Chinese cabbage hsk kinase, encoding gene bra dmr1 and use thereof

Abstract

The present application discloses Chinese cabbage HSK kinase, its coding gene BraDMR1 and application, and belongs to the technical field of genetic engineering breeding. The present application provides application of HSK kinase or a substance for regulating expression of the coding gene of the HSK kinase or a substance for regulating activity or content of the HSK kinase in regulating downy mildew resistance of plants, wherein the HSK kinase is a protein with an amino acid sequence of SEQ ID No. 2. The present application also provides a method for regulating downy mildew resistance of plants, which comprises regulating disease resistance of plants by regulating expression of the coding gene of the HSK kinase or regulating activity or content of the HSK kinase. The BraDMR1 gene is expected to be used in genetic engineering breeding, and a material with enhanced downy mildew resistance can be obtained after knocking out the BraDMR1 gene in an intermediate material in breeding.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering breeding technology, and particularly relates to Brassica campestris L. HSK kinase, a coding gene BraDMR1 thereof and application thereof. BACKGROUND

[0002] Brassica campestris L. ssp. pekinensis (Lour.) Olsson is a cultivated subspecies of Brassica campestris L. ssp. pekinensis (Lour.) Olsson, which is originally from China. As the largest vegetable crop in China, the yield and quality of Brassica campestris L. ssp. pekinensis (Lour.) Olsson are related to the market supply and market price of vegetables, and it is indeed an important vegetable. In the growth process of Brassica campestris L. ssp. pekinensis (Lour.) Olsson, it is often infected by downy mildew, virus disease, soft rot, black spot, white spot and black rot, among which downy mildew is one of the three major diseases of Brassica campestris L. ssp. pekinensis (Lour.) Olsson and the most common disease in Brassica campestris L. ssp. pekinensis (Lour.) Olsson production.

[0003] Downy mildew is a kind of fungal disease caused by Peronospora parasitica (Pers) Fr., and the pathogen mainly survives in the form of oospores in the soil or overwinters in the form of mycelium on the mother plant of seed storage. It germinates and infects in spring when the temperature and humidity are suitable, repeatedly infects the disease site to produce sporangia, and becomes the main initial infection source of crucifer downy mildew. At the initial stage of infection, light green spots are formed on the back of the leaf, and white mold appears when the humidity is high at the later stage of disease. Brown spots appear on the leaf veins, and then the spots gradually expand and connect, eventually leading to leaf withering, which has a great impact on the yield and quality of Brassica campestris L. ssp. pekinensis (Lour.) Olsson, especially the fast-growing Brassica campestris L. ssp. pekinensis (Lour.) Olsson such as seedling Brassica campestris L. ssp. pekinensis (Lour.) Olsson, green stem and heart. Brassica campestris L. ssp. pekinensis (Lour.) Olsson downy mildew is more serious in early spring and late autumn with lower temperature and higher humidity, and it is easy to spread in humid and cool areas and along rivers and coasts. In epidemic years, the incidence of Brassica campestris L. ssp. pekinensis (Lour.) Olsson can reach 80%-90%, and the yield can be reduced by 30%-50%. It can occur throughout the growth period and seriously affect the yield and quality of Brassica campestris L. ssp. pekinensis (Lour.) Olsson (Chen Feng, 2016, Analysis of the Occurrence and Control Measures of the Three Major Diseases of Brassica campestris L. ssp. pekinensis (Lour.) Olsson. China Agricultural Information, (17): 103-125; Gao Tianyi, Ren Xili, Meng Qifeng, et al., 2019, Research Status and Progress of Brassica campestris L. ssp. pekinensis (Lour.) Olsson Downy Mildew. Yangtze Vegetables, (16): 49-53).

[0004] Breeding of disease-resistant varieties is the most effective and safe method to control downy mildew of Chinese cabbage (Cao XM, Yu HM, Liu JJ, 2016, Different control effects of downy mildew of Chinese cabbage. Modern Rural Science and Technology, (05): 46). The pathogen of downy mildew of Chinese cabbage has multiple physiological races and complex resistance mechanisms, and the progress of resistance gene mining is slow. Niu XQ (1984) confirmed that the resistance of Chinese cabbage to downy mildew at the seedling stage was dominant inheritance by analyzing the resistance of resistant and susceptible materials and their F1 progeny (Niu XQ, 1984, Screening of original materials and genetic analysis of resistance to downy mildew and virus diseases in Chinese cabbage. Chinese Vegetables, (4): 28-32). However, there are only a few reports on the location and marker screening of resistance genes (Leng YQ, Hou XL, Shi GJ, 2007, RAPD markers for resistance to downy mildew in Chinese cabbage. Acta Horticulturae Sinica, 34(003): 763-766; Yu HF, Zhong XM, Li BY, et al., 2010, Molecular markers linked to the resistance gene to downy mildew in Chinese cabbage. Chinese Agricultural Science Bulletin, 26(15): 66-70; Kim SG, Song YH, Lee JY, et al., 2011, Identification of the BrRHP1 locus that confers resistance to downy mildew in Chinese cabbage (Brassica rapa ssp. pekinensis) and development of linked molecular markers. Theoretical and Applied Genetics, 123: 1183-1192). Our laboratory was the first to conduct research on the identification of the pathogen of downy mildew of Chinese cabbage, germplasm screening, resistance QTL mapping, and map-based cloning. We have fine-mapped the major QTLs BraDM, BR-DM1.1, and BR-DM04 on chromosomes A08, A01, and A04, respectively, and developed SSR, SNP, and Indel markers tightly linked to these loci (Yu SC, Zhang FL, Yu RB, et al., 2009, Genetic mapping and localization of a major QTL for seedling resistance to downy mildew in Chinese cabbage (Brassica rapa ssp. pekinensis). Molecular breeding, 23(4): 573-590; Yu SC, Zhang FL, Zhao XY, et al., 2011,Sequence-characterized amplified region and simple sequence repeat markers for identifying the major quantitative trait locus responsible for seedling resistance to Downy Mildew in Chinese cabbage (Brassica rapa ssp. Pekinensis). Plant breeding, 130(5):580-583; Li Hui, Yu Kuan-cang, Zhang Feng-lan et al., 2011. Development of molecular markers linked to the major QTL for resistance to downy mildew in Chinese cabbage (Brassica rapa L. ssp. Pekinensis). Acta Genetica Sinica, 33(11): 1271-1278; Yu SC., Su TB., Zhi SH., et al., 2016. Construction of a sequence-based bin map and mapping of QTLs for downy mildew resistance at four developmental stages in Chinese cabbage (Brassica rapa L. ssp pekinensis). Molecular Breeding, 36(4): 1-12.; Zhi Shenghua, Su Tong-bing, Yu Kuan-cang et al., 2016. Identification of a downy mildew resistance locus on chromosome A01 and development of related molecular markers in Chinese cabbage (Brassica rapa L. ssp. Pekinensis) using genome-wide association analysis. Plant Physiology Journal, 52(5): 693-702.; Zhang B., Li P., Su TB., et al., 2018. BrRLP48, encoding a receptor-like protein, is involved in downy mildew resistance in Brassica rapa. Frontiers in Plant science, 9: 1708), however, the mining of Chinese cabbage downy mildew resistance genes is still a long way to go.

