betI coupled with the 5'UTR sequence of the repressor protein BetI.

[0010] In one embodiment of the present invention, the application is to place the repressor protein LmrA binding sequence downstream of the promoter of the target gene whose expression needs to be reduced on the recombinant bacterial genome;

[0011] At the same time, an expression vector was used to episomally express the repressor protein gene lmrA coupled with the 5'UTR sequence of the repressor protein LmrA.

[0012] The present invention also provides a recombinant bacterium containing the above-mentioned system for regulating the expression of the target gene.

[0013] In one embodiment of the present invention, the recombinant bacteria uses bacteria or fungi as host cells.

[0014] In one embodiment of the present invention, the host cell is Corynebacterium glutamicum.

[0015] The present invention also provides a method for reducing the expression of a target gene in Corynebacterium glutamicum, wherein the method comprises placing the above-mentioned repressor protein BetI binding sequence downstream of the promoter of the target gene whose expression is to be reduced on the Corynebacterium glutamicum genome;

[0016] At the same time, an expression vector was used to episomally express the repressor protein gene betI coupled with the 5'UTR sequence of the repressor protein BetI.

[0017] The present invention also provides a method for reducing the expression of a target gene in Corynebacterium glutamicum, wherein the method comprises placing the above-mentioned repressor protein LmrA binding sequence downstream of the promoter of the target gene whose expression is to be reduced on the Corynebacterium glutamicum genome;

[0018] At the same time, an expression vector was used to episomally express the repressor protein gene lmrA coupled with the 5'UTR sequence of the repressor protein LmrA.

[0019] In one embodiment of the present invention, the Corynebacterium glutamicum includes but is not limited to: ATCC13032, ATCC14067, and SCgG2.

[0020] The present invention also provides the use of the recombinant bacteria in preparing target proteins.

[0021] The present invention also provides a recombinant Corynebacterium glutamicum, wherein the recombinant Corynebacterium glutamicum is:

[0022] The above-mentioned repressor protein BetI binding sequence is inserted downstream of the dihydrodipicolinate synthase gene dapA promoter on the Corynebacterium glutamicum genome;

[0023] The pEC-XK99E plasmid was used as an expression vector to express the repressor protein gene betI coupled with the 5'UTR sequence of the repressor protein BetI.

[0024] The present invention also provides a recombinant Corynebacterium glutamicum, wherein the recombinant Corynebacterium glutamicum is:

[0025] Inserting the repressor protein LmrA binding sequence into the citrate synthase gene gltA promoter region on the Corynebacterium glutamicum genome;

[0026] The pXMJ19 plasmid was used as an expression vector to express the repressor protein gene lmrA coupled with the 5'UTR sequence of the repressor protein LmrA.

[0027] In one embodiment of the present invention, green fluorescent protein can be coupled to the free expression vector to verify the expression intensity range of the repressor protein before use.

[0028] In one embodiment of the present invention, the nucleotide sequence of the green fluorescent protein gene egfp is shown as SEQ ID NO.19.

[0029] In one embodiment of the present invention, the recombinant Corynebacterium glutamicum uses Corynebacterium glutamicum K02 as a host.

[0030] In one embodiment of the present invention, the pXMJ19 and pEC-XK99E plasmid expression vectors are purchased from BioVector China Plasmid Vector Strain Cell Gene Collection Center.

[0031] The present invention also provides a method for constructing the above-mentioned recombinant Corynebacterium glutamicum, which comprises the following steps:

[0032] (1) Using pK18mobsacB, the repressor protein BetI or LmrA binding sequence was inserted into the promoter region of the target gene in Corynebacterium glutamicum K02;

[0033] (2) Chemically synthesize the nucleotide sequence of the 5'UTR sequence of the repressor protein LmrA as shown in SEQ ID NOs. 8 to 14 (SynUTR) lmrA_variant1 ~SynUTR lmrA_variant7 ;

[0034] Chemically synthesized nucleotide sequences such as SEQ ID NO. 1 to 7 of the 5'UTR sequence of the repressor protein BetI SynUTR betI_variant1 ~SynUTR betI_variant7 ;

