Tomato leaf miner ecdysone hormone receptor EcR gene and its application in controlling tomato leaf miner

Abstract

The present invention relates to the field of agricultural biotechnology, and particularly to the ecdysone hormone receptor EcR gene of the tomato leafminer and its application in controlling the tomato leafminer. The present invention for the first time clones the ecdysone hormone receptor EcR gene from the newly emerged important invasive pest, the tomato leafminer. After the larvae of the above-mentioned invasive pest feed on the dsRNA of this gene, phenomena such as larval death and abnormal pupation occur. The obtained results provide a new approach for controlling newly emerged invasive pests by using RNAi.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biotechnology, and particularly to the ecdysone receptor EcR gene of Tuta absoluta and its application in controlling Tuta absoluta. Background Art

[0002] Tuta absoluta belongs to the family Gelechiidae of Lepidoptera and is native to Peru in the western part of South America. It is a world quarantine pest. Currently, the main method for controlling Tuta absoluta is chemical control. With the continuous use of chemical pesticides, its drug resistance has been continuously enhanced, and it can quickly develop resistance to various pesticide targets.

[0003] After double-stranded RNA (dsRNA) homologous to the target gene sequence enters the cell, it specifically degrades or inhibits the expression of homologous mRNA, thereby inhibiting or shutting down the expression of specific genes. This process of triggering post-transcriptional silencing of specific genes in an organism is called RNAi. The RNAi technology has the advantages of high specificity and precise pest control in terms of specificity, and will not affect non-target organisms; it has the characteristic of easy degradation in terms of safety and is an environmentally friendly reagent; it has the advantages of simple operation and short working cycle in actual operation, which can greatly save labor and time costs; in terms of practicality, it has the advantage of being able to be applied in the field in the form of spray or irrigation preparations. Research shows that inhibiting the expression of important genes during the growth and development of insects can cause growth and development disorders or death of insects. Therefore, RNAi is considered a potential method for effectively controlling pests, which can avoid the overuse of chemical insecticides, facilitate the development of sustainable agriculture, and is also the most likely bioengineering technology to be applied to pest control so far.

[0004] The ecdysone receptor EcR (ecdysone receptor) belongs to the members of the nuclear receptor superfamily and is the target of the molting hormone 20-hydroxyecdysone (20E). It is an important regulatory protein in insects. Therefore, based on the RNA interference technology, the present invention provides a new RNAi molecular target for pest control that is non-toxic and harmless to the environment and has strong specificity, hoping to provide new ideas for controlling Tuta absoluta and achieving effective control effects. Summary of the Invention

[0005] The purpose of the present invention is to provide a ecdysone receptor gene of Tuta absoluta.

[0006] Another purpose of the present invention is to provide the application of the ecdysone receptor gene of Tuta absoluta in controlling Tuta absoluta.

[0007] Another purpose of the present invention is to provide a method for controlling Tuta absoluta.

[0008] According to the specific embodiments of the present invention, the ecdysone hormone receptor EcR gene of Tuta absoluta was cloned for the first time, and its full-length cDNA nucleotide sequence is shown in SEQ ID No: 1 as follows:

[0009]

[0010] The ecdysone hormone receptor EcR gene of Tuta absoluta encodes an amino acid sequence shown in SEQ ID NO: 2: MRRRWSNNGGFQTLRMLEESSSEVTSSSALGLLPAMVMSPESLASPEYGALELWGYDDGINSYNATQLLQANACNMPPQQPQQTLPSMPLPMNPQTPKSENESISSGREELSPASSVNGCSTDGDARRQKKGPAPRQQEELCLVCGDRASGYHYNALTCEGCKGFFRRSVTKNAVYICKFGHACEMDMYMRRKCQECRLKKCLAVGMRPECVVPETQCQIKRNEKKKQREKDKLPVSTTTVDDHMPPIMQCDPPPPEAARIHEVVPRFLPEKLLEQNRAKKIPPLTANQQFLIARLVWYQDGYEHPSEEDLKRVTQTWQQAAEEEEGSSDLPFRQITEMTILTVQLIVEFAKGLPGFSKISQPDQITLLKACSSEVMMLRVTRNYDAATDSVMFATNQAYTRDNYRKAGMDYVIEDLLHFCRCMHAMAMDNVHYALLIAIVIFSDRPGLEQPQLVEEIQRYYLNTLRMYILNQHSASPRCAIIYGKMLSILSELRTLGMQNSNMCISLKLKNRKLPPFLEEIWDVADVSSAQSRAIQNAVDAPSSRPSPYTSVVP

[0011] The present invention provides the application of the above-mentioned ecdysone hormone receptor EcR gene of Tuta absoluta. RNAi was performed on Tuta absoluta, and the results showed that the mortality rate of Tuta absoluta larvae fed with dsEcR reached 69.68%, and the larvae and pupae showed malformation with different symptoms. This indicates that the dsEcR gene plays a key role in the development of Tuta absoluta. The dsRNA synthesized from the EcR gene fragment of Tuta absoluta in the present invention has a high mortality rate for Tuta absoluta larvae and can be used for the control of Tuta absoluta, which has important practical significance for the control of this invasive pest.