[0005] After the pathogen invades the plant, the plant recognizes the pathogen-associated molecular patterns (PAMPs) on the surface of the pathogen through the pattern recognition receptors (PRRs) on the cell membrane surface, causing the PTI response (PAMPs triggered immunity). The PTI response is the first layer of innate immunity of the plant, which can inhibit the invasion of most pathogens, and is usually accompanied by Ca2+ outflow, large amounts of salicylic acid (SA) and jasmonic acid (JA) production, MAPK activation, etc., and at the same time, the expression of disease resistance related genes is up-regulated, and a large amount of reactive oxygen species is produced, but the immune response is relatively weak. Subsequently, the pathogen secretes effectors into the host cells to inhibit the PTI response of the plant, and then the plant directly or indirectly recognizes the effectors through the R protein (Resistance protein) to trigger the ETI response (Effector triggered immunity) (Zhou JM. & Zhang Y., 2020. Plant immunity: danger perception and signaling. Cell, 181(5): 978-989), i.e. the second layer of innate immunity. The ETI response is similar to the PTI response process, but the reaction is more intense, the duration is longer, and the inhibition of the pathogen is stronger, such as the hypersensitive response (HR). When the disease resistance gene is activated, the synthesis of plant hormone SA is activated through the regulation of EDS1, PAD4, etc., the transcriptional co-factor NPR1 recognizes the large amount of SA synthesis, and then transfers to the nucleus to activate the expression of antibacterial factors (Zhang J., Coaker G., Zhou JM., et al., 2020. Plant immune mechanisms: from reductionistic to holistic points of view. Molecular Plant, 13(10): 1358-1378).

[0006] In recent years, some genes that can help pathogen to infect host or promote the reproduction of pathogen in host have been reported in plants; because such genes reduce the resistance of plants to pathogen and promote the disease of plants, they are called susceptibility genes. According to the different functions of susceptibility genes in pathogen infection and reproduction in host, they are divided into three categories: the first category of susceptibility genes plays a function in the early stage of pathogen infection, such as regulating spore germination, promoting hyphal growth, etc. Glossy 11 mutation in maize can inhibit the germination of powdery mildew spores (Hansjakob A., Riederer M., Hildebrandt U., 2011, Wax matters: absence of very-long-chain aldehydes from the leaf cuticular wax of the glossy 11 mutant of maize compromises the prepenetration processes of Blumeria graminis. Plant Pathology, 60: 1151-1161); the second category of susceptibility genes encodes negative regulators of plant immune response, inhibits the PTI response or ETI response of plants, promotes the infection of pathogen, CESA3 mutation in Arabidopsis thaliana regulates cellulose synthesis, which can increase the resistance to multiple pathogenic bacteria by increasing the synthesis of ABA, JA and SA (Ellis C., Karafyllidis I., Wasternack C., et al., 2002, The Arabidopsis mutant cev1 links cell wall signaling to jasmonate and ethylene responses. Plant Cell, 14: 1557-1566); the third category of susceptibility genes maintains the growth and metabolism of pathogen in host, sucrose transporter protein SWEET in rice can be activated by TAL type effector to provide carbon source for the growth of pathogen (Streubel J., Pesce C., Hutin M., et al., 2013, Five phylogenetically close rice SWEET genes confer TAL effector-mediated susceptibility to Xanthomonas oryzae pv. oryzae. New Phytol, 200: 808-819).

[0007] The recessive resistance existing in nature can be caused by mutation of a disease-susceptible gene core site. At present, the disease-susceptible gene is found in crops such as Arabidopsis, rice, tomato and pepper. Knocking out the disease-susceptible gene by using the CRISPR / Cas9 technology can produce a polyphasic effect. Therefore, mining the disease-susceptible gene and knocking out the disease-susceptible gene are another important way to obtain a resistant variety. SUMMARY

[0008] The technical problem to be solved by the present application is how to improve the disease resistance of plants, especially the resistance to Chinese cabbage downy mildew.

[0009] To solve the above technical problems, in a first aspect, the present application provides applications, which can be C1) or C2) or C3):

[0010] C1), application of HSK kinase or a substance for regulating expression of a gene encoding the HSK kinase or a substance for regulating activity or content of the HSK kinase in regulating disease resistance of plants;

[0011] C2), application of HSK kinase or a substance for regulating expression of a gene encoding the HSK kinase or a substance for regulating activity or content of the HSK kinase in preparing a product for regulating disease resistance of plants;

[0012] C3), application of HSK kinase or a substance for regulating expression of a gene encoding the HSK kinase or a substance for regulating activity or content of the HSK kinase in plant breeding;

[0013] The HSK kinase can be A1) or A2) or A3) as follows:

[0014] A1), a protein with an amino acid sequence of SEQ ID No. 2;

[0015] A2), a protein obtained by substitution, deletion and / or addition of one or more amino acid residues in the amino acid sequence of A1) and having 80% or more identity with the protein of A1) and having the function of regulating disease resistance of plants;

[0016] A3), a fusion protein obtained by connecting a protein tag to the N-terminal or / and C-terminal of A1) or A2).

