A nucleic acid reagent for plasma exosome and a kit for direct PCR amplification

By using a nucleic acid extraction reagent from plasma exosomes and a direct PCR amplification kit, along with immunomagnetic beads and PCR Mix solution, the problem of cumbersome and time-consuming nucleic acid extraction in existing technologies has been solved, achieving simplified operation and improved amplification efficiency.

CN115807054BActive Publication Date: 2026-02-273D BIOMEDICINE SCI & TECH CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202111083174.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-09-15
Publication Date
2026-02-27
Estimated Expiration
2041-09-15

AI Technical Summary

Technical Problem

In existing technologies, nucleic acid PCR detection of plasma exosomes requires nucleic acid extraction and purification, which is cumbersome and time-consuming. Furthermore, commonly used PCR amplification reagents are not resistant enough to the inhibitors in the system, affecting the detection results.

Method used

A reagent kit for nucleic acid extraction from plasma exosomes and direct PCR amplification is provided, comprising polidocanol and Tris-HCl solution, as well as magnetic bead suspension and PCR Mix solution. Nucleic acid amplification is performed directly using immunomagnetic beads and PCR Mix solution, simplifying the operation process and improving amplification efficiency.

Benefits of technology

This method enables extraction-free direct PCR amplification of nucleic acids from plasma exosomes, simplifying the operation process, improving exosome recovery rate and PCR amplification efficiency, and reducing harm to operators and the environment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115807054B_ABST
    Figure CN115807054B_ABST
Patent Text Reader

Abstract

The application discloses a nucleic acid free extraction reagent of plasma exosome and a direct PCR amplification kit. The nucleic acid free extraction reagent comprises 0.001-0.1% polidocanol and 1-100 mM Tris-HCl in mass volume concentration, and the solvent is water. The direct PCR amplification kit provided by the application comprises the nucleic acid free extraction reagent and an immunomagnetic bead suspension, a washing liquid, a free extraction reagent and a PCR Mix solution; the surface of the immunomagnetic bead is simultaneously coated with three exosome specific antibodies of CD9, CD63 and CD81, so that the recovery rate of the exosome can be greatly improved during the extraction and purification of the plasma exosome; the PCR Mix solution contains an anti-inhibitory component, can effectively neutralize the inhibitors such as proteins in the PCR system, and ensures the amplification efficiency of the PCR. The nucleic acid free extraction reagent of the application can realize the amplification detection of the exosome nucleic acid free extraction, and simplifies the operation process of the PCR detection.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological detection, and particularly relates to a nucleic acid non-lifting reagent for plasma exosomes and a kit for direct PCR amplification. BACKGROUND

[0002] Exosomes are 30-150 nm-sized, extremely low-density extracellular nanoscale cystic structures formed by cells through a series of regulated processes such as "endocytosis-fusion- exocytosis". Exosomes have not attracted the attention of researchers for a long time since they were discovered. Until the introduction of nanotechnology and the announcement of the Nobel Prize in Biomedicine in 2013, this particle with a diameter of only tens of nanometers has received unprecedented attention.

[0003] According to research reports, the contents contained in exosomes such as DNA, RNA, protein and signal complex play an important role in the regulation of gene and protein expression in receptor cells. For example, the miRNA in plasma exosomes (exosomal-miRNA) has a unique function of mediating intercellular communication and can specifically inhibit the expression of target genes in target cells, so compared with free miRNA, the change in the level of plasma exosomal-miRNA can better represent the change in the biological function of malignant tumors. In addition, tumor cell-derived exosomes can also regulate the formation of pre-metastatic microenvironments through the delivery of miRNA.

[0004] At present, the detection of nucleic acids in exosomes in plasma on the market needs to extract and purify the internal nucleic acids first, and then perform PCR amplification detection. The specific operation is as follows:

[0005] 1. Exosome extraction: usually adopt methods such as fiber membrane adsorption, precipitation reagent precipitation, centrifugation and immunoadsorption to separate and enrich exosomes.

[0006] 2. Exosome nucleic acid extraction: the separated exosomes are usually lysed by Trizol or high-salt method, and then the nucleic acid is purified to obtain the nucleic acid product, and finally the PCR detection is performed.

