Probe primer, probe for labeling gill-kidney cells of Exopalaemon carinicauda and application thereof

Abstract

The present invention relates to a probe primer, a probe and an application for labeling the branchial renal cells of Exopalaemon carinicauda, belonging to the field of aquatic biotechnology. The primer sequences are shown as SEQ.ID NO 1 and SEQ.ID NO 2, and the RNA probe sequence is shown as SEQ.ID NO 3. The present invention also provides a kit for labeling the branchial renal cells of Exopalaemon carinicauda, and the kit contains the RNA probe. The present invention also provides the application of the RNA probe in labeling the branchial renal cells of Exopalaemon carinicauda. The present invention locates the branchial renal cells of Exopalaemon carinicauda through fluorescence in situ hybridization of the NAR6 gene, providing theoretical and technical support for exploring the functions of renal cells and cell isolation and culture research.

Description

Technical Field

[0001] The invention belongs to the technical field of aquatic biology, and particularly relates to a probe primer for marking gill nephrocytes of white shrimp (Psora sphenodon), a probe and an application thereof. Background Art

[0002] Crustacean gills, in direct contact with water, are crucial organs for respiration, excretion, osmotic pressure regulation, and ion exchange. They are susceptible to environmental influences and pathogens, and their morphology and structure can undergo significant changes as they adapt to complex external environments. They are crucial components in the development of crustaceans' adaptive capacity. Therefore, understanding the detailed morphology and cell classification of crustacean gills is crucial for deciphering their complex physiological functions and further understanding the impacts of the environment and disease on crustaceans. Crustacean gills are categorized into lobate, branched, and filamentous gills, depending on the degree of gill surface magnification. Shrimp gills are branched, with two rows of curved lamellae along the gill axis, which are further subdivided into numerous lamellae. Crayfish and lobster gills are filamentous, with numerous tubular filaments arranged transversely along the gill axis. Brachyura, true shrimp, and some anomalas have lobate gills, with leaf-like lamellae flanking a flat central axis. Although they have been classified based on their appearance, due to methodological limitations, there is still no consensus on the specific morphological and structural characteristics of crustacean gills, such as cell composition and corresponding functions.

[0003] The carinicauda white shrimp (Exopalaemon carinicauda) belongs to the order Decapoda, tribe Euryphridia, family Polibridae, genus Exopalaemon. Its gills are typical foliate gills with strong environmental adaptability. They have a wide tolerance range to environmental stress factors that significantly affect homeostasis, such as salinity, alkalinity, pH, and ammonia nitrogen. They are good experimental materials for studying the morphological structure and function of crustacean foliate gills. According to existing research reports, the cell types of foliate gills mainly include columnar cells, septal cells, fixed blood cells and nephrocytes. At present, the cell localization, function and cell marker genes of columnar cells, septal cells and fixed blood cells have been studied to a certain extent. Columnar cells are epithelial cells, distributed below the cuticle of the gill lamellae, often appearing in pairs, with a large number of microtubules on the basal side and a large number of mitochondria on the top plasma membrane. They mainly play a supporting and ion transport role. Studies have shown that VH + -ATPase, carbonic anhydrase and other plasma transport genes are its marker genes. Septal cells are often located between a pair of columnar cells and contain many mitochondria, Golgi bodies and rough endoplasmic reticulum. Studies have shown that Na + / K +-ATPase is its marker gene. Sessile hemocytes are found in the hemolymph spaces of gill tissue and, similar to hemocytes, play an immune role in the gills. It is speculated that common hemocyte marker genes, such as prophenoloxidase and lectin, are also its marker genes. Currently, little research has been conducted on crustacean gill nephrocytes. Studies have reported that their structure is similar to podocytes in other tissues, podocytes in insect sinusoids, and podocytes in the glomeruli of vertebrate kidneys, indicating that they are cells with excretion functions. However, due to the unknown marker genes and unclear cellular localization, their function needs further verification.