[0017] Further, in the above applications, the HSK kinase is derived from Chinese cabbage, the disease resistance of the plant can be the resistance to downy mildew of the plant, and the downy mildew can be a fungal disease caused by specific parasitic Peronospora parasitica (Pers) Fr. infection of the plant.

[0018] In the present application, the regulation of the expression of the HSK kinase-encoding gene or the regulation of the activity or content of the HSK kinase can be down-regulation or inhibition or reduction of the expression of the HSK kinase-encoding gene or down-regulation or inhibition or reduction of the activity or content of the HSK kinase.

[0019] In the present application, the purpose of plant breeding can include plants with improved disease resistance, especially plants that provide resistance to downy mildew.

[0020] The above-mentioned protein can be artificially synthesized, or the coding gene thereof can be synthesized first and then expressed biologically.

[0021] SEQ ID No. 2 consists of 370 amino acid residues.

[0022] In the present application, the protein tag refers to a polypeptide or protein that is expressed together with the target protein by using DNA in vitro recombination technology, so as to facilitate the expression, detection, tracking and / or purification of the target protein. The protein tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0023] Further, in the above-mentioned application, the substance for regulating the expression of the HSK kinase-encoding gene or the substance for regulating the activity or content of the HSK kinase is a biological material, and the biological material is any one of the following B1) to B15):

[0024] B1), an RNA molecule for inhibiting or reducing or down-regulating the expression of the HSK kinase-encoding gene or an RNA molecule for inhibiting or reducing or down-regulating the activity or content of the HSK kinase;

[0025] B2), an expression gene of the RNA molecule of B1);

[0026] B3), an expression cassette containing the expression gene of B2);

[0027] B4), a recombinant vector containing the expression gene of B2) or a recombinant vector containing the expression cassette of B3);

[0028] B5), a recombinant microorganism containing the expression gene of B2) or a recombinant microorganism containing the expression cassette of B3) or a recombinant microorganism containing the recombinant vector of B4);

[0029] B6), a transgenic plant cell line containing the expression gene of B2) or a transgenic plant cell line containing the expression cassette of B3) or a transgenic plant cell line containing the recombinant vector of B4);

[0030] B7) a transgenic plant tissue comprising the coding gene of B2), or a transgenic plant tissue comprising the expression cassette of B3), or a transgenic plant tissue comprising the recombinant vector of B4);

[0031] B8) a transgenic plant organ comprising the coding gene of B2), or a transgenic plant organ comprising the expression cassette of B3), or a transgenic plant organ comprising the recombinant vector of B4);

[0032] B9) a nucleic acid molecule encoding the HSK kinase;

[0033] B10) an expression cassette comprising the nucleic acid molecule of B9);

[0034] B11) a recombinant vector comprising the nucleic acid molecule of B9), or a recombinant vector comprising the expression cassette of B10);

[0035] B12) a recombinant microorganism comprising the nucleic acid molecule of B9), or a recombinant microorganism comprising the expression cassette of B10), or a recombinant microorganism comprising the recombinant vector of B11);

[0036] B13) a transgenic plant cell line comprising the nucleic acid molecule of B9), or a transgenic plant cell line comprising the expression cassette of B10), or a transgenic plant cell line comprising the recombinant vector of B11);

[0037] B14) a transgenic plant tissue comprising the nucleic acid molecule of B9), or a transgenic plant tissue comprising the expression cassette of B10), or a transgenic plant tissue comprising the recombinant vector of B11);

[0038] B15) a transgenic plant organ comprising the nucleic acid molecule of B9), or a transgenic plant organ comprising the expression cassette of B10), or a transgenic plant organ comprising the recombinant vector of B11).

[0039] Further, in the above-mentioned uses, the RNA molecule of B1) is a gRNA targeting the HSK kinase-encoding gene, and the nucleotide sequence of the target sequence of the gRNA is SEQ ID No. 1 218-236 and / or the nucleotide sequence of the target sequence of the gRNA is the reverse complement of SEQ ID No. 1 696-714.

[0040] Further, in the above-mentioned uses, the coding gene of B2) is a DNA molecule expressing a gRNA targeting the HSK kinase-encoding gene;

[0041] The nucleic acid molecule of B9) is a BraDMR1 gene, and the BraDMR1 gene is a DNA molecule as shown in b1), b2) or b3) below:

[0042] b1) the coding sequence of the coding strand is a DNA molecule represented by SEQ ID No. 1;

[0043] b2) the nucleotide sequence of the coding strand is a DNA molecule represented by SEQ ID No. 1;

[0044] b3) a DNA molecule having 80% identity to the DNA molecule represented by b1) or b2) and encoding a HSK kinase.

[0045] Herein, the identity refers to the identity of the amino acid sequence or the nucleotide sequence. The identity of the amino acid sequence can be determined using the homology search site on the Internet, such as the BLAST page of the NCBI homepage. For example, the identity (%) can be obtained by calculating the identity of a pair of amino acid sequences using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values), respectively, and performing a search in Advanced BLAST 2.1.

[0046] Herein, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0047] Further, in the above-mentioned use, the plant can be any one of the following P1) to P4):

[0048] P1) a monocotyledonous plant or a dicotyledonous plant;

[0049] P2) a Brassicaceae plant;

[0050] P3) a Brassica genus plant;

[0051] P4) a Chinese cabbage.

[0052] In the present application, the inhibition or reduction or down-regulation of the expression of the HSK kinase-encoding gene can be achieved by gene knockout or gene silencing.

[0053] The gene knockout refers to a phenomenon in which a specific target gene is inactivated by homologous recombination. The gene knockout is a phenomenon in which a specific target gene is inactivated by a change in the DNA sequence.

[0054] The gene silencing refers to a phenomenon that a gene is not expressed or lowly expressed without damaging original DNA. The gene silencing is premised on not changing the DNA sequence, so that the gene is not expressed or lowly expressed. The gene silencing can occur in two levels. One is the transcription level gene silencing caused by DNA methylation, heterochromatinization and position effect, etc. The other is the post-transcription gene silencing, i.e. the gene is inactivated by specifically inhibiting the target RNA after the gene is transcribed, including antisense RNA, co-suppression, quelling, RNA interference (RNAi) and micro RNA (miRNA) mediated translation inhibition, etc.