[0007] The current PCR detection of nucleic acids in plasma exosomes has the following shortcomings:

[0008] 1. Nucleic acid purification in exosomes is needed, and the commonly used method is tedious in operation steps, time-consuming, and most of the reagents used are toxic, which may cause harm to the operator's body and environment.

[0009] 2. The commonly used PCR amplification reagent has insufficient resistance to inhibitors in the system, and a high-purity template is required for amplification. If the nucleic acid entering the amplification system has low purity, it will have an inhibitory effect on PCR amplification, thereby affecting the PCR amplification result. SUMMARY

[0010] The purpose of the present application is to provide a nucleic acid extraction-free reagent for plasma exosomes and a direct PCR amplification kit. The technical problem of the prior art that the nucleic acid PCR detection in exosomes needs to be extracted and purified first, and the operation steps are complicated and time-consuming is solved.

[0011] The technical solution adopted by the present application to solve the above technical problems is as follows:

[0012] A nucleic acid extraction-free reagent for plasma exosomes comprises 0.001-0.1% polidocanol and 1-100 mM Tris-HCl in terms of mass volume concentration, and the solvent is water.

[0013] As a preferred embodiment, the extraction-free reagent comprises 0.001-0.05% polidocanol and 1-50 mM Tris-HCl in terms of mass volume concentration.

[0014] As a preferred embodiment, the extraction-free reagent comprises 0.05% polidocanol and 50 mM Tris-HCl with pH 6.5 in terms of mass volume concentration.

[0015] The polidocanol in the present application refers to a surfactant hardener with a molecular weight of 582.8, and the molecular formula is C 30 H 62 O 10 .

[0016] The present application also provides a direct PCR amplification kit, which comprises the nucleic acid extraction-free reagent.

[0017] As a preferred embodiment, the kit further comprises an immunomagnetic bead suspension, which comprises carboxyl magnetic beads with a particle size of 150 nm-4 um, the concentration of the magnetic beads is 1-30 mg / ml, the surface of the magnetic beads is coated with an exosome-specific antibody, and the concentration of the antibody is 0.01-1 mg / ml.

[0018] As a preferred embodiment, the solution system of the magnetic bead suspension is 40-60 mM Tris, 0.1-0.2 M NaCl, 0.4-0.5 M sucrose, 0.4%-0.6% BSA in terms of mass volume concentration, and the solvent is water.

[0019] As a preferred embodiment, the magnetic bead surface-coated exosome-specific antibody is CD9, CD63 and CD81. Further preferably, the concentration of the magnetic bead surface-coated exosome-specific antibody CD9, CD63 and CD81 is 0.1 mg / ml.

[0020] As a preferred embodiment, the kit further comprises a PCR Mix solution, which is composed of 0.1-100 mM MgCl, 10-500 mM KCl, 1-5% (volume concentration) glycerol, 0.01-0.5% (volume concentration) NP-40, 1-5 U Taq enzyme, 0.1-50 mM dNTPs, 0.1-20% (volume concentration) DMSO, 10-100 μg / ml BSA, 10-500 mM (NH4)2SO4, 0.1-50 mM TMAC, 1-5 U reverse transcriptase, 0.1-5 U UNG enzyme, 0.1-5 U RNA inhibitor, and water as solvent.

[0021] As a preferred embodiment, the PCR Mix solution is composed of 5 mM MgCl, 50 mM KCl, 3% glycerol, 0.5% NP-40, 3 U Taq enzyme, 0.3 mM dNTPs, 0.3% DMSO, 50 μg / ml BSA, 100 mM (NH4)2SO4, 20 mM TMAC, 3 U reverse transcriptase, 0.5 U UNG enzyme, 0.5 U RNA inhibitor, and water as solvent.

[0022] As a preferred embodiment, the kit further comprises a washing solution, which is composed of 1-20 mM Na2HPO4, 0.5-10 mM NaH2PO4, 0.1-2 M NaCl and 0.01-1% (volume concentration) TWEEN-20, and water as solvent.

[0023] As a preferred embodiment, the washing solution is composed of 8 mM Na2HPO4, 2 mM NaH2PO4, 0.15 M NaCl and 0.05% (volume concentration) TWEEN-20, and water as solvent.