[0012] According to the method for controlling Tuta absoluta of the present invention, the method includes the step of feeding Tuta absoluta with a dsRNA fragment of the ecdysone hormone receptor EcR gene of Tuta absoluta.

[0013] The method for preventing and controlling Tuta absoluta according to the present invention, wherein the total RNA of Tuta absoluta is extracted, cDNA is synthesized, and then the following primers are used to amplify the cDNA to obtain the dsRNA fragment of the ecdysone hormone receptor EcR gene of Tuta absoluta,

[0014] Primer dsEcR-F: taatacgactcactatagggGCGACCAACCAAGCCTACAC

[0015] Primer dsEcR-R: taatacgactcactatagggAAGACACATCGGCGACATCC.

[0016] The present invention first clones the ecdysone hormone receptor EcR gene from the newly emerged important invasive pest Tuta absoluta. After the larvae of the above-mentioned invasive pest feed on the dsRNA of this gene, phenomena such as larval death and abnormal pupation occur. The obtained results provide a new way for using RNAi to control newly emerged invasive pests. Description of the Drawings

[0017] Figure 1 Showing the changes in the expression profile of the EcR gene at different developmental stages

[0018] Figure 2 Showing the changes in the expression level of EcR under the conditions of feeding dsRNA of the EcR gene and feeding dsEGFP;

[0019] Figure 3 Showing the effect of dsRNA treatment of the EcR gene on the larval mortality rate of Tuta absoluta;

[0020] Figure 4 Showing the effect of dsRNA treatment of the EcR gene on the pupal weight of Tuta absoluta. Detailed Embodiments

[0021] Example 1 Cloning of the full-length cDNA sequence of the EcR gene of Tuta absoluta

[0022] Take 4 larvae of Tuta absoluta and put them into a 1.5 mL centrifuge tube. After freezing in liquid nitrogen, use a grinding rod to grind them into powder, and then extract RNA and store it at -80 °C for later use. According to the instructions of the TransScript All-in-One First-Strand cDNA Synthesis SuperMix for PCR kit, reverse transcribe the extracted RNA to synthesize cDNA. Using the cDNA as a template, design primers and perform PCR amplification. The designed primers are shown in Table 1:

[0023] Table 1 Primer sequences for cloning the full-length cDNA of the BtEcR gene

[0024] Primer Name Primer Sequence (5'-3') EcR-F TCAACAAAGTTTAAGTTTTC EcR-R ACGATCTGAATCTCCTTG

[0025] Using the sequences in Table 1, the full-length cDNA sequence of the EcR gene was obtained by PCR amplification, which is 1665 bp. The obtained gene has the nucleotide sequence shown in SEQ ID No: 1. This gene encodes 555 amino acid sequences shown in SEQ ID No: 2 and has the typical structural characteristics of the EcR protein. The highest identity of the amino acid sequence of the ecdysone receptor EcR gene of Tuta absoluta with homologous amino acid sequences in other insects is 90.23%.

[0026] Example 2 Analyze the effects of the EcR gene on the survival and development of Tuta absoluta larvae

[0027] 2.1 Analysis of the expression profile of the EcR gene at different developmental stages

[0028] Samples were collected from eggs, first to fourth instar larvae, early pupae (<3 d), late pupae (>3 d), newly emerged adults (female / male <3 d), and old adults (female / male >3 d) of Tuta absoluta, respectively. The expression of EcR at each stage was determined by real-time fluorescence quantitative PCR (RT-qPCR), and the relative expression level of the gene was calculated by the 2 -ΔΔCT method. The results are as Figure 1 shown. The expression level at the early pupal stage (<3 d) is significantly higher than that at other stages. There is no significant difference among different stages of the larval stage, and there is no significant difference from the late pupal stage (>3 d) to the adult stage. The expression level in the egg stage is significantly higher than that in the larval stage, female adults, and old male adults.

[0029] 2.2 Synthesis of dsRNA

[0030] (1) Design and synthesize primer sequences with the T7 promoter (the underlined sequence):

[0031] T7+dsEcR-F: 5’ taatacgactcactataggg GCGACCAACCAAGCCTACAC3’

[0032] T7+dsEcR-R: 5’ taatacgactcactataggg AAGACACATCGGCGACATCC3’;

[0033] (2) Total RNA extraction and cDNA synthesis: The same as in Example 1;

[0034] (3) PCR amplification with T7 primers, product purification. The purified PCR product is the template for synthesizing dsRNA. Use a kit to synthesize and purify dsRNA and operate according to the kit instructions.