[0055] In the present application, the recombinant microorganism of B5) or B12) can be yeast, bacteria, algae or fungi. The bacteria can be gram-positive bacteria or gram-negative bacteria. The gram-negative bacteria can be Agrobacterium tumefaciens, which can be Agrobacterium tumefaciens GV3101; the gram-negative bacteria can be Escherichia coli, which can be Escherichia coli DH5α.

[0056] In the present application, the plant tissue of B7) or B14) can be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and anthers.

[0057] In the present application, the transgenic plant organ of B8) or B15) can be roots, stems, leaves, flowers, fruits and seeds of the transgenic plant.

[0058] In the present application, the transgenic plant cell line, the transgenic plant tissue and the transgenic plant organ can or can not include propagation materials.

[0059] To solve the above technical problems, in a second aspect, the present application provides a method for regulating the disease resistance of a plant, which comprises regulating the expression of the HSK kinase-encoding gene or regulating the activity or content of the HSK kinase to regulate the disease resistance of the plant.

[0060] Further, in the above method, the method comprises introducing the coding gene of the above gRNA molecule and the coding gene of the Cas protein into a recipient plant to inhibit or reduce the expression of the HSK kinase-encoding gene in the recipient plant or to inhibit or reduce the activity or content of the HSK kinase in the recipient plant, so as to obtain a target plant whose disease resistance is different from that of the recipient plant or a target plant whose disease resistance is higher than that of the recipient plant.

[0061] In the present application, the Cas protein can be a Cas9 protein.

[0062] Further, the coding gene of the Cas9 protein is located on a pKSE401 vector.

[0063] Further, in the above method, the plant can be any one of the following P1) to P4):

[0064] P1), a monocotyledonous plant or a dicotyledonous plant;

[0065] P2), a Brassicaceae plant;

[0066] P3), a Brassica genus plant;

[0067] P4), a Chinese cabbage.

[0068] Further, in the above method, the target plant can be a Chinese cabbage with higher resistance to downy mildew than the receptor plant.

[0069] To solve the above technical problem, in a third aspect, the present application provides a method for preparing a Chinese cabbage resistant to downy mildew, which comprises introducing the coding gene of the above gRNA molecule and the coding gene of the Cas protein into a receptor Chinese cabbage to inhibit or reduce the expression of the HSK kinase coding gene in the receptor plant or to inhibit or reduce the activity or content of the HSK kinase in the receptor plant, so as to obtain a target Chinese cabbage with higher disease resistance than the receptor Chinese cabbage.

[0070] Further, in the above method for regulating the disease resistance of a plant and / or the method for preparing a Chinese cabbage resistant to downy mildew, the inhibition or reduction of the expression of the HSK kinase coding gene in the receptor plant or the inhibition or reduction of the activity or content of the HSK kinase in the receptor plant is any one of the following mutations of sequence 1 in the sequence list:

[0071] M1) mutating the BraDMR1 gene into a BraDMR1-1 gene, which is a DNA molecule obtained by deleting the nucleotide C at position 395 of sequence 1 in the sequence list;

[0072] M2) mutating the BraDMR1 gene into a BraDMR1-2 gene, which is a DNA molecule obtained by mutating the deoxynucleotide G at position 343 of sequence 1 in the sequence list into A, mutating the deoxynucleotide T at position 337 into C, deleting the deoxynucleotide T at position 336, and mutating the deoxynucleotide C at position 313 into A;

[0073] M3) mutating the BraDMR1 gene into a BraDMR1-3 gene, which is a DNA molecule obtained by deleting the deoxynucleotide C at position 313 of sequence 1 in the sequence list.

[0074] To solve the above technical problems, the fourth aspect, the present application provides the protein in the above application or the biological material in the above application.

[0075] The present application clones a DMR1 gene BraDMR1 encoding HSK protein from the susceptible material of the second leaf of Chinese cabbage, the expression amount of the gene in the susceptible material is higher than that in the resistant material, and the expression amount of BraDMR1 is up-regulated after inoculation with Peronospora parasitica; the function of BraDMR1 in the susceptible material is studied by knocking out the gene using CRISPR-Cas9 technology, and it is found that the resistance of the susceptible material of the second leaf of Chinese cabbage to downy mildew is improved after the knockout of BraDMR1, and the area of the disease spot is reduced. BraDMR1 is expected to be used for genetic engineering breeding, and the material with enhanced resistance to downy mildew can be obtained after knocking out the BraDMR1 gene in the intermediate material in breeding, and the resistance of Chinese cabbage to downy mildew is improved.

[0076] By using the above scheme, the present application has the following advantages:

[0077] (1) The present application clones a HSK kinase gene BraDMR1 and the amino acid sequence encoded thereby from Chinese cabbage. The resistance of the susceptible material of the second leaf of Chinese cabbage to downy mildew is improved after the knockout of BraDMR1 in the susceptible material using CRISPR-Cas9 technology, and the area of the disease spot is reduced. The material with enhanced resistance to downy mildew can be obtained after the knockout of the gene.

[0078] (2) The present application starts from the angle of susceptible gene, verifies that there is a susceptible gene in Chinese cabbage that is beneficial to the infection of pathogenic bacteria, and verifies that the resistance of the plant to downy mildew is enhanced after the knockout of the susceptible gene, thereby providing a new strategy for the breeding of Chinese cabbage resistant to diseases.

[0079] (3) The technical scheme of the present application can obtain a Chinese cabbage strain with significantly higher resistance to downy mildew than the initial receptor Chinese cabbage variety. BRIEF DESCRIPTION OF DRAWINGS

[0080] Figure 1 It is a physical map of the sgRNA expression cassette.

[0081] Figure 2 It is a photo of the proportion of disease spot area of different single plants after the knockout of BraDMR1.

[0082] Figure 3 It is a detection of the knockout site of BraDMR1 in the knockout strain.

[0083] Figure 4 It is a column chart of the proportion of disease spot area of different single plants after the knockout of BraDMR1.