[0004] Notably, previous studies using single-cell transcriptome sequencing revealed a significant increase in the proportion of nephrocytes in white shrimp (Palaeocarpus spinulosa) following alkalinity stress, with some cells transitioning to ion transport functions. This suggests that nephrocytes play a key role in responding to alkalinity stress. Single-cell transcriptome sequencing identified several genes that are specifically and highly expressed in nephrocytes, with neuronal acetylcholine receptor subunit alpha-6 (NAR6) being the most prominent. Therefore, probes designed using nephrocyte marker genes will clarify the distribution of nephrocytes and provide a foundation for future studies of nephrocyte culture in vitro and the key molecular mechanisms underlying their response to environmental stress. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a probe primer, a probe and an application for marking the gill nephrocytes of the white shrimp, that is, using fluorescence in situ hybridization technology, designing probe primers on the NAR6 gene sequence specifically expressed in the gill nephrocytes of the white shrimp, preparing the probe, and locating the gill nephrocytes of the white shrimp.

[0006] The present invention is achieved through the following technical solutions:

[0007] The present invention provides a probe primer for labeling gill nephrocytes of white shrimp, and the primer sequence is as follows:

[0008] F:5'-tggaccacttcggagaaaacc-, 3'

[0009] R:'- taatacgactcactataggg taagaagattcggagggggtg-3', the underlined sequence is the T7 promoter.

[0010] The present invention also provides an RNA probe for marking gill nephrocytes of white shrimp, and the sequence of the RNA probe is shown in SEQ.ID NO.3.

[0011] The present invention also provides a kit for locating gill nephrocytes of white shrimp, and the kit comprises the RNA probe.

[0012] The preparation method of the RNA probe is as follows:

[0013] 1) Synthesize the linearized template of the NAR6 gene of white shrimp

[0014] 2) In a 0.2 ml centrifuge tube, add 1 μg of linearized template, 1 μl of Fluorescein-NTP, 2 μl of 5× buffer, 0.5 μl of 10 U RNase I, 1 μl of T7 polymerase, and add H2O to 10 μl in this order.

[0015] 3) The product was placed in a 37°C water bath for 2 hours.

[0016] 4) After incubation in a water bath, add 2 μl of DNase I and 18 μl of DEPC H2O to the product and incubate in a 37°C water bath for 15 minutes.

[0017] 5) Purify the RNA probe in a water bath and store at -80°C.

[0018] The present invention also provides an application of the RNA probe in labeling gill nephrocytes of white shrimp, and the specific steps of the application are as follows:

[0019] 1) Gill tissues of white shrimp were collected, rinsed with PBS, fixed in 4% PFA in an RNA-free centrifuge tube, and stored at 4°C overnight.

[0020] 2) The fixed samples were washed with PBS, dehydrated by sedimentation in 30% sucrose solution at 4°C overnight, and then placed in OCT (a cryosection embedding medium) and frozen at -80°C.

[0021] 3) preparing gill tissue frozen sections from the sample in a freezing microtome;

[0022] 4) Fixing the slices described in step 3) with 4% PFA and then rinsing with PBS;

[0023] 5) Prepare hybridization solution, add the white shrimp NAR6 RNA probe after pre-hybridization, hybridize at a final concentration of 1 μg / ml, and incubate at 70°C overnight;

[0024] 6) After overnight incubation in step 5), washing with wash solution, TNT, Glycine-HCl, and TNT;

[0025] 7) Incubate with blocking solution at room temperature for 2-3 hours, then add anti-Fluoresein-POD and incubate overnight at 4°C.

[0026] 8) Wash the slices in step 7) with TNT, add Try-Cy3 dye and incubate at 37°C for 10-20 minutes;

[0027] 9) Stain the nuclei with DAPI, add an antifade reagent, and mount the slides. Finally, observe the fluorescence staining results under a laser confocal microscope to localize the expression of the NAR6 gene at the mRNA level and, in turn, localize the gill nephrocytes of the white shrimp.