[0024] The kit provided by the present application is used for a nucleic acid extraction-free direct PCR amplification method of plasma exosomes, which comprises the following steps:

[0025] (1) 1 mL of plasma sample is added into a centrifuge tube, then 50 μL of immunomagnetic bead suspension is added, and the mixture is fully shaken and mixed, and then incubated at room temperature for 15 min;

[0026] (2) The centrifuge tube is instantaneously centrifuged for about 5 s, and then placed on a magnetic stand for 1 min, and then the liquid is aspirated and discarded;

[0027] (3) add 1 mL of washing solution, mix well, centrifuge for about 5 s, place on the magnetic stand for 1 min, and aspirate the liquid;

[0028] (4) add 100 μL of nucleic acid extraction reagent, mix well, and shake incubate at 37 DEG C for 5 min;

[0029] (5) centrifuge the obtained mixture for about 5 s, and place on the magnetic stand for 1 min;

[0030] (6) add PCR Mix solution and amplification primer probe in the PCR tube, add the supernatant in (5) into the PCR tube, mix well, and centrifuge;

[0031] (7) qPCR machine detection.

[0032] Compared with the prior art, the present application has the following beneficial effects:

[0033] 1. The nucleic acid extraction reagent of the present application can realize the extraction of exosome nucleic acid without extraction and direct amplification detection, simplifying the operation process of PCR detection.

[0034] 2. The immunomagnetic beads used in the present application are coated with CD9, CD63 and CD81, three exosome-specific antibodies, which can greatly improve the recovery rate of exosomes during plasma exosome extraction and purification.

[0035] 3. The PCR amplification reagent of the present application contains DMSO and BSA, which can effectively neutralize the inhibitors such as proteins in the PCR system, ensuring the amplification efficiency of PCR. DETAILED DESCRIPTION

[0036] Figure 1 is the PCR amplification result graph of the plasma exosome nucleic acid extraction detection of B2M gene in Example 1 of the present application.

[0037] Figure 2 is the Ct value comparison graph of the nucleic acid extraction detection and ordinary detection kit for different samples in Example 2 of the present application.

[0038] Figure 3 is the amplification result comparison graph of the PCR Mix solution and ordinary PCR reaction solution in Example 3 of the present application.

[0039] Figure 4 is the amplification result comparison graph of the three-antibody immunomagnetic bead suspension and single / double-antibody immunomagnetic bead suspension in Example 4 of the present application.

[0040] Figure 5 is the PCR amplification graph of the three nucleic acid extraction reagent formulations in Example 5 of the present application. DETAILED DESCRIPTION

[0041] The technical solutions of the present application are described in detail below in combination with examples. The reagents and biological materials used below are commercial products unless otherwise specified.

[0042] Example 1: B2M gene detection in plasma exosomes

[0043] (1) Add 1 mL of plasma sample into a centrifuge tube, then add 50 μL of immunomagnetic bead suspension (magnetic bead concentration is 1 mg / ml), and the solution system of the magnetic bead suspension is: 50 mM Tris, 0.15 M NaCl, 0.45 M sucrose, 0.5% (mass / volume percentage) BSA, solvent is water. Shake well, shake incubate at room temperature for 15 min;

[0044] (2) Centrifuge the centrifuge tube for about 5 s, place it on a magnetic stand for 1 min, and discard the liquid;

[0045] (3) Add 1 mL of washing solution (8 mM Na2HPO4, 2 mM NaH2PO4, 0.15 M NaCl and 0.05% (v / v) TWEEN-20), shake well, centrifuge for about 5 s, place on a magnetic stand for 1 min, and discard the liquid;

[0046] (4) Add 100 μL of nucleic acid release reagent (0.05% polidocanol and 50 mM Tris-HCl, pH 6.5), shake well, and shake incubate at 37°C for 5 min;

[0047] (5) Centrifuge the resulting mixture for about 5 s, and place it on a magnetic stand for 1 min;

[0048] (6) Add 29 μL of PCR Mix solution (5 mM MgCl, 50 mM KCl, 3% glycerol, 0.5% NP40, 3 U Taq enzyme, 0.3 mM dNTPs, 0.3% DMSO, 50 μg / ml BSA, 100 mM (NH4)2SO4, 20 mM TMAC, 3 U reverse transcriptase, 0.5 U UNG enzyme, 0.5 U RNA inhibitor) and 1 μL of 10 μM B2M (DNA) amplification primer probe into a PCR tube, wherein the primer sequence is: F: AAGTCAAGCCTAACCAGGGC (SEQ ID NO: 1), R: TGCGTGAGATTCTCCAGAGC (SEQ ID NO: 2), and the probe sequence is P: GCCTTTTGGCTGTAATTCGTG (SEQ ID NO: 3), transfer 20 μL of the supernatant in (5) into the PCR tube, shake well, and centrifuge;

[0049] (7) qPCR machine detection.