[0084] Figure 5The results of identifying resistance of the white cabbage single strain to downy mildew with partial knockout of the BraDMR1 gene are shown. DETAILED DESCRIPTION

[0085] The application will be further described in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0086] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0087] The glue leaves (also called R032) described in the following examples are a high-generation inbred line of Chinese cabbage, which is a downy mildew susceptible material. The 536 shallow (also called R031) described in the following examples is a high-generation inbred line of Chinese cabbage, which is a downy mildew resistant material. Both materials are preserved in the laboratory and are disclosed in the literature "Yu R, Su TB, Yu K, et al., 2016, Effects of seed germination and chloroplast spring on the present budding and flowering time of Brassica rapa L. Chinese Vegetables, (05):27-32." The above biological materials can be obtained from the applicant, and the obtained biological materials can only be used to verify the experiments of the application, and cannot be used for other purposes.

[0088] The pKSE401 vector and the pCBC-DT1T2 vector are provided by the State Key Laboratory of Plant Physiology and Biochemistry, College of Life Sciences, China Agricultural University. The pCBC-DT1T2 vector is disclosed in the literature "Application of CRISPR / Cas9 gene editing technology in plants. Master's thesis of China Agricultural University." The pKSE401 vector is disclosed in the literature "Su TB., Wang WH., Li P., et al., 2021, Natural variations of BrHISN2 provide a genetic basis for growth-flavour trade-off in different Brassica rapa subspecies. New Phytologist. 6(231):2186-2199." The above biological materials can be obtained from the applicant, and the obtained biological materials can only be used to verify the experiments of the application, and cannot be used for other purposes.

[0089] The Brassica rapa P. downy mildew is disclosed in the document "Zhang B., Li P., Su TB., 2018, BrRLP48, Encoding a Receptor-Like Protein, Involved in Downy Mildew Resistance in Brassica rapa. Frontiers in plant science, 9: 1708." The biological material can be obtained from the applicant, and the obtained biological material can only be used for verifying the experiments of the present application and cannot be used for other purposes.

[0090] The following examples use SPSS19.0 statistical software to process data, and the experimental results are expressed as mean ± standard deviation. One-way ANOVA test is used, * indicates significant difference (P<0.05), ** indicates extremely significant difference (P<0.01), and *** indicates extremely significant difference (P<0.001). In the following examples, unless otherwise specified, the test is set up in triplicate.

[0091] Example 1, obtaining of the target gene

[0092] 1.1, amplification of Brassica rapa BraDMR1 gene sequence

[0093] The primers BrDMR1-F and BrDMR1-R for amplifying the full-length of BraDMR1 gene are designed according to the Brassica rapa reference genome sequence, and the nucleotide sequences of BrDMR1-F and BrDMR1-R are as follows:

[0094] BrDMR1-F: 5'-ATGGCAACACTCTGCTTCCACTCT-3',

[0095] BrDMR1-R: 5'-TCACCTGGAGACGCTACTAACAAG-3'.

[0096] The DNA and RNA of the young leaves of the second leaf of the diseased material of Brassica rapa P. are extracted, and the RNA is reverse transcribed into cDNA. The RNA extraction uses Huaiyue RNA extraction kit, and the reagent for reverse transcription is TAKARA PrimeScript TMRT reagent Kit with gDNA Eraser kit, steps refer to the use of reagent kit instructions. With the cDNA of the second leaf of glue as the template, the primer BrDMR1-F and BrDMR1-R as the upper and lower primers to amplify the CDS full-length sequence of BraDMR1, and the DNA of the second leaf of glue as the template to amplify the DNA full-length sequence of BraDMR1. The PCR reaction system is as follows: cDNA / DNA 2 μl, 2 μl of upper and lower primers, Tks Gflex DNA Polymerase (1.25 U / μl) 1 μl, 2×Gflex PCR Buffer (Mg2+, dNTP plus) 25 μl, H2O 18 μl. The PCR reaction program is 94℃ pre-denaturation 1 min; 98℃ 10 sec, 55℃ 10 sec, 68℃ 45 sec, a total of 38 cycles; 4℃ storage. After the PCR product is recovered, it is connected to the pEASY-Blunt Zero vector, transformed into DH5α E. coli, and screened by single colony, sequenced, and analyzed to obtain the sequence of BraDMR1 in the second leaf of glue.

[0097] 1.2, sequence of the target gene and protein

[0098] The coding sequence of the BraDMR1 gene is a DNA molecule with the nucleotide sequence of SEQ ID No. 1, and the BraDMR1 gene has no intron, so the genomic sequence of the BraDMR1 gene is also a DNA molecule with the nucleotide sequence of SEQ ID No. 1. The amino acid sequence of the HSK kinase encoded by the Brassica rapa BraDMR1 gene is SEQ ID No. 2.

[0099] Table 1: sequence 1 and sequence 2

[0100]

[0101]

[0102] Example 2, preparation of BraDMR1 gene knockout strain

[0103] 2.1, selection of BraDMR1 knockout target and construction of knockout vector

[0104] 1) Construction of sgRNA expression cassette

[0105] The BrDMR1 gene knockout target sites T1 and T2 were designed according to CRIPSR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / ), primers DMR1-BsF, DMR1-F0, DMR1-R0 and DMR1-BsR were designed according to the sequences of the two target sites, and the sgRNA expression cassette DMR1-pCBC-DT1T2 with the target sequence was obtained by bridge PCR amplification using the pCBC-DT1T2 vector as a template.

[0106] The bridge PCR reaction system was as follows: Tks Gflex DNA Polymerase (1.25 U / μl) 1 μl, 2x Gflex PCR Buffer (Mg2+, dNTP plus) 25 μl, pCBC-DT1T2 (5 ng / μL) 1 μL, DMR1-BsF (20 μM) 1 μL, DMR1-F0 (1 μM) 1 μL, DMR1-R0 (1 μM) 1 μL, DMR1-BsR (20 μM) 1 μL, ddH2O 19 μL, and the total reaction volume was 50 μL. The reaction program was as follows: the first round: denaturation at 94°C for 1 min; the second round: denaturation at 98°C for 10 sec, annealing at 55°C for 10 sec, extension at 68°C for 45 sec, 38 cycles.