[0035] 2.3 dsRNA feeding

[0036] Fresh leaves were picked and dried for 1 hour. Subsequently, the petioles were soaked in an aqueous solution containing dsEcR at a concentration of 25 μg / mL. After the leaves had fully absorbed the solution containing dsEcR (about 4 hours), 25 second-instar larvae that had been starved for 3 hours were gently transferred back to the soaked leaves. After moisturizing treatment, they were placed in an artificial climate chamber (average temperature 25 ± 2 °C, relative humidity 50 ± 10%, photoperiod L14:D10) for rearing. The larval status was observed every 24 hours. Four larvae were randomly selected for the detection of expression levels, and abnormal phenotypes (premature pupation or death, etc.) were recorded. Parameters such as larval mortality and pupal weight were statistically analyzed. Tomato leafminers fed with an aqueous solution containing dsEGFP (final concentration of dsEGFP was 25 μg / mL) were used as a control, and 4 biological replicates were set for each treatment.

[0037] By using the 2 -ΔΔCT method to calculate the relative expression level of the gene, the results are as Figure 2 shown. Feeding dsEcR can significantly knockdown the expression of the EcR gene. The mortality of tomato leafminer larvae after feeding different solutions was analyzed using SAS 9.4 statistical software. The results are as Figure 3 shown. The mortality of tomato leafminers fed with dsRNA of the EcR gene was significantly higher than that of the dsEGFP-fed group (P < 0.05); and Figure 4 the results showed that after feeding dsRNA of the EcR gene, the pupal weight was significantly lower than that of the control group. The target sequence fragment fed in this application is a unique sequence of the EcR gene, thus ensuring that the interference effect is generated by the EcR gene of the tomato leafminer, indicating that the EcR gene plays a key role in the growth and development of tomato leafminer larvae.

[0038] In the present invention, the full-length cDNA of the EcR gene was cloned from the tomato leafminer. Fluorescence quantitative PCR showed that the expression level of the EcR gene was significantly decreased after feeding the double-stranded RNA of the target gene. Finally, by feeding dsRNA of the EcR gene, the death of tomato leafminer larvae was induced. According to the specific embodiments of the present invention, the experimental results clarified that the EcR gene plays a key role in the growth and development of tomato leafminer larvae. The present invention laid a foundation for the research on the effective control of tomato leafminers using RNAi and provided a method basis for reducing the damage of tomato leafminers through future research on ecdysteroids.

[0039] The above embodiments are only used to explain the technical solutions of this application and do not limit the protection scope of this application.

Claims

1. Tomato leafminer ecdysone hormone receptor EcR gene, characterized in that The gene encodes a protein whose amino acid sequence is shown in SEQ ID No:

2.

2. The ecdysone hormone receptor of Tuta absoluta according to claim 1 EcR gene, characterized in that The nucleotide sequence of the gene is shown in SEQ ID No:

1.

3. Use of the ecdysone hormone receptor of Tuta absoluta described in claim 1 in controlling Tuta absoluta, wherein, EcR the gene Controlling the tomato leafminer is achieved by feeding the tomato leafminer with the dsRNA fragment of the tomato leafminer ecdysone hormone receptor EcR gene 4. The application according to claim 3, characterized in that, Tomato leafminer ecdysone hormone receptor EcR The gene is used to increase the mortality rate of tomato leafminers and reduce the pupal weight of tomato leafminers.

5. A method for controlling Tuta absoluta, characterized in that, The method includes the step of feeding the tomato leafminer with a dsRNA fragment of the tomato leafminer ecdysone hormone receptor EcR gene, wherein the tomato leafminer ecdysone hormone receptor EcR gene encodes a protein with an amino acid sequence shown in SEQ ID No:

2.

6. The method for preventing and controlling Tuta absoluta according to claim 5, characterized in that, The ecdysone hormone receptor of Tuta absoluta EcR The nucleotide sequence of the gene is shown in SEQ ID No:

1.

7. The method for controlling Tuta absoluta according to claim 5, characterized in that, Extract the total RNA of Tuta absoluta, synthesize cDNA, and then amplify the cDNA using the following primers to obtain the dsRNA fragment of the ecdysone hormone receptor gene of Tuta absoluta EcR of the gene Primer dsEcR-F: 5’GCGACCAACCAAGCCTACAC3’, Primer dsEcR-R: 5’AAGACACATCGGCGACATCC3’.

Images