[0028] Furthermore, the hybridization solution in step 5) is prepared by adding 25 ml of formamide, 10 ml of 20×SSC, 5 g of dextran sulfate, 1 ml of 50×Denhardt's, and adding RNase-free water to make up to 50 ml;

[0029] Furthermore, the pre-hybridization in step 5) is performed by adding hybridization solution and incubating at 68-70° C. for 15 minutes.

[0030] Furthermore, the wash solution in step 6) is prepared by adding 10 ml of 20×SSC, 100 ml of Formamide, 2.5 ml of 20% Tween 20, and adding RNase-free water to a volume of 200 ml;

[0031] The preparation method of TNT in step 6) is as follows: 100 ml of 1 M Tris-HCl (pH 7.5), 30 ml of 5 M NaCl, 5 ml of 20% Tween 20, and RNase-free water are added to make up the volume to 1 L.

[0032] The preparation method of Glycine-HCl in step 6) is as follows: 7.5g of Glycine is added with water to 1L, and concentrated HCl is added dropwise to adjust the pH to 2.0;

[0033] The blocking solution in step 7) is prepared by adding 2% goat serum and 2 mg / ml BSA in a volume ratio to TNT;

[0034] The beneficial effects of the present invention compared with the prior art are as follows:

[0035] The present invention locates nephrocytes in the gill tissue of white shrimp through fluorescence in situ hybridization of the NAR6 gene, providing theoretical and technical support for exploring the function of nephrocytes and cell isolation and culture research, which will help further study the saline-alkali adaptation mechanism of white shrimp. In addition, the invention has certain application references in gene localization and functional research in the gill tissue of other crustaceans through in situ hybridization. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1Schematic diagram of HE staining of paraffin sections of gill nephrocytes of white shrimp provided in Example 1 of the present invention, wherein black arrows indicate nephrocytes;

[0037] Figure 2 This is a schematic diagram of the fluorescence in situ hybridization analysis of the NAR6 gene in gill tissue of the white shrimp in Example 2 of the present invention. Blue fluorescence indicates the cell nucleus, and yellow fluorescence indicates the positive signal of the NAR6 gene. DETAILED DESCRIPTION

[0038] The following is a further description of the method for designing and preparing a fluorescent in situ hybridization probe for the gill nephrogenic cell-specific gene NAR6 of the white shrimp to specifically locate and identify nephrogenic cells, with reference to specific examples.

[0039] The present invention first uses paraffin section HE staining technology to observe the specific location and morphological structure of nephrocytes in gill tissue, and further locates the mRNA level of gill nephrocytes through frozen sections of gill tissue of white shrimp and fluorescence in situ hybridization experiments of the NAR6 gene of white shrimp. In addition, the present invention will have certain application prospects in the gene positioning and functional research of nephrocytes in the gill tissue of other crustaceans through fluorescence in situ hybridization.

[0040] The hybridization solution was prepared by adding 25 ml of formamide, 10 ml of 20× SSC, 5 g of dextran sulfate, 1 ml of 50× Denhardt's, and adding RNase-free water to make up to 50 ml.

[0041] The wash solution was prepared by adding 10 ml of 20× SSC, 100 ml of Formamide, 202.5 ml of 20% Tween, and adding RNase-free water to make up to 200 ml.

[0042] TNT was prepared by adding 100 ml of 1 M Tris-HCl (pH 7.5), 30 ml of 5 M NaCl, 205 ml of 20% Tween, and adding RNase-free water to make up to 1 L.

[0043] Glycine-HCl was prepared by adding 7.5 g of Glycine to 1 L of water and adding concentrated HCl dropwise to adjust the pH to 2.0;

[0044] The blocking solution was prepared by adding 2% goat serum and 2 mg / ml BSA in TNT by volume;

[0045] The hybridization solution containing the NAR6 gene RNA probe of the white shrimp is added to dilute the probe to a final concentration of 1 μg / ml.