[0107] After the reaction, the product was detected by 1% agarose gel electrophoresis, the product fragment size was 603 bp, the gel block containing the target fragment was cut, and the fragment was recovered by a gel recovery kit. The gel recovery product was sequenced, and the sequence of DMR1-pCBC-DT1T2 is shown as sequence 3 in the sequence table. The 17-36th of sequence 3 is the coding sequence of sgRNA1, and the 568-586th is the coding sequence of sgRNA2. The map of DMR1-pCBC-DT1T2 is shown as Figure 1

[0108] Table 2: Sequence 3

[0109]

[0110]

[0111] The nucleotide sequences of the target sites and primers are as follows:

[0112] T1: GGCTGCGCCGTCGACGGCCT (Br1.5ch07g2309817-Br1.5ch07g2309836);

[0113] T1 is the 217-236th of SEQ ID No. 1;

[0114] ​T2: GGTCGGAGCTTCGAACTCA (Br1.5ch07g2309339-Br1.5ch07g2309358);

[0115] T2 is the reverse complement of SEQ ID No. 1 at positions 696-714;

[0116] DMR1-BsF: ATATATGGTCTCGATT GGCTGCGCCGTCGACGGCCT GTT (the underlined nucleotide sequence is target 1 (T1));

[0117] DMR1-F0: T GGCTGCGCCGTCGACGGCCT GTTTTAGAGCTAGAAATAGC (the underlined nucleotide sequence is target 1 (T1));

[0118] DMR1-R0: AAC TGAGTTCGAAGCTCCGACCC AATCTCTTAGTCGACTCTAC

[0119] (the underlined nucleotide sequence is the reverse complement of target 2 (T2));

[0120] DMR1-BsR: ATTATTGGTCTCGAAAC TGAGTTCGAAGCTCCGACCC AA (the underlined nucleotide sequence is the reverse complement of target 2 (T2));

[0121] 2) Construction of gene editing vector

[0122] DMR1-pCBC-DT1T2 and pKSE401 vectors were digested with Bsa I enzyme and then constructed into BraDMR1-401 vector.

[0123] Golden Gate digestion and ligation reaction: DMR1-pCBC-DT1T2 fragment with target sequence and pKSE401 vector were digested with Bsa I and ligated by T4 DNA Ligase to construct the recombinant vector named BraDMR1-401. The specific reaction system is as follows: DMR1-pCBC-DT1T2 fragment (100 ng / μL) 8 μL, pKSE401 (400 ng / μL) 2 μL, 10×T4 Ligase Buffer (NEB) 1.5 μL, 10×BSA 1.5 μL, BsaI (NEB) 1 μL, T4 DNA Ligase (NEB) 1 μL, total reaction volume 15 μL. The reaction program is as follows: first step: 37°C, 5h; second step: 50°C, 5min; third step: 80°C, 10min.

[0124] 3) Transformation of E. coli

[0125] The connected vector is transformed into E. coli DH5a by heat shock method. 10 μl of the ligation product is added to 50 μl of E. coli DH5a competent cells thawed on ice, mixed gently, and then placed on ice for 30 min. After being heated at 42°C for 85 s, it is quickly placed on ice, cooled for 2 min, and then 500 μl of blank LB liquid medium is added and placed in a 37°C shaking incubator at 180 rpm for 45-60 min. According to the copy number of the vector, an appropriate amount of bacterial liquid is coated on a solid LB medium containing 100 mM kana, and placed in a 37°C incubator for dark culture. After about 12 h, single colonies are picked and 500 μl of liquid LB medium (100 mM kana) is added and shaken for 6 h (37°C, 180 rpm) until the bacterial liquid becomes turbid. After PCR detection of the bacterial liquid, the positive single colony is sequenced, and the correct single colony is saved and the plasmid is extracted. When saving the bacterial liquid, 60% glycerol is mixed at a ratio of 1:1, mixed, and then stored at -80°C.

[0126] Plasmid extraction: 100 μl of the sequenced E. coli bacterial liquid is taken, 20 ml of fresh liquid LB medium (100 mM kana) is added, and it is cultured at 37°C, 180 rpm overnight. The plasmid is extracted using the Novizen plasmid extraction kit, and the extracted plasmid is stored after determining the concentration.

[0127] The sequencing results show that BraDMR1-401 is a recombinant expression vector in which the DMR1-pCBC-DT1T2 fragment shown in SEQ ID NO: 3 in the sequence table is replaced with the fragment between the Bsa I cleavage sites of the vector pKSE401, and the other sequences of the vector p6401 pKSE401 are kept unchanged. BraDMR1-401 expresses sgRNA1 (target sequence T1) and sgRNA2 (target sequence T2) targeting the BraDMR1 gene.

[0128] 4) Transformation of Agrobacterium

[0129] 1 μg of the extracted plasmid is added to 50 μl of Agrobacterium GV3101 competent cells, mixed, and then placed on ice for 10 min. It is frozen in liquid nitrogen for 5 min, immediately placed in a 37°C water bath for 5 min, taken out immediately and placed on ice for 5 min, and then fresh liquid LB medium is added and placed in a 28°C shaking incubator at 180 rpm for 2-3 h. 100 μl of the bacterial liquid is coated on a solid LB medium (100 mM kana, 50 mM rifampin) and placed in a 28°C incubator for dark culture. After 2 d, single colonies are picked and 1 ml of liquid LB medium (100 mM kana, 50 mM rifampin) is added and shaken for 24 h (28°C, 180 rpm) until the bacterial liquid becomes turbid. After PCR detection of the bacterial liquid, the positive single colony is saved.

[0130] 2.2, Obtaining of BraDMR1 knockout plants

[0131] The Agrobacterium carrying the BraDMR1-401 vector was used to infect the leaves of the rubber tree, and the transgenic plants were obtained by the following method:

[0132] 1) Seeding

[0133] The seeds were placed in a 10 ml centrifuge tube and about 5 ml of 75% ethanol was added, shaken for 45 s, and immediately all the alcohol was poured out in a clean bench, washed with cold sterile water for 3 times, added about 5 ml of sodium hypochlorite NaClO3, shaken for 8-10 min, immediately poured out all the liquid, washed with sterile water for 4-6 times, and then seeded on MS solid medium. After dark culture for 2 days, the seedlings were placed in a 16 h light and 8 h dark condition until the cotyledon fully expanded.