[0050] Reference Figure 1 , the PCR amplification results of the B2M gene in the plasma exosome nucleic acid non-extraction detection. From Figure 1 It can be seen that the B2M (DNA) gene detection in the plasma exosome using the method of the application can detect the B2M gene amplification in 8 detection samples, and the amplification curve is good.

[0051] Example 2: Comparison of nucleic acid non-extraction detection and ordinary extraction method detection in plasma exosome

[0052] The specific component content of the immune magnetic bead suspension, washing solution, nucleic acid non-extraction reagent and PCR Mix solution used in this example is the same as that in Example 1.

[0053] A: Nucleic acid non-extraction detection in plasma exosome

[0054] (1) Add 1 mL of plasma sample to a centrifuge tube, then add 50 μL of immune magnetic bead suspension, shake well, shake and incubate at room temperature for 15 min;

[0055] (2) Centrifuge the centrifuge tube for about 5 s, place it on a magnetic stand for 1 min, and aspirate the liquid;

[0056] (3) Add 1 mL of washing solution, shake well, centrifuge for about 5 s, place on a magnetic stand for 1 min, and aspirate the liquid;

[0057] (4) Add 50 μL of nucleic acid non-extraction reagent, shake well, and shake and incubate at 37°C for 5 min;

[0058] (5) Centrifuge the resulting mixture for about 5 s, place it on a magnetic stand for 1 min;

[0059] (6) Add 29 μL of PCR Mix solution and 1 μL of 10 μM actin (RNA) amplification primer probe to the PCR tube, wherein the primer sequence is: F: CAAGCCAGAGCGAGGC (SEQ ID NO: 4), R: ACGATTTCTCCGATGG (SEQ ID NO: 5), and the probe sequence is: P: TCCAACGTCAACAAGGCCCTG (SEQ ID NO: 6), transfer 20 μL of the supernatant in (5) to the PCR tube, shake well, and centrifuge;

[0060] (7) qPCR machine detection.

[0061] B: Ordinary extraction method detection - QIAGEN-exoRNeasy Midi Kit (Cat 77144)

[0062] First step: Isolation of exosome vesicles

[0063] (1) Add 1 mL of plasma sample into a centrifuge tube, then add 1x volume of Buffer XBP, invert gently 5 times, mix well;

[0064] (2) Transfer the mixed solution in (1) into an exoEasy spin column, centrifuge at 500g for 1 min, discard the liquid in the collection tube, put the spin column back into the collection tube (if there is still liquid left on the filter membrane, centrifuge the spin column at 5000g for 1 min again, make sure all the liquid has passed through the filter membrane);

[0065] (3) Add 3.5 mL of Buffer XWP, centrifuge at 5000g for 1 min, discard the collection tube;

[0066] (4) Transfer the spin column into a new collection tube;

[0067] (5) Add 700 μL of QIAzol reagent onto the filter membrane of the spin column, centrifuge at 5000g for 5 min, collect the centrifuged liquid, then transfer it into a 2 mL centrifuge tube.

[0068] Second step: RNA isolation

[0069] (1) Vortex the centrifuge tube in step (5) of the first step, let it stand at room temperature (15-25°C) for 5 min;

[0070] (2) Add 90 μL of chloroform, vortex for 15 s with the cap on;

[0071] (3) Let it stand at room temperature for 2-3 min;

[0072] (4) Centrifuge at 12000g for 15 min at 4°C;

[0073] (5) Transfer the uppermost liquid in the centrifuge tube into a new centrifuge tube, then add 2x volume of absolute ethanol, vortex to mix well;

[0074] (6) Transfer 70 μL of the mixed solution in (5) into an RNeasy MinElute spin column, centrifuge at 8000g for 15 s at room temperature, discard the liquid in the collection tube;