[0035] (3) Overexpression of the 5'UTR sequence SynUTR of the repressor protein LmrA using the pXMJ19 plasmid lmrA_variant1 ~SynUTR lmrA_variant7 and the repressor protein gene lmrA from Bacillus subtilis to prepare pXMJ19-SynUTR lmrA_variant1 -lmrA~pXMJ19-SynUTR lmrA_variant7 -lmrA;

[0036] (4) Overexpression of the 5'UTR sequence of the repressor protein BetI using the pEC-XK99E plasmid betI_variant1 ~SynUTR betI_variant7 and the repressor protein gene betI from Escherichia coli to prepare pEC-XK99E-SynUTR betI_variant1 -betI~pEC-XK99E-SynUTR betI_variant7 -betI;

[0037] (5) The recombinant vector prepared in step (4) is introduced into the host cell obtained in step (1).

[0038] Beneficial effects

[0039] The present invention generates two repressor libraries through simulation calculations, which regulate target gene expression over a wide range. By constructing repressor libraries, the present invention enables "on-off" fine-tuning of gene expression. This breakthrough in metabolic analysis and modification, which previously relied on gene knockout and overexpression as two non-on / off approaches to perturb cellular genotype, allows for precise, gradient fine-tuning of target gene expression to analyze and control its impact on phenotype and metabolic flux distribution. This can further improve the synthesis level and efficiency of target metabolites produced by microbial cell factories, shortening the production process. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 : Schematic diagram of the construction of a repressor library to downregulate competitive metabolic flux.

[0041] Figure 2 : Verification of repressor expression intensity.

[0042] Figure 3 : Effects of repressor library on gene transcription level in Corynebacterium glutamicum. DETAILED DESCRIPTION

[0043] The present invention will be further described below with reference to specific embodiments.

[0044] The Corynebacterium glutamicum K02 involved in the following examples was purchased from the China Industrial Microbiology Information Center and is numbered CICIM B1031.

[0045] The culture medium involved in the following examples is as follows:

[0046] Corynebacterium glutamicum competent medium (1 L): 10 g NaCl, 10 g tryptone, 5 g yeast extract, 3 g glycine, 7 g glucose, 1 mL tween-80.

[0047] BHI liquid medium: dissolve 38.5 g of brain heart infusion broth powder in 1 L of distilled water.

[0048] BHI solid medium: Add 2% agar powder to BHI liquid medium.

[0049] LB solid medium (1 L): 10 g NaCl, 10 g tryptone, 5 g yeast extract, 20 g agar powder.

[0050] The detection methods involved in the following embodiments are as follows:

[0051] The cell density OD was measured by UV spectrophotometer 600 The fluorescence intensity of the samples was measured using an Infinite M200 microplate reader.

[0052] The relative expression levels of the genes involved in the following examples were detected as follows:

[0053] Take 2mL of sample and use RNAprep Pure Cell / Bacteria Kit (DP430) to extract total bacterial RNA. The extraction process should be kept in an RNase-free state to prevent RNA degradation. After RNA extraction, the concentration is tested according to Reverse transcription was performed according to the instructions of the II QRT SuperMix for qPCR (+gDNA wiper) (R223-01) kit to obtain single-stranded cDNA. Finally, RT-qPCR analysis was performed using a StepOnePlus fluorescent quantitative PCR instrument, and the 16srRNA gene was selected as an internal reference for quantification. Specific operations refer to ChamQ TM Universal The qPCR Master Mix (Q311) kit instructions were followed and the reaction conditions were set as follows: 95°C for 30s; 95°C for 10s, 60°C for 30s, 40 cycles; then 95°C for 15s, 60°C for 60s, and 95°C for 15s. Each target gene was repeated three times and the average reading cycle was calculated. Finally, 2 -ΔΔCt Methods to calculate relative expression levels

[0054] In the following examples, the dihydrodipicolinate synthase gene dapA and the citrate synthase gene gltA are used as examples to illustrate the use of the system for regulating gene expression of the present invention. However, the technical solution of the present invention is applicable to the inhibition of other target genes of Corynebacterium glutamicum.