[0134] 2) Infection

[0135] After the cotyledon fully expanded, it was cut off and laid on MSO solid medium, and then infected with bacterial liquid after dark culture for 2 days. The bacterial liquid was directly poured into the petri dish with the laid cotyledon, shaken for 8-10 min, and then the bacterial liquid was absorbed, and then transferred to MS medium after dark culture for 2 days. Before infection, the Agrobacterium containing the BraDMR1-401 plasmid was cultured in liquid LB (kana 100 Mm, 50 mM rifampin, 100 μM AS) medium in a shaker (28°C, 180 rpm) to OD600=0.8-1.0, and then centrifuged at 4000 rpm for 10 min to collect the bacterial body, and then resuspended in liquid MSO medium (100 mg / ml NAA, 100 mg / ml 6-BA, 100 μM AS) to OD600=0.6.

[0136] 3) Screening culture

[0137] The infected cotyledon was transferred to MS medium, and the medium was replaced every 14 days or when the cotyledon turned yellow, until the regenerated seedlings appeared.

[0138] 4) Rooting

[0139] After the regenerated seedlings grew into strong root system, they were transplanted and planted.

[0140] 5) Planting

[0141] The root medium of the regenerated seedlings was completely removed, and then transplanted in a nutrient pot and bagged, and then the bag was gradually removed after the seedlings recovered.

[0142] The obtained gene edited plants were T0 generation, and T1 generation was obtained by selfing of T0 generation.

[0143] 2.3, Detection of knockout site of BraDMR1 knockout offspring

[0144] The obtained T1 generation of gene edited plants, disease material of wild type plants of Jia'erye, and disease resistant material 536 of wild type plants were sowed in 50-hole hole trays, DNA was extracted for PCR amplification, and the PCR products were sequenced for knockout site detection.

[0145] According to the sequencing results, three homozygous gene edited plants were obtained, which were named BraDMR1-CP1, BraDMR1-CP2 and BraDMR1-CP3 respectively. The results of knockout site detection of BraDMR1 in knockout strains are shown in Figure 3 Figure 3 Among them, Jia'erye is the wild type gene sequence before gene editing, and BraDMR1-CP1, BraDMR1-CP2 and BraDMR1-CP3 are the sequences after gene editing; however, since the gene is a reverse gene on the chromosome (the gene start site is located at the position 2310052, and the stop codon is located at the position 2308940), the sequence alignment is along the chromosome sequence (2308940 to 2310052), which is reverse complementary to the sequence of the gene (2310052 to 2308940).

[0146] The sequencing results show that:

[0147] Compared with Jia'erye wild type (Jia'erye), the BraDMR1 gene of BraDMR1-CP1 mutant is mutated to BraDMR1-1 gene. The BraDMR1-1 gene is a deletion of the 395th base (deoxynucleotide of C) in sequence 1 in the sequence table, and its coding sequence is a deletion of the base C at the 395th position in sequence 1 in the sequence table, resulting in a frameshift mutation and premature translation termination, thereby knocking out the BraDMR1 gene;

[0148] ​Compared with the wild type of Jiaer Ye (Jiaer Ye), the BraDMR1 gene of the BraDMR1-CP2 mutant is mutated into the BraDMR1-2 gene, the BraDMR1-2 gene is that the 343rd base (deoxynucleotide with base G) in sequence 1 in the sequence table is mutated into A (deoxynucleotide with base A), the 337th base (deoxynucleotide with base T) is mutated into C (deoxynucleotide with base C), the 336th base (deoxynucleotide with base T) is deleted, and the 313th base (deoxynucleotide with base C) is mutated into A (deoxynucleotide with base A), and the coding sequence is that the 343rd base (deoxynucleotide with base G) in sequence 1 in the sequence table is mutated into A (deoxynucleotide with base A), the 337th base (deoxynucleotide with base T) is mutated into C (deoxynucleotide with base C), the 336th base (deoxynucleotide with base T) is deleted, and the 313th base (deoxynucleotide with base C) is mutated into A (deoxynucleotide with base A), resulting in a frameshift mutation and premature translation termination, so as to knock out the BraDMR1 gene;

[0149] Compared with the wild type of Jiaer Ye (Jiaer Ye), the BraDMR1 gene of the BraDMR1-CP3 mutant is mutated into the BraDMR1-3 gene, the BraDMR1-3 gene is that the 313th base (deoxynucleotide with base C) in sequence 1 in the sequence table is deleted, and the coding sequence is that the 313th base (deoxynucleotide with base C) in sequence 1 in the sequence table is deleted, resulting in a frameshift mutation and premature translation termination, so as to knock out the BraDMR1 gene.

[0150] In the experiment, 100 T1 generation plants were identified, and only the above 3 homozygous knockout plants were screened out.

[0151] 2.4, Disease resistance identification of gene edited plants

[0152] T1 generation BraDMR1 knockout plants BraDMR1-CP1, BraDMR1-CP2 and BraDMR1-CP3, and non-knockout plants, wild type plants, disease-resistant material Jiaer Ye, wild type plants, and disease-resistant material 536 were inoculated with B. brassicae to identify disease resistance.

[0153] Preparation of pathogenic bacteria: B. brassicae is a living parasitic fungus. The B. brassicae inoculated on the cabbage for about 7 days was placed in an environment with humidity greater than 90% rh and darkness for 12 hours, and then the mold layer and B. brassicae spores were grown on the back of the leaf. After the B. brassicae spores were removed with a brush, they were suspended in water to prepare an infection liquid with a concentration of about 1.0x10 8 cfu.

[0154] Pathogen inoculation: The prepared pathogen suspension was sprayed on the back of all the leaves and cotyledons of the plants to be inoculated (genetically edited plants T1 generation BraDMR1-CP1, BraDMR1-CP2 and BraDMR1-CP3, Jia'erye wild type plants, disease-resistant material 536qian, T1 generation non-knockout plants), and placed in a 22℃, humidity greater than 90% rh, dark environment for 24h, and then placed in a 22℃, normal humidity, 16h light environment for 6d. On the 7th day, all the plants were placed in a 22℃, humidity greater than 90% rh, dark environment for 12h, and the resistance phenotype was observed. The resistance identification results were compared with the susceptible material wild type Jia'erye and the disease-resistant material 536qian.