[0075] (7) Repeat step (6) until all the liquid in (5) is transferred;

[0076] (8) Add 700 μL of Buffer RWT into the MinElute spin column, centrifuge at 8000g for 15 s, discard the liquid in the collection tube;

[0077] (9) Add 500 μL of Buffer RPE to the MinElute spin column, centrifuge at 8000 g for 15 s, and discard the flow-through;

[0078] (10) Add 500 μL of Buffer RPE to the MinElute spin column, centrifuge at 8000 g for 2 min, and discard the flow-through;

[0079] (11) Transfer the MinElute spin column to a new 2 mL collection tube, centrifuge at 20000 g for 5 min, and discard the flow-through;

[0080] (12) Transfer the MinElute spin column to a new 1.5 mL collection tube, add 50 μL of nuclease-free water to the membrane, and centrifuge at 20000 g for 1 min, and the 1.5 mL tube contains the RNA;

[0081] (13) qPCR uses QIAGEN's QuantiTect Probe RT-PCR Kit (cat: 204443); prepare 29 μL of PCR Mix, add 1 μL of 10 μM of actin (RNA) amplification primer probe, transfer 20 μL of the collected liquid in (12) to the PCR tube, shake and mix, and centrifuge;

[0082] (14) qPCR machine detection.

[0083] Reference Figure 2 is the Ct value comparison chart of the nucleic acid extraction-free detection of the application and the ordinary detection kit for different samples. From Figure 2 It can be seen that: among the 7 detection samples, the Ct value of the PCR amplification detection of the application is earlier than that of the comparison group, which shows that the method of the application is superior to the comparison group in the effect of exosome nucleic acid detection.

[0084] Example 3: Comparison of the PCR Mix solution of the application and the ordinary PCR reaction liquid

[0085] The specific component content of the immunomagnetic bead suspension, the washing liquid, the nucleic acid extraction-free reagent, and the PCR Mix solution used in this example is the same as that in Example 1.

[0086] (1) Add 1 mL of plasma sample to the centrifuge tube, then add 50 μL of immunomagnetic bead suspension, shake and mix thoroughly, and shake and incubate at room temperature for 15 min;

[0087] (2) Centrifuge the centrifuge tube for about 5 s, place it on the magnetic stand for 1 min, and aspirate the liquid;

[0088] (3) Add 1 mL of washing solution, shake well, centrifuge for about 5 s, place on the magnetic stand for 1 min, and aspirate the liquid;

[0089] (4) Add 50 μL of nucleic acid extraction reagent, shake well, and shake incubate at 37°C for 5 min;

[0090] (5) The resulting mixture is centrifuged for about 5 s, and placed on the magnetic stand for 1 min;

[0091] (6) Prepare the PCR Mix solution according to the application, and add 29 μL of the PCR Mix solution and 1 μL of 10 μM actin (RNA) amplification primer probe to the PCR tube;

[0092] (7) Purchase a commonly used PCR reaction solution on the market (item number: ThermoFisher AM1005), prepare the PCR Mix according to the instructions, and add 29 μL of the PCR Mix and 1 μL of 10 μM actin (RNA) amplification primer probe (the specific sequence of the primer probe is the same as in Example 2) to the PCR tube;

[0093] (8) Transfer 20 μL of the supernatant in (5) to the PCR tubes in steps (6) and (7), shake well, and centrifuge;

[0094] (9) qPCR machine detection.

[0095] Reference Figure 3 is a comparison chart of the amplification results of the PCR Mix solution of the application and the ordinary PCR reaction solution. From Figure 3 It can be seen that the Ct value of the PCR Mix amplification in the method of the application is earlier than that of the control group, indicating that the PCR Mix of the application is superior to the selected control group in PCE amplification efficiency.

[0096] Example 4: Comparison of the three-antibody immunomagnetic bead suspension of the application with the single / double-antibody immunomagnetic bead suspension

[0097] The immunomagnetic bead suspension, washing solution, nucleic acid extraction reagent, and PCR Mix solution used in this example contain the same specific component contents as in Example 1.