[0055] Example 1: Assembly and verification of the Corynebacterium glutamicum repressor library

[0056] (1) Chemically synthesize the nucleotide sequence of the 5'UTR sequence of the repressor protein BetI as shown in SEQ ID NO. 1 to 7 betI_variant1 ~SynUTR betI_variant7 ;

[0057] Chemically synthesized nucleotide sequences such as SEQ ID NO.8-14 shown in the 5'UTR sequence SynUTR of the repressor protein LmrA lmrA_variant1 ~SynUTR lmrA_variant7 ;

[0058] (2) Based on the lmrA nucleotide sequence of the Bacillus subtilis 168 genome sequence in NCBI (nucleotide sequence as shown in SEQ ID NO.18), the betI nucleotide sequence of the Escherichia coli BL21 (DE3) genome sequence as shown in SEQ ID NO.17), and the egfp nucleotide sequence of the recombinant plasmid pP43-egfp as shown in SEQ ID NO.19, the gene fragment SynUTR was designed. lmrA_variant1 -lmrA~SynUTR lmrA_variant7 -lmrA PCR primers P9-1-7 / P10, designed gene fragment SynUTR betI_variant1 -betI~SynUTR betI_variant7 -betI PCR primers P11-1-7 / P12, green fluorescent protein EGFP primers P13 / 14.

[0059] P9-1: 5'-tcacacaggaaacagaccatggaattcgacttgacaaaggaggacaaccgtcatg-3';

[0060] P9-2: 5'-tcacacaggaaacagaccatggaattc gagttgacaaaggaggacaaccgtc atg-3';

[0061] P9-3: 5'-tcacacaggaaacagaccatggaattc gacatgacaaaggaggacaaccgtc atg-3';

[0062] P9-4: 5'-tcacacaggaaacagaccatggaattc gagttgacaaaggagtacaaccgtc atg-3';

[0063] P9-5: 5'-tcacacaggaaacagaccatggaattc gacttgacaaaggactacaaccgtc atg-3';

[0064] P9-6: 5'-tcacacaggaaacagaccatggaattc gagttgacaaaggactacaaccgtc atg-3';

[0065] P9-7: 5'-tcacacaggaaacagaccatggaattc gacatgacaaaggacgacaaccgtc atg-3';

[0066] P10:5’-aaaacagccaagctgaattcttatctcttcagcaggtcaggaatgc-3’;

[0067] P11-1:5’-gaaactggtgcaggagtatctgtactaaaggaatataaaggaggacaacccgaatgccca-3’;

[0068] P11-2:5’-gaaactggtgcaggagtatctgtactaaaggaatataaaggaggacaacccgaatgccca-3’;

[0069] P11-3:5’-gaaactggtgcaggagtatctgtactaaaggaatataaaggaggacaacccgaatgccca-3’;

[0070] P11-4:5’-gaaactggtgcaggagtatctgtactaaaggaatataaaggaggacaacccgaatgccca-3’;

[0071] P11-5:5’-gaaactggtgcaggagtatctgtactaaaggaatataaaggaggacaacccgaatgccca-3’;

[0072] P11-6:5’-gaaactggtgcaggagtatctgtactaaaggaatataaaggaggacaacccgaatgccca-3’;

[0073] P11-7:5’-gaaactggtgcaggagtatctgtactaaaggaatataaaggaggacaacccgaatgccca-3’;

[0074] P12:5’-catgcctgcaggtcgactctagaggatccttaatcggtgggtaaatgctgagtaataaag-3’;

[0075] P13:5’-atgggtaagggagaagaacttttcac-3’;

[0076] P14: 5'-ttctctcatccgccaaaacagccttatttgtatagttcatccatgccatgtgtaatc-3'.

[0077] (2) Gene fragment SynUTR lmrA_variant1 -lmrA~SynUTR lmrA_variant7 -lmrA and SynUTR betI_variant1 -betI~SynUTR betI_variant7 -betI and cloning of the green fluorescent protein gene egfp.