[0046] Example 1

[0047] A method for locating nephrogenic cells in gill tissue of white shrimp using HE staining of paraffin sections, the specific steps of the method are as follows:

[0048] (1) Sampling: The gill tissue of fresh white shrimp was removed in one piece with scissors and fixed in Bouin's fixative (75 ml of saturated picric acid solution, 5 ml of glacial acetic acid, and 25 ml of 40% formaldehyde) for 24 h.

[0049] (2) Dehydration and wax immersion: Place the sample in an alcohol gradient for dehydration: 75% alcohol for 4 hours, 85% alcohol for 2 hours, 90% alcohol for 2 hours, 95% alcohol for 1 hour, anhydrous ethanol for 30 minutes twice, benzene for 10 minutes, xylene for 10 minutes twice, and paraffin wax melted at 65° for 1 hour three times.

[0050] (3) Embedding: Place the melted wax into the embedding box and place the gill tissue into the embedding frame before the wax solidifies. Cool the wax in a -20° freezer. After the wax solidifies, remove the wax block from the embedding frame and trim the wax block.

[0051] (4) Sectioning: Place the trimmed wax block on a paraffin slicer and slice it to a thickness of 6 μm. Float the slices on a 42°C warm water slide to flatten the tissue. Pick up the tissue on a glass slide and bake it in a 60°C oven. Store at room temperature until ready for use.

[0052] (5) Dewaxing of paraffin sections: Place the sections in xylene I for 20 min, xylene II for 20 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, and 75% alcohol for 5 min, and then wash with tap water.

[0053] (6) Hematoxylin staining: Stain the sections with hematoxylin solution for 3-5 minutes, wash with tap water, differentiate with differentiation solution, wash with tap water, blue with bluing solution, and rinse with running water.

[0054] (7) Eosin staining: The sections were dehydrated in 85% and 95% graded alcohol for 5 min each, and then stained in eosin solution for 5 min.

[0055] (8) Dehydration and sealing: The slices were placed in anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, anhydrous ethanol 5 and 5 min, xylene I for 5 min, and xylene II for 5 min to make them transparent, and then sealed with neutral gum. Observe under an optical microscope (see Figure 1 ).

[0056] Example 2

[0057] 1. Probe Design and Synthesis

[0058] A fluorescent in situ hybridization probe primer for the NAR6 gene in the gill tissue nephrocytes of white shrimp, wherein the primer sequences are as follows: SEQ.NO 1: 5-'TGGACCACTTCGGAGA-A3A'ACC, SEQ.NO 2: 5'- TAATACGACTCACTATAGGG TAAGAAGATTCGGAGGGGGTG-3', underlined is the T7 promoter sequence; the probe was synthesized using the above primers. Specific steps: (1) PCR amplification was performed in a 20 μl reaction system, the resulting product was subjected to 1.5% agarose gel electrophoresis, ligated and transformed, gel-cut and recovered to obtain a linearized template, and sequenced to confirm the sequence correctness. The sequence is SEQ ID NO: 3. After sequencing was confirmed, 1 μg of the linearized template product was obtained by PCR amplification and gel recovery in a 100 μl reaction system.

[0059] (2) Amplification of linear template: Add the following to a PCR centrifuge tube: 1 μg of linearized template, 1 μl of Fluorescein-NTP, 2 μl of 5× buffer, 0.5 μl of 10 U RNase I, 1 μl of T7 polymerase, and finally add DEPC H2O to make up to 10 μl.

[0060] (3) Seal with sealing film and place in a 37°C water bath for 2 hours.

[0061] (4) Centrifuge after water bath, add 2 μl DNase I and 18 μl DEPC H2O, and bathe at 37°C for 15 min.