[0098] Three kinds of magnetic bead suspensions coated with different antibodies are selected for comparison

[0099] a. Immunomagnetic bead suspension coated with CD9, CD63, and CD81 antibodies

[0100] b. Immunomagnetic bead suspension coated with CD9 and CD63 antibodies

[0101] c. Immunomagnetic bead suspension coated with CD63 antibodies

[0102] (1) Add 1 mL of plasma sample into a centrifuge tube, then add 50 μL of the three kinds of immunomagnetic bead suspensions respectively according to the experimental design, shake well, and shake incubate at room temperature for 15 min;

[0103] (2) Centrifuge the centrifuge tube for about 5 s, place it on a magnetic stand for 1 min, and aspirate the liquid;

[0104] (3) Add 1 mL of washing solution, shake well, centrifuge for about 5 s, place it on a magnetic stand for 1 min, and aspirate the liquid;

[0105] (4) Add 50 μL of nucleic acid extraction-free reagent, shake well, and shake incubate at 37°C for 5 min;

[0106] (5) Centrifuge the resulting mixture for about 5 s, place it on a magnetic stand for 1 min;

[0107] (6) Add 29 μL of PCR Mix solution and 1 μL of 10 μM actin (RNA) amplification primer probe (the specific sequence of the primer probe is the same as that in Example 2) into a PCR tube according to the preparation of the PMix solution of the present application; transfer 20 μL of the supernatant in (5) into the PCR tube, shake well, and centrifuge;

[0108] (7) qPCR machine detection.

[0109] Reference Figure 4 is a comparison chart of amplification results of the three-antibody immunomagnetic bead suspension and the single / double-antibody immunomagnetic bead suspension. It can be seen from Figure 4 that the effect of single-antibody coated magnetic beads is the worst, the effect of two antibodies is better than that of one antibody, and the effect of the three-antibody coated magnetic beads of the present application is the best, which has obvious advantages in PCR amplification detection.

[0110] Example 5: End value detection of the nucleic acid extraction-free reagent formula of the present application

[0111] The concentration range of the extraction-free reagent formula is verified, and the following three kinds of nucleic acid extraction-free reagents with different concentrations are prepared.

[0112] ① 0.001% polidocanol, 1 mM Tris-HCl

[0113] ② 0.05% polidocanol, 50 mM Tris-HCl

[0114] ③ 0.1% polidocanol, 100 mM Tris-HCl

[0115] The immunomagnetic bead suspension, washing solution, and PCR Mix solution used in this example contain the same specific component contents as those in Example 1.

[0116] (1) Add 1 mL of plasma sample into a centrifuge tube, then add 50 μL of immunomagnetic bead suspension according to the experimental design, shake well, shake and incubate at room temperature for 15 min;

[0117] (2) Centrifuge the centrifuge tube for about 5 s, place it on a magnetic stand for 1 min, and aspirate the liquid;

[0118] (3) Add 1 mL of washing solution, shake well, centrifuge for about 5 s, place it on a magnetic stand for 1 min, and aspirate the liquid;

[0119] (4) Add 50 μL of the above-mentioned three nucleic acid stripping reagents, shake well, and shake and incubate at 37℃ for 5 min;

[0120] (5) Centrifuge the obtained mixture for about 5 s, and place it on a magnetic stand for 1 min;

[0121] (6) Prepare the PCR Mix solution according to the application, add 29 μL of the PCR Mix solution and 1 μL of 10 μM of the amplification primer probe of actin (RNA) (the specific sequence of the primer probe is the same as that in Example 2) into a PCR tube; transfer 20 μL of the supernatant in (5) into the PCR tube, shake well, and centrifuge;

[0122] (7) qPCR machine detection.

[0123] Reference Figure 5 PCR amplification diagram for testing the formula of the three nucleic acid stripping reagents. From Figure 5 It can be seen that: in the nucleic acid stripping reagent formula provided in the application scheme, the end value of the concentration can also achieve good experimental results.