[0078] PCR amplification was performed using the total DNA sequences of Bacillus subtilis 168 and Escherichia coli BL21 (DE3) published at NCBI and the recombinant plasmid pP43-egfp as templates using the aforementioned primers. Amplification conditions were: initial denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 90 s; and a final extension at 72°C for 5 min. The PCR amplification system consisted of 1 μL of template, 1 μL of each upstream and downstream primer, 22 μL of sterile double-distilled water, and 25 μL of 2× Phanta Max Master Mix. The PCR product was purified and recovered using a gel recovery kit, and the concentration of the recovered product was determined. The recovered product was stored in a 1.5 mL centrifuge tube at -20°C until further use.

[0079] (3) Fragment SynUTR lmrA_variant1 -lmrA-egfp~SynUTR lmrA_variant7 -lmrA-egfp and SynUTR betI_variant1 -betI-egfp~SynUTR betI_variant7 -Build of betI-egfp.

[0080] Using fusion PCR technology, P9-1-7 / P14 and P11-1-7 / P14 were used as primers to obtain SynUTR lmrA_variant1 -lmrA~SynUTR lmrA_variant7 -lmrA and SynUTR betI_variant1 -betI~SynUTR betI_variant7Fusion PCR was performed using -betI and egfp as templates. The fusion PCR amplification conditions were as follows: initial denaturation at 95°C for 5 min, followed by 8 cycles of denaturation at 95°C for 30 s and annealing at 55°C for 30 s. Then, primers P9-1-7 / P14 and P11-1-7 / P14 were added, followed by initial denaturation at 95°C for 5 min, 30 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 90 s, with a final extension at 72°C for 5 min. The PCR amplification system consisted of 2 μL of the upper and lower fragments, 1 μL each of the P15 and P18 primers, 19 μL of sterile double-distilled water, and 25 μL of 2× Phanta Max Master Mix. The PCR product was purified and recovered using a gel recovery kit, and the concentration of the recovered product was determined. The recovered product was stored in a 1.5 mL centrifuge tube at -20°C until further use.

[0081] (4) Construction of recombinant plasmid pXMJ19-SynUTR lmrA_variant1 -lmrA-egfp~pXMJ19-SynUTR lmrA_variant7 -lmrA-egfp and pEC-XK99E-SynUTR betI_variant1 -betI-egfp~pEC-XK99E-SynUTR betI_variant7 -betI-egfp.

[0082] The plasmid pXMJ19 stored in E. coli JM109 was extracted and double-digested with BamH I and EcoR I. The fragment SynUTR in (3) was recovered by gel recovery kit. lmrA_variant1 -lmrA-egfp~SynUTR lmrA_variant7 -lmrA-egfp, ligation was performed using the following system: Exnase II 2μL, 5×CE II Bμffer 4μL. The vector and fragment were added according to the instructions of the ligase Exnase II. The total volume was made up to 20μL with sterile double-distilled water, and then the enzyme ligation was carried out at 30℃ for 30min.

[0083] The plasmid pEC-XK99E stored in E. coli JM109 was extracted and double-digested with BamH I and EcoR I. After recovery using a gel recovery kit, the plasmid was combined with SynUTR in (3). betI_variant1 -betI-egfp~SynUTR betI_variant7-betI-egfp tandem fragments were ligated using the following ligation system: Exnase II 2μL, 5×CE II Bμffer 4μL. The vector and fragments were added according to the instructions for ligating Exnase II. The total volume was made up to 20μL with sterile double-distilled water, and then the enzyme ligation was carried out at 30°C for 30 min.

[0084] The ligated recombinant plasmids were transformed into competent E. coli JM109 cells, and positive transformants were screened using LB solid medium supplemented with chloramphenicol at a concentration of 10 μg / mL.

[0085] The correct transformants were picked and inoculated into 10 ml LB liquid medium with 10 μg / mL chloramphenicol resistance. After overnight culture at 37°C in a shaking incubator, the plasmids were extracted and the enzyme digestion and sequencing were performed to verify the correctness.