[0062] (5) Purify the RNA probe using a Sigma kit according to the instructions and store at -80°C for a long time.

[0063] The nucleic acid sequence of the NAR6 RNA probe is shown in SEQ ID NO: 3:

[0064] tggaccacttcggagaaaaccatttgctgatattccccggcggcactgttctgtgggtacctccaggtttattcagggtggagtgtccgctggattttacctattggccctatgacagccaaaaagtgccatttgcatattggctcttggacttaccatggatgg cagatagatttacagttaatgtataacaccacagataaggaggtacttctgggagcttattgggaaccgtcccacgagtggaagttcctctctgggaccatgcaacgtcacgagtcttacttcgcctgttgcccggaaccttacgtcagcatcctcgtcactct caacctgaagcgaatttcggcgacgttcgtggggacggtggtcattccagcttgcgcaatatcggcgttgaccttgatccagttcctgttgcctgtaagagagaagaagagagtggtagttggatgctgctgcctcctgttgaccgttttggaaatcatctact tgggaacgtccatcccgcacctgtctacttcgacccccattatagtcaagttctacggccaaacgttgatcgtggtgacagtcagtgtggccgtgactgccctcatactacgactgactgacactgagcaccctgcagcctcaacaccccctccgaatcttctta

[0065] 2. Fluorescence in situ hybridization

[0066] The fluorescence in situ hybridization method for localizing the NAR6 gene in the gill nephrocytes of the white shrimp using the above probe is as follows:

[0067] (1) Sample fixation. Use DEPC-treated scissors to remove the entire gill sample of the white shrimp, place it in an RNase-free centrifuge tube, add at least 10 times the sample volume of 4% PFA fixative, and store at 4°C overnight.

[0068] (2) Sample embedding and section preparation: After fixation and preservation, the samples were washed three times with PBS, dehydrated in 30% sucrose solution, and precipitated at 4°C overnight. The samples were then embedded in OCT and frozen at -80°C. Frozen sections with a thickness of approximately 8 μm were cut using a freezing microtome, air-dried at room temperature overnight, and stored at -20°C as in situ hybridization samples.

[0069] (3) Fluorescence in situ hybridization:

[0070] 1) Day 1: Rinse frozen sections three times with PBS, then three times with PBST (PBS + 0.3% Triton) for 15 minutes each. After rinsing, prepare hybridization solution with 10% Dextran sulfate at 80°C for 5 minutes to promote probe binding. Incubate at 68-70°C for 15 minutes. Then, replace the hybridization solution and add 1 μg / ml of NAR6 fluorescent probe. Incubate at 70°C overnight.

[0071] 2) Day 2: Wash sections three times for 30 minutes each in a wash solution (1× SSC, 50% formamide, 0.1% Tween-20) at 70°C. Rinse sections three times for 10 minutes each in TNT. Soak sections in 100mM Glycine-HCl (adjusted to pH 2.0 and 0.1% Tween 20) for 10 minutes to inactivate any peroxidase. Rinse sections three times for 10 minutes each in TNT. Finally, incubate sections in blocking solution (TNT with 2% goat serum and 2mg / ml BSA) at room temperature for 2-3 hours. Add anti-Fluoresein-POD antibody to the blocking solution at a 1:2000 volume ratio and incubate overnight at 4°C.

[0072] 3) Day 3: Rinse the sections with TNT 4 times at room temperature for 10 minutes each time. After rinsing, incubate with 1× Plus Amplification Diluent antibody diluent for 5 minutes. Add 20μl Cy3 and 40ul 50% Dextran sulfate to 1ml Amplification Diluent to make a fluorescent colorimetric solution. Evenly drip the colorimetric solution on the tissue for closed-light colorimetric development. All steps after colorimetric development are performed in a dark box. Rinse the sections with TNT 4 times for 5 minutes each time. Dilute DAPI 1000 times with PBS and drip it on the sample to stain the nucleus, then rinse with TNT 4 times. After adding antifade agent, seal the sections with neutral gum and observe with a laser confocal microscope (see Figure 2 Both HE staining and fluorescence in situ hybridization results showed that the gill nephrocytes of the white shrimp were located in the middle axis of the gill filaments close to the gill lamellae.