[0155] The results are shown in Figure 2 and Figure 4 The results are shown in Figure 2 The results are shown in Figure 4 The results are shown in

[0156] The resistance of the genetically edited strains T1 generation BraDMR1-CP1, BraDMR1-CP2 and BraDMR1-CP3 was significantly enhanced compared with the susceptible parent Jia'erye (Jia'erye), and the rest of the non-knockout plants were consistent with the susceptible parent. Figure 5 The results are shown in

[0157] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In short, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which deviates from the scope disclosed in the present application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. Application, characterized in that: The application is C1), C2), or C3): C1) Application of HSK kinase-related biomaterials in improving resistance to downy mildew in Chinese cabbage; C2) Application of HSK kinase-related biomaterials in the preparation of products that enhance resistance to downy mildew in Chinese cabbage; C3) Application of HSK kinase-related biomaterials in the cultivation of downy mildew-resistant Chinese cabbage; The HSK kinase is a protein with the amino acid sequence SEQ ID No. 2; the downy mildew is a fungal disease of Chinese cabbage caused by the obligate parasitic downy mildew fungus (Peronospora parasitica (Pers) Fr.). The biomaterial is any one of B1) to B8) below: B1) RNA molecules that inhibit or reduce the expression of the gene encoding the HSK kinase or RNA molecules that inhibit or reduce the content of the HSK kinase; B2) The gene encoding the RNA molecule described in B1); B3), an expression cassette containing the gene encoding described in B2); B4), a recombinant vector containing the encoding gene described in B2), or a recombinant vector containing the expression cassette described in B3); B5) recombinant microorganisms containing the encoding gene described in B2), recombinant microorganisms containing the expression cassette described in B3), or recombinant microorganisms containing the recombinant vector described in B4); B6) A transgenic plant cell line containing the encoding gene described in B2), a transgenic plant cell line containing the expression cassette described in B3), or a transgenic plant cell line containing the recombinant vector described in B4); B7), transgenic plant tissue containing the encoding gene described in B2), transgenic plant tissue containing the expression cassette described in B3), or transgenic plant tissue containing the recombinant vector described in B4); B8) a transgenic plant organ containing the encoding gene described in B2), a transgenic plant organ containing the expression cassette described in B3), or a transgenic plant organ containing the recombinant vector described in B4).

2. The application according to claim 1, characterized in that: The HSK kinase was derived from cabbage.

3. The application according to claim 1 or 2, characterized in that: B1) The RNA molecule is a gRNA in the CRISPR / Cas9 system that targets the HSK kinase encoding gene. The nucleotide sequence of the target sequence of the gRNA is shown as positions 217-236 of SEQ ID No. 1 and the nucleotide sequence of the target sequence of the gRNA is shown as the reverse complementary sequence of positions 696-714 of SEQ ID No.

1.

4. The application according to claim 1, characterized in that: B2) The encoding gene is a DNA molecule that expresses gRNA targeting the HSK kinase encoding gene; the nucleotide sequence of the target sequence of the gRNA is shown as positions 217-236 of SEQ ID No. 1 and the nucleotide sequence of the target sequence of the gRNA is shown as the reverse complementary sequence of positions 696-714 of SEQ ID No.

1.

5. A method for improving the resistance of Chinese cabbage to downy mildew, characterized in that: The method includes improving the downy mildew resistance of cabbage by knocking out the encoding gene of the HSK kinase in the recipient cabbage, wherein the recipient cabbage contains the encoding gene of the HSK kinase, and the HSK kinase is a protein with the amino acid sequence SEQ ID No.

2.

6. The method according to claim 5, characterized in that: The method includes introducing the coding gene of the gRNA molecule and the coding gene of the Cas9 protein as described in claim 3 into the recipient Chinese cabbage to knock out the coding gene of the HSK kinase, thereby obtaining a target Chinese cabbage with higher resistance to downy mildew than the recipient Chinese cabbage.

7. The method according to claim 5 or 6, characterized in that: The HSK kinase-encoding gene knockout is achieved by mutating the gene shown in sequence 1 of the sequence listing using any of the following mutations: M1) The BraDMR1 gene is mutated into the BraDMR1-1 gene, which is a DNA molecule obtained by deleting nucleotide C at position 395 of sequence 1 in the sequence listing. M2) The BraDMR1 gene is mutated into the BraDMR1-2 gene, which is a DNA molecule obtained by mutating the deoxynucleotide G at position 343 of sequence 1 in the sequence listing to A, the deoxynucleotide T at position 337 to C, deleting the deoxynucleotide T at position 336, and mutating the deoxynucleotide C at position 313 to A. M3) The BraDMR1 gene is mutated into the BraDMR1-3 gene, which is a DNA molecule obtained by deleting the deoxynucleotide C at position 313 of sequence 1 in the sequence listing.

8. A method for preparing downy mildew-resistant Chinese cabbage, the method comprising introducing the coding gene of the gRNA molecule of claim 4 and the coding gene of the Cas9 protein into a recipient Chinese cabbage to knock out the coding gene of the HSK kinase in the recipient Chinese cabbage, thereby obtaining a target Chinese cabbage with downy mildew resistance higher than that of the recipient Chinese cabbage.

9. The method according to claim 8, characterized in that: The HSK kinase-encoding gene knockout is achieved by mutating the gene shown in sequence 1 of the sequence listing using any of the following mutations: M1) The BraDMR1 gene is mutated into the BraDMR1-1 gene, which is a DNA molecule obtained by deleting nucleotide C at position 395 of sequence 1 in the sequence listing. M2) The BraDMR1 gene is mutated into the BraDMR1-2 gene, which is a DNA molecule obtained by mutating the deoxynucleotide G at position 343 of sequence 1 in the sequence listing to A, the deoxynucleotide T at position 337 to C, deleting the deoxynucleotide T at position 336, and mutating the deoxynucleotide C at position 313 to A. M3) The BraDMR1 gene is mutated into the BraDMR1-3 gene, which is a DNA molecule obtained by deleting the deoxynucleotide C at position 313 of sequence 1 in the sequence listing.

Images