[0086] Get the correct recombinant strain and extract it to get the recombinant plasmid: pXMJ19-SynUTR lmrA_variant1 -lmrA-egfp~pXMJ19-SynUTR lmrA_variant7 -lmrA-egfp and pEC-XK99E-SynUTR betI_variant1 -betI-egfp~pEC-XK99E-SynUTR betI_variant7 -betI-egfp.

[0087] (5) Recombinant plasmid pXMJ19-SynUTR lmrA_variant1 -lmrA-egfp~pXMJ19-SynUTR lmrA_variant7 -lmrA-egfp and pEC-XK99E-SynUTR betI_variant1 -betI-egfp~pEC-XK99E-SynUTR betI_variant7 -betI-egfp were transformed into C. glutamicum K02 respectively.

[0088] Competent culture preparation: C. glutamicum K02 was picked and inoculated into 10 mL BHI liquid medium, cultured at 30 ° C for 18 h, and the cultured bacterial liquid was transferred into 100 mL liquid LBG medium containing 3 g / L glycine and 0.1% Tween-80 to make the initial cell OD 600 The cell OD reached 0.3. Culture at 30℃ and 200rpm until the cell OD 600 After the cell culture is complete, pre-chill the bacterial solution for 30 minutes and then collect the cells by centrifugation. Wash the cells three times with pre-chilled 10% glycerol and resuspend them in 0.2 mL of 10% glycerol. Aliquot 60 μL into 1.5 mL tubes and use them directly for electroporation.

[0089] Electroporation: Electroporation was performed at 1.8 kV for 5 ms. After electroporation, 800 μL of BHI medium was added and cultured at 30°C and 200 rpm for 1-2 h.

[0090] Obtain recombinant bacteria: Recombinant plasmid pXMJ19-SynUTR prepared in step (4) was respectively lmrA_variant1 -lmrA-egfp~pXMJ19-SynUTR lmrA_variant7 -lmrA-egfp and pEC-XK99E-SynUTR betI_variant1 -betI-egfp~pEC-XK99E-SynUTR betI_variant7 -betI-egfp were transformed into C. glutamicum K02 competent cells to obtain transformants, which were then plated on BHI solid medium containing 10 μg / mL chloramphenicol resistance and cultured at 30°C. Positive colonies were picked and the plasmids were extracted for enzyme digestion verification to obtain the recombinant strain C. glutamicum K02 / pXMJ19-SynUTR lmrA_variant1 -lmrA-egfp;C.glutamicum K02 / pXMJ19-SynUTR lmrA_variant2 -lmrA-egfp;C.glutamicum K02 / pXMJ19-SynUTR lmrA_variant3 -lmrA-egfp;C.glutamicum K02 / pXMJ19-SynUTR lmrA_variant4 -lmrA-egfp;C.glutamicum K02 / pXMJ19-SynUTR lmrA_variant5 -lmrA-egfp;C.glutamicum K02 / pXMJ19-SynUTR lmrA_variant6 -lmrA-egfp;C.glutamicum K02 / pXMJ19-SynUTR lmrA_variant7 -lmrA-egfp; respectively named: CLE1, CLE2, CLE3, CLE4, CLE5, CLE6, CLE7;

[0091] C.glutamicum K02 / pEC-XK99E-SynUTR betI_variant1 -betI-egfp;C.glutamicumK02 / pEC-XK99E-SynUTR betI_variant2 -betI-egfp;C.glutamicum K02 / pEC-XK99E-SynUTR betI_variant3-betI-egfp;C.glutamicum K02 / pEC-XK99E-SynUTR betI_variant4 -betI-egfp;C.glutamicum K02 / pEC-XK99E-SynUTR betI_variant5 -betI-egfp;C.glutamicum K02 / pEC-XK99E-SynUTR betI_variant6 -betI-egfp;C.glutamicum K02 / pEC-XK99E-SynUTR betI_variant7 -betI-egfp; respectively named: CBE1, CBE2, CBE3, CBE4, CBE5, CBE6, CBE7;

[0092] (6) Fluorescence intensity detection of recombinant bacteria

[0093] The recombinant bacteria obtained in step (5) above and the starting strain C. glutamicum K02 were inoculated into BHI liquid culture medium, respectively, and cultured at 30° C. for 18 h using a 24-well plate to obtain seed solution.