Claims

1. A probe primer for labeling gill nephrocytes of white shrimp, characterized in that: The primer sequences are as follows: F: 5'-TGGACCACTTCGGAGAAAACC-3', R:5'- TAATACGACTCACTATAGGG TAGAAGATTCGGAGG GGGTG-3'.

2. An RNA probe for labeling gill nephrocytes of white shrimp, the probe being constructed using the primers according to claim 1, and the sequence of the RNA probe being shown in SEQ.ID NO 3.

3. A kit for locating gill nephrogenic cells of white shrimp, characterized in that: The kit comprises the probe primer according to claim 1.

4. Use of the RNA probe according to claim 2 in labeling gill nephrocytes of white shrimp.

5. The use according to claim 4, characterized in that The specific steps of the application are as follows: 1) Gill tissues of white shrimp were collected, rinsed with PBS, fixed in 4% PFA in an RNA-free centrifuge tube, and stored at 4°C overnight. 2) The fixed samples were washed with PBS, dehydrated by sedimentation in 30% sucrose solution at 4°C overnight, and then placed in OCT (a cryosection embedding medium) and frozen at -80°C. 3) preparing gill tissue frozen sections using a freezing microtome from the sample prepared in step 2); 4) Fixing the slices described in step 3) with 4% PFA and then rinsing with PBS; 5) preparing a hybridization solution, adding the RNA probe of claim 2 after prehybridization for hybridization, with a final concentration of the RNA probe of 1 μg / ml, and incubating at 70° C. overnight; 6) After overnight incubation in step 5), washing with wash solution, TNT, Glycine-HCl, and TNT in sequence; 7) After washing in step 6), incubate the sections with blocking solution at room temperature for 2-3 hours, then add anti-Fluoresein-POD and incubate at 4°C overnight; 8) Wash the slices treated in step 7) with TNT, add Try-Cy3 dye and incubate at 37°C for 10-20 minutes; 9) The sections treated in step 8 were stained with DAPI for nuclei, antifade agent was added, and the sections were sealed; finally, the fluorescence staining results were observed under a laser confocal microscope to localize the expression of the NAR6 gene at the mRNA level in the white shrimp, thereby localizing the gill nephrocytes of the white shrimp.

6. The use according to claim 5, characterized in that The hybridization solution in step 5) is prepared by adding 25 ml of formamide, 10 ml of 20×SSC, 5 g of dextran sulfate, 1 ml of 50×Denhardt's, and adding RNase-free water to make up the volume to 50 ml.

7. The use according to claim 5, characterized in that The pre-hybridization in step 5) is performed by adding hybridization solution to the sample and then incubating at 68-70° C. for 15 minutes.

8. The use according to claim 5, characterized in that The wash solution in step 6) is prepared by adding 10 ml of 20×SSC, 100 ml of Formamide, 202.5 ml of 20% Tween, and adding RNase-free water to make the volume up to 200 ml.

9. The use according to claim 5, characterized in that The preparation method of TNT in step 6) is as follows: 100 ml of 1 M Tris-HCl (pH 7.5), 30 ml of 5 M NaCl, 205 ml of 20% Tween, and RNase-free water are added to make the volume to 1 L.

10. The use according to claim 5, characterized in that In step 6), the preparation method of Glycine-HCl is as follows: 7.5 g of Glycine is added with water to 1 L, and concentrated HCl is added dropwise to adjust the pH to 2.0; the preparation method of the blocking solution in step 7) is as follows: 2% goat serum and 2 mg / ml BSA are added to TNT in a volume ratio.

Images