[0124] The above are only some preferred embodiments of the application, and the application is not limited to the contents of the embodiments. For those skilled in the art, various changes and modifications can be made within the concept of the technical scheme of the application, and any changes and modifications made are within the protection scope of the application. SEQUENCE LISTING <110> Shanghai Sidu Di Biomedicine Technology Co., Ltd. <120> A nucleic acid stripping reagent for plasma exosome and a kit for direct PCR amplification <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Primer <400> 1 aagtcaagcc taaccagggc 20 <210> 2 <211> 20 <212> DNA <213> primer <400> 2 tgcgtgagat tctccagagc 20 <210> 3 <211> 21 <212> DNA <213> probe <400> 3 gccttttggc tgtaattcgt g 21 <210> 4 <211> 16 <212> DNA <213> primer <400> 4 caagccagag cgaggc 16 <210> 5 <211> 16 <212> DNA <213> primer <400> 5 acgatttctc cgatgg 16 <210> 6 <211> 21 <212> DNA <213> probe <400> 6 tccaacgtca acaaggccct g 21

Claims

1. A kit for direct PCR amplification, characterized by: The kit includes a plasma exosome nucleic acid extraction reagent, an immunomagnetic bead suspension, and a PCR Mix solution; The plasma exosome nucleic acid extraction reagent consists of 0.001–0.1% polydocaol and 1–100 mM Tris-HCl, with water as the solvent. The immunomagnetic bead suspension contains carboxyl magnetic beads with a particle size of 150 nm to 4 μm, a magnetic bead concentration of 1 to 30 mg / ml, and exosome-specific antibodies coated on the surface of the magnetic beads with an antibody concentration of 0.01 to 1 mg / ml. The PCR Mix solution consists of: 0.1–100 mM MgCl2, 10–500 mM KCl, 1–5% glycerol (v / v), 0.01–0.5% NP-40 (v / v), 1–5 U Taq enzyme, 0.1–50 mM dNTPs, 0.1–20% DMSO (v / v), 10–100 μg / ml BSA, 10–500 mM (NH4)2SO4, 0.1–50 mM TMAC, 1–5 U reverse transcriptase, 0.1–5 U UNG enzyme, 0.1–5 U RNA inhibitor, and water as the solvent.

2. The kit for direct PCR amplification according to claim 1, wherein: The plasma exosome nucleic acid extraction reagent consists of 0.001–0.05% polydocaol and 1–50 mM Tris-HCl.

3. The kit for direct PCR amplification as claimed in claim 2, wherein: The plasma exosome nucleic acid extraction reagent consists of 0.05% polydextrose and 50mM Tris-HCl at pH 6.

5.

4. The kit for direct PCR amplification as claimed in claim 1 wherein: The solution system of the magnetic bead suspension is: 40-60mM Tris, 0.1-0.2M NaCl, 0.4-0.5M sucrose, BSA with a mass-volume concentration of 0.4%-0.6%, and water as the solvent.

5. The direct PCR amplification kit as described in claim 1, characterized in that: The exosome-specific antibodies coated on the surface of the magnetic beads are CD9, CD63, and CD81.

6. The kit for direct PCR amplification as described in claim 5, characterized in that: The magnetic beads were coated with exosome-specific antibodies CD9, CD63, and CD81 at a concentration of 0.1 mg / ml.

7. The direct PCR amplification kit as described in claim 1, characterized in that, The PCR Mix solution consisted of: 5 mM MgCl2, 50 mM KCl, 3% glycerol, 0.5% NP-40, 3 U Taq enzyme, 0.3 mM dNTPs, 0.3% DMSO, 50 μg / ml BSA, 100 mM (NH4)2SO4, 20 mM TMAC, 3 U reverse transcriptase, 0.5 U UNG enzyme, 0.5 U RNA inhibitor, and water as the solvent.

8. The kit for direct PCR amplification as described in claim 1, characterized in that: The kit also includes a washing solution composed of 1–20 mM Na₂HPO₄, 0.5–10 mM NaH₂PO₄, 0.1–2 M NaCl, and 0.01–1% TWEEN-20 by volume, with water as the solvent.

9. The direct PCR amplification kit as described in claim 8, characterized in that, The washing solution consists of 8 mM Na2HPO4, 2 mM NaH2PO4, 0.15 M NaCl, and 0.05% TWEEN-20 (volume concentration), with water as the solvent.

Citation Information

Patent Citations

  • Primer, probe and reagent kit for quick and quantitative detection by AR-V7 fluorescent qRT-PCR method

    CN110923299A

  • Method for detecting nucleic acid molecules in exosomes

    CN113151398A

  • Therapies for the regulation of insulin and glucose using RLIP76

    US20060104983A1

  • Ceramidase gene

    US6830919B1