[0094] Take 30 μL of seed solution and inoculate it into 3 mL of LBG liquid medium. Cultivate it until the OD600 is 0.4-0.6. Take 100 μL of it and place it in a black 96-well fluorescent plate. Use Infinite M200 microplate reader to measure the fluorescence intensity of the sample. Determine the fluorescence intensity and OD600 value. Use the wild-type C. glutamicum K02 strain as the control strain. The green fluorescence detection conditions are excitation 485 nm and emission 528 nm. The results are as follows. Figure 2 shown.

[0095] Example 2: Construction of recombinant Corynebacterium glutamicum CGE00 and CGE01 The specific steps are as follows:

[0096] (1) Construction of integration plasmid pK18mobsacB-P BetI -dapA

[0097] The dapA gene sequence for the dihydrodipicolinate synthase gene from the Corynebacterium glutamicum ATCC 13032 genome published on the NCBI website was used to determine the location of the dapA gene promoter sequence and the insertion site of the repressor protein BetI binding sequence (nucleotide sequence shown in SEQ ID NO. 17). Gene fragments 750 bp in size before and after the insertion site were selected as upstream and downstream homology arms, and their sequences are shown in SEQ ID NO. 20 and SEQ ID NO. 21.

[0098] The upstream and downstream homology arm fragments (with the repressor protein BetI binding sequence) of the insertion site were amplified from the Corynebacterium glutamicum K02 genome with primers P1 / P2 and P3 / P4. The primer sequences involved are as follows:

[0099] P1: 5'-aggaaacagctatgacatgattacgaattcatgttgagggcgcggaagc-3';

[0100] P2: 5'-ttatattgaacgtccaatcaatggtttttacggctgtcttttacagc-3';

[0101] P3: 5'-attgattggacgttcaatataatcttgctcatgtcaattgttcttatcggaa-3';

[0102] P4: 5'-ttgtaaaacgacggccagtgccaagcttgatccgcccaaagcaagc-3';

[0103] The PCR program was as follows: 95°C, 10 min; 95°C, 30 s; 58°C, 30 s; 72°C, 1 min; 72°C, 10 min, 30 cycles. The two fragments were purified and overlap extension PCR amplified using primers P1 / P4 to obtain a fusion fragment. After purification, the fragment was ligated with the linearized plasmid pK18mobsacB (EcoR I / Hind III) using the homologous recombinase ClonExpress II One Step Cloning Kit (Norwegian) and transformed into E. coli JM109 competent cells to obtain transformants. The transformants were inoculated into LB liquid medium containing 50 μg / mL of kanamycin. After the positive transformant colonies were picked for PCR verification of the correct band size, the plasmid was extracted and sent to Jinweizhi Company for sequencing. If the plasmid was correct, then pK18mobsacB-P BetI -dapA plasmid was constructed successfully.

[0104] (2) Construction of integration plasmid pK18mobsacB-P LmrA -gltA.

[0105] The promoter sequence position and repressor LmrA binding sequence insertion site of the gltA gene were determined from the citrate synthase gene gltA sequence on the Corynebacterium glutamicum ATCC 13032 genome published on the NCBI website. Gene fragments 750 bp in size before and after the insertion site were selected as upstream and downstream homology arms, and the sequences are shown in SEQ ID NO. 22 and SEQ ID NO. 23.

[0106] The upstream and downstream homology arm fragments (with the repressor protein LmrA binding sequence) of the insertion site were amplified from the Corynebacterium glutamicum K02 genome with primers P5 / P6 and P7 / P8. The primer sequences involved are as follows:

[0107] P5: 5'-ggaaacagctatgacatgattacgaattccaaacttggaggagaactcaccg-3';

[0108] P6: 5'-aaatatagtgactggtctattatcggcattaaaaatcccacaataagtggact-3';

[0109] P7: 5'-gataatagaccagtcactatatttttaaaggccagcattttcaccct-3';

[0110] P8: 5'-ttgtaaaacgacggccagtgccaagcttcgaatctcgtcgttaaacttgtgaag-3';

[0111] The PCR program was as follows: 95°C, 10 min; 95°C, 30 s; 58°C, 30 s; 72°C, 1 min; 72°C, 10 min, 30 cycles. The two fragments were purified and overlap extension PCR amplified using primers P5 / P8 to obtain a fusion fragment. After purification, the fragment was ligated with the linearized plasmid pK18mobsacB (EcoR I / Hind III) using the homologous recombinase ClonExpress II One Step Cloning Kit (Norwegian) and transformed into E. coli JM109 competent cells to obtain transformants. The transformants were inoculated into LB liquid medium containing 50 μg / mL of kanamycin. After the positive transformant colonies were picked for PCR verification of the correct band size, the plasmid was extracted and sent to Jinweizhi Company for sequencing. If the plasmid was correct, then pK18mobsacB-P LmrA -gltA plasmid was constructed successfully.

[0112] (3) Preparation of competent cells:

[0113] C. glutamicum K02 competent cells were prepared according to the method of Example 1.

[0114] Recombinant bacteria obtained:

[0115] The recombinant plasmid pK18mobsacB-P prepared in step (1) BetI -dapA and pK18mobsacB-P LmrA -gltA were transformed into C. glutamicum K02 competent cells to obtain transformants, and the transformants were spread on BHI solid culture medium containing 50 μg / mL kanamycin resistance and cultured at 30°C. Positive colonies were picked and single colonies were verified by colony PCR using P1 / P4 and P5 / P8 as primers using Taq DNA polymerase; positive single colonies with the target band size were inoculated into vials containing BHI liquid culture medium and cultured for 12 hours, and then transferred to BHI liquid culture medium containing 20% ​​(m / v) sucrose and continued to be cultured for 12 hours; streaked onto BHI non-resistant plates, cultured for 24 hours, and colony PCR verification was performed. If the amplified fragment was smaller than the wild-type fragment, it was a positive clone; the positive clone was inoculated into a BHI vial, cultured overnight at 30°C, the bacterial genome was extracted, and sent to Jinweizhi Company for sequencing to verify that the sequence insertion in the genome was successful.

[0116] The strain in which the repressor protein BetI binding sequence was inserted into the promoter region of the dihydrodipicolinate synthase gene dapA in Corynebacterium glutamicum K02 was named C. glutamicum CGE 00.

[0117] The strain in which the citrate synthase gene gltA promoter region of Corynebacterium glutamicum K02 was inserted into the repressor protein LmrA binding sequence was named C. glutamicum CGE 01.

[0118] Example 3: Verification of the repressor library for attenuating gene transcription levels in Corynebacterium glutamicum

[0119] (1) Construction of recombinant plasmid:

[0120] The recombinant plasmid pXMJ19-SynUTR was prepared according to the method of Example 1. lmrA_variant1 -lmrA~pXMJ19-SynUTR lmrA_variant7 -lmrA and pEC-XK99E-SynUTR betI_variant1 -betI~pEC-XK99E-SynUTR betI_variant7 -betI.

[0121] (2) Construction of recombinant bacteria

[0122] Competent cells of C. glutamicum CGE00 and C. glutamicum CGE01 were prepared according to the method of Example 1.

[0123] (3) Obtaining recombinant bacteria:

[0124] The recombinant plasmid pXMJ19-SynUTR prepared in step (1) was respectively lmrA_variant1 -lmrA~pXMJ19-SynUTR lmrA_variant7 -lmrA were transformed into C. glutamicum CGE01 competent cells to obtain transformants, which were then spread on BHI solid medium containing 10 μg / mL chloramphenicol resistance and cultured at 30°C. Positive colonies were picked, and plasmids were extracted for enzyme digestion verification to obtain recombinant bacteria:

[0125] C.glutamicum CGE01 / pXMJ19-SynUTR lmrA_variant1 -lmrA;C.glutamicum CGE01 / pXMJ19-SynUTR lmrA_variant2 -lmrA;C.glutamicum CGE01 / pXMJ19-SynUTR lmrA_variant3 -lmrA;C.glutamicum CGE01 / pXMJ19-SynUTR lmrA_variant4 -lmrA;C.glutamicum CGE01 / pXMJ19-SynUTR lmrA_variant5 -lmrA;C.glutamicum CGE01 / pXMJ19-SynUTR lmrA_variant6 -lmrA;C.glutamicum CGE01 / pXMJ19-SynUTR lmrA_variant7 -lmrA; named as: CL1, CL2, CL3, CL4, CL5, CL6, CL7;

[0126] The recombinant plasmid pEC-XK99E-SynUTR prepared in step (1) was respectively betI_variant1 -betI~pEC-XK99E-SynUTR betI_variant7 -betI were transformed into C. glutamicum CGE00 competent cells to obtain transformants, which were then spread on BHI solid medium containing 10 μg / mL chloramphenicol resistance and cultured at 30°C. Positive colonies were picked, and plasmids were extracted and digested for enzyme verification to obtain recombinant bacteria:

[0127] C.glutamicum CGE00 / pEC-XK99E-SynUTR betI_variant1-betI;C.glutamicum CGE00 / pEC-XK99E-SynUTR betI_variant2 -betI;C.glutamicum CGE00 / pEC-XK99E-SynUTR betI_variant3 -betI;C.glutamicum CGE00 / pEC-XK99E-SynUTR betI_variant4 -betI;C.glutamicum CGE00 / pEC-XK99E-SynUTR betI_variant5 -betI;C.glutamicum CGE00 / pEC-XK99E-SynUTR betI_variant6 -betI;C.glutamicum CGE00 / pEC-XK99E-SynUTR betI_variant7 -betI; named as: CB1, CB2, CB3, CB4, CB5, CB6, CB7;

[0128] (5) Verification of the effect of repressor library on weakening gene transcription level (construction of repressor library for downregulating competitive metabolic flux as shown in Figure 5) Figure 1 shown)

[0129] The starting strain K02 and the recombinant bacteria were inoculated into the shake flask fermentation medium at 30℃ and 180r·min. -1 After culturing for 24 h, samples were taken to calculate the transcription levels of the target genes dapA and gltA.

[0130] The results are as follows Figure 3 As shown:

[0131] The results showed that C. glutamicum CGE01 / pXMJ19-SynUTR lmrA_variant1 -lmrA~C.glutamicumCGE01 / pXMJ19-SynUTR lmrA_variant7 The transcription level of gltA in -lmrA decreased with the increase of lmrA expression level and was lower than that of the starting strain.

[0132] C.glutamicum CGE00 / pEC-XK99E-SynUTR betI_variant1 -betI~C.glutamicumCGE00 / pEC-XK99E-SynUTR betI_variant7 The transcription level of dapA in -betI decreased with the increase of betI expression level and was lower than that in the starting strain.

[0133] RT-qPCR results showed that the repressor library strategy can achieve the down-regulation of transcriptional levels of target genes related to Corynebacterium glutamicum, providing an effective means for fine metabolic regulation.

[0134] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A method for reducing the expression of a target gene in Corynebacterium glutamicum, characterized in that The repressor protein LmrA binding sequence shown in SEQ ID NO.16 is placed downstream of the promoter of the target gene whose expression is to be reduced on the genome of Corynebacterium glutamicum; At the same time, an expression vector was used to express the repressor protein gene coupled with the 5'UTR sequence of the repressor protein LmrA. lmrA ; The nucleotide sequence of the 5'UTR sequence of the repressor protein LmrA includes the sequences of SEQ ID NO.8 to 14, and the repressor protein gene lmrA The nucleotide sequence is shown in SEQ ID NO.18; The expression vector is pXMJ19.

2. The method according to claim 1, wherein The Corynebacterium glutamicum includes but is not limited to: ATCC13032, ATCC14067, and SCgG2.

3. The recombinant Corynebacterium glutamicum prepared by the method according to claim 1 or 2.

4. Use of the recombinant Corynebacterium glutamicum according to claim 3 in expressing a target protein